ID: 928348962

View in Genome Browser
Species Human (GRCh38)
Location 2:30529284-30529306
Sequence GCACATTTCTGTGCTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928348962 Original CRISPR GCACATTTCTGTGCTAAAAG AGG Intronic
907808962 1:57849576-57849598 GATCATTTCTTTTCTAAAAGTGG - Intronic
908445329 1:64194402-64194424 GAACTTTTCAGTGCTAAAACTGG - Intergenic
908490006 1:64634040-64634062 GCAGATTTCTGTGTTAACTGTGG + Exonic
908588123 1:65596979-65597001 GCAGAGTTCTTTGCTAAAACTGG - Intronic
909611031 1:77552033-77552055 GCAGAGTTCTTTGCTAAAACTGG - Intronic
913480456 1:119283771-119283793 GCACACTTCAGTGGGAAAAGAGG - Intergenic
916601512 1:166297777-166297799 GCATATCTCTGTGCTAAAAGTGG - Intergenic
920095143 1:203481887-203481909 ACACGTTTCTTTGCTAAAAATGG - Intronic
921035943 1:211378347-211378369 TCACATTGCTGTGCTACAAAGGG - Intergenic
923266564 1:232319988-232320010 GCCCATTGCTGTGCCAAGAGCGG - Intergenic
924728007 1:246687810-246687832 AAACATTTCTGTGGTAAAGGAGG - Intergenic
1067398752 10:45950912-45950934 GAAAATTTCTGTGCAAAAAAAGG + Intergenic
1067531666 10:47078705-47078727 GAACTTTTCTGTCTTAAAAGAGG - Intergenic
1067867071 10:49920006-49920028 GAAAATTTCTGTGCAAAAAAAGG + Intronic
1068416640 10:56732733-56732755 GTACATTTCTGCTCAAAAAGGGG - Intergenic
1068823011 10:61400069-61400091 CCACATTTCTATGCTCAAAGTGG - Intergenic
1072143049 10:92607450-92607472 GCACAGTTATATGATAAAAGAGG + Intronic
1074717880 10:116236326-116236348 GCACCTTTCTCTGCTGAAAGGGG - Intronic
1074925097 10:118060600-118060622 GCCCAAATCAGTGCTAAAAGTGG + Intergenic
1075931608 10:126301546-126301568 CCACATTTCTAGGCTAAATGAGG + Intronic
1078586095 11:12590581-12590603 GCACATTTTCCTCCTAAAAGGGG + Intergenic
1078960209 11:16257494-16257516 GGACATTTATGTGCAAAAGGAGG + Intronic
1080662146 11:34305357-34305379 GCACACTTCTCTCCTCAAAGAGG + Intronic
1081137878 11:39461588-39461610 ACACATTTCTGTGGATAAAGTGG - Intergenic
1083111493 11:60413677-60413699 GCACATTACTGTGCCATTAGTGG - Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1083415124 11:62520562-62520584 GGACATTTCTCTGCCCAAAGTGG - Exonic
1087965655 11:104410878-104410900 GAACATTTCTGTCTTACAAGAGG - Intergenic
1091353790 11:134919577-134919599 GCAAATTACTGTGATTAAAGGGG + Intergenic
1093824759 12:23670441-23670463 GCACATTTATTGGCTGAAAGGGG + Intronic
1094338867 12:29388696-29388718 GCATAATTGTATGCTAAAAGTGG + Intergenic
1094863903 12:34505347-34505369 GGACATTTCTGAGCTCAATGAGG - Intergenic
1096078996 12:48821558-48821580 GCCCAGAACTGTGCTAAAAGAGG - Intronic
1096203436 12:49702903-49702925 GCCCATTTCTGTGTCAAAGGAGG + Intronic
1097557455 12:61156888-61156910 ACACCTTTCTTTGCTAAAACAGG - Intergenic
1097904541 12:64906255-64906277 GCTCTTCTCTGTTCTAAAAGTGG - Intergenic
1099720416 12:86355273-86355295 GAACATTTCTGTCTTAGAAGAGG - Intronic
1100683032 12:96949772-96949794 GCAGATTTATGTGCAAAAAATGG + Intronic
1101048011 12:100830852-100830874 CCACACTTTTGTGCTCAAAGTGG - Intronic
1107655164 13:42585483-42585505 TCAGAGTTCTGTGCTAAAGGGGG - Intronic
1107688075 13:42924047-42924069 GAACATTTCTTTGTAAAAAGAGG - Intronic
1107995221 13:45852699-45852721 GCACATTTCTGTGCTGGCACAGG + Intergenic
1111312881 13:86512953-86512975 GCACATTTTTGTGTAAAAACTGG - Intergenic
1113226493 13:108165395-108165417 GTAATTTTCTGTGATAAAAGTGG + Intergenic
1113473835 13:110565628-110565650 GCACATTTCTTTGATGAAACTGG - Intergenic
1114871921 14:26668965-26668987 TTTCCTTTCTGTGCTAAAAGAGG + Intergenic
1117157499 14:52955213-52955235 GCCCATTTCTGTCAAAAAAGTGG - Intergenic
1128379899 15:67104876-67104898 GCAGCTTTCAGTACTAAAAGGGG - Intronic
1129343887 15:74904564-74904586 GCACAGTGCTGTGCTCACAGCGG + Intronic
1130748434 15:86682448-86682470 TCACATTTCTGTGAAGAAAGAGG + Intronic
1131942825 15:97585612-97585634 GCACAGTTCCGTGGGAAAAGCGG + Intergenic
1132137118 15:99352089-99352111 GCAGAGTTCTTTGCTAAAACTGG + Intronic
1133431288 16:5739287-5739309 CAACAGTTATGTGCTAAAAGTGG - Intergenic
1134592166 16:15463422-15463444 CCACACTTCTGTGATAACAGTGG - Intronic
1140158476 16:72458729-72458751 CCACATCTTTGTGCCAAAAGAGG - Intergenic
1140898661 16:79348524-79348546 GCACTTTAGTGTGATAAAAGGGG + Intergenic
1142853009 17:2713694-2713716 GCACATTTGTGTAACAAAAGAGG - Intergenic
1143259226 17:5585721-5585743 GAAAAGTGCTGTGCTAAAAGTGG + Intronic
1149616120 17:58001196-58001218 TCACATTTCTGTGGTCAAGGTGG - Intronic
1153906713 18:9668221-9668243 GAACATTTCTGTCTTACAAGAGG + Intergenic
1154338673 18:13485562-13485584 GCACATCTCTGTTCTACAAGTGG - Intronic
1156853352 18:41754209-41754231 GCAAATTGCTGTGCAAATAGAGG - Intergenic
1157782417 18:50451457-50451479 GCACATGACTGTGCTTAAACTGG - Intergenic
1158332014 18:56373312-56373334 GCAAATTTCTGTGCTCTAATAGG - Intergenic
1167661882 19:50800067-50800089 GCATATTTCTATGCAAAATGGGG - Intronic
925302747 2:2828640-2828662 GCACTTTTATGTGCTTTAAGGGG - Intergenic
927064776 2:19460450-19460472 GCAGGGTTCTTTGCTAAAAGTGG - Intergenic
928230666 2:29495983-29496005 TCACATTTCCTTTCTAAAAGAGG + Intronic
928348962 2:30529284-30529306 GCACATTTCTGTGCTAAAAGAGG + Intronic
929453225 2:42049813-42049835 GCACATGTCTGAGCAAACAGAGG + Intronic
930176253 2:48304325-48304347 GCAGAGTTCTTTGCTAAAAATGG - Intergenic
931144419 2:59501487-59501509 GCACATTACTGTCCTTAAAAAGG - Intergenic
932961616 2:76419124-76419146 TCACATTTCTGTGATATAAATGG + Intergenic
935553879 2:104485872-104485894 GTCCATTTCTATGCTGAAAGAGG - Intergenic
937435297 2:121875149-121875171 TCACATTTCTTTCATAAAAGTGG + Intergenic
939116265 2:138064821-138064843 GCAGATTCCTGTGTGAAAAGAGG + Intergenic
939877725 2:147596946-147596968 GCAGATTGCTTTGCTTAAAGTGG + Intergenic
940334587 2:152512132-152512154 ACACATTTGTGTGCTGAATGAGG - Intronic
940603681 2:155892807-155892829 GCAAATTTCTGAGATAAAGGAGG - Intergenic
941622637 2:167795626-167795648 ACTCATTTCTGTGCTAAGATAGG + Intergenic
942921416 2:181378201-181378223 ACATACTTTTGTGCTAAAAGAGG + Intergenic
943191324 2:184682172-184682194 ACACATTCCTGTGTTGAAAGGGG + Intronic
943262987 2:185689407-185689429 GCAAATTTTGGTGCTAAAAGTGG + Intergenic
943317299 2:186405859-186405881 ACACATTTGTGTGCTAATGGGGG - Intergenic
944673873 2:202018993-202019015 TCACATTTCTCTTCTAAGAGTGG - Intergenic
945538026 2:211044382-211044404 GCACTTTTCTGCAATAAAAGTGG - Intergenic
945895799 2:215480191-215480213 GCACATTCCTTTGTAAAAAGTGG + Intergenic
947354353 2:229276589-229276611 GCCCCTTTCTGGGCTAAATGTGG - Intergenic
1170423106 20:16211884-16211906 GAACATTTCTCTTCAAAAAGGGG + Intergenic
1170837301 20:19895313-19895335 GCACCATTCTTTGCTATAAGAGG - Intronic
1173798180 20:45877305-45877327 GCACTTTGCTGTGCTCAAGGCGG + Exonic
1174539235 20:51276088-51276110 CCACATTTCTGAGCTGAAACAGG + Intergenic
1175447061 20:59029495-59029517 TCACATTTCTGTGCTATTATGGG + Intronic
1175572006 20:60030565-60030587 GCACATCTCTGAACTAATAGTGG - Intronic
1179057350 21:37948362-37948384 GCAAAATTCTTTGCTAAAACTGG + Intergenic
1179312421 21:40208434-40208456 ACACATTTCTGGGCTAAACCGGG + Intronic
1179594881 21:42436863-42436885 GCCCATTTCTGAGCTCACAGTGG + Intronic
1180947039 22:19701253-19701275 GAAAATTTCTCTGTTAAAAGTGG + Intergenic
1181526697 22:23493607-23493629 GAACATTTCTGAGCTTAAATTGG - Intergenic
950092538 3:10306128-10306150 GCACATTTGGGTGATAAAATGGG - Intronic
951669560 3:25165002-25165024 GCACCTTACTCTTCTAAAAGGGG + Intergenic
953735040 3:45486460-45486482 GCACAGGTCTGTCCTAAAGGAGG - Intronic
953921077 3:46952015-46952037 GAACACCTTTGTGCTAAAAGTGG - Intronic
955231008 3:57098649-57098671 GCACATAGCTGTGCTAATAAGGG - Intronic
955478568 3:59365649-59365671 GCACATTTTACTGCTTAAAGTGG - Intergenic
955648474 3:61166669-61166691 GCAGTTTTCTGTGTTACAAGTGG - Intronic
956915451 3:73866466-73866488 ACACATTTCTGTGCCCAAACTGG + Intergenic
957314206 3:78556840-78556862 ATACATTTCTGTGCAAAGAGGGG - Intergenic
957603110 3:82364258-82364280 ACACATTTCTCTCATAAAAGTGG + Intergenic
957647641 3:82953781-82953803 GCACATTTATGTTATAAAAATGG + Intergenic
958686013 3:97395720-97395742 ACACATTCCTGTCCTAAAAGAGG + Intronic
958923280 3:100130130-100130152 CCCCATTTCTGTTTTAAAAGGGG - Intronic
959037932 3:101387202-101387224 GCACATTCATGTGCTAATGGTGG - Intronic
959306846 3:104678084-104678106 GAACTTTTCTGTCCTACAAGAGG + Intergenic
959314032 3:104779352-104779374 GAACTTTTCTGTCTTAAAAGAGG + Intergenic
959359438 3:105369272-105369294 ACACATTTAACTGCTAAAAGGGG + Intronic
960628009 3:119700497-119700519 GCACGGTTCTTTGCTAAAACTGG + Intergenic
962012565 3:131406831-131406853 ACACATTTTTGTGCTTAAACAGG + Intergenic
963502487 3:146145805-146145827 TCACTTTTCTGAGATAAAAGTGG - Intronic
967196186 3:187027808-187027830 GGGCATTTCTGTGCATAAAGTGG + Intronic
967589503 3:191256960-191256982 TCAAATTTCTGGGCTCAAAGTGG - Intronic
971939335 4:33194020-33194042 GCACAGTTCTTTGCATAAAGAGG + Intergenic
972217861 4:36917005-36917027 CCACATTTCTGTGTAAAAACTGG + Intergenic
976164518 4:82240070-82240092 GCACATTGCTGTGCTGCAAATGG - Intergenic
977128900 4:93208589-93208611 TCACTTTTCTGTGTAAAAAGAGG - Intronic
979884360 4:126006200-126006222 GCTTATCTTTGTGCTAAAAGGGG + Intergenic
980998112 4:139801140-139801162 TCACAGCCCTGTGCTAAAAGTGG - Intronic
982440018 4:155424300-155424322 GAGAATTTCAGTGCTAAAAGTGG - Intergenic
983800004 4:171916004-171916026 GCATATTTATGTTCTAAAAATGG - Intronic
989513024 5:42310440-42310462 GCATCTTTATGTGCTAAAAGGGG + Intergenic
991413842 5:66371133-66371155 TAACATTTCTGTCCTTAAAGGGG - Intergenic
992149042 5:73883270-73883292 ACACATTTATGTGGTAAAAAAGG - Intronic
993136223 5:83967848-83967870 GCACAATTCTGTGATGAAACTGG - Intronic
995351824 5:111185921-111185943 GCATATTTTTGTGCAAAAACTGG - Intergenic
995931864 5:117455649-117455671 GCCCATTTCTCTGCTGGAAGGGG + Intergenic
999015388 5:148098196-148098218 GGACATTCCAGTGCTAAAAGAGG - Intronic
1000958613 5:167572217-167572239 CCACATTGCTGTGCCCAAAGAGG - Intronic
1007148311 6:39660252-39660274 GAACATTGCTGTGGAAAAAGGGG - Intronic
1008071031 6:47099161-47099183 GAACATTTCAGTGCTAGAACTGG - Intergenic
1008309296 6:49946216-49946238 GCACATTTCACTGTTAAAAGGGG + Intergenic
1008441044 6:51532118-51532140 AGACATTTCTGAGGTAAAAGTGG + Intergenic
1009866538 6:69405142-69405164 GCACATTTCTGGGCAAAGTGTGG - Intergenic
1010508825 6:76692122-76692144 GCAGAGTTCTTTGCTAAAACTGG + Intergenic
1011348154 6:86393768-86393790 AAACTTTTCTGTGCTAAAGGAGG + Intergenic
1011698658 6:89935314-89935336 GCAGATTTCTGTACTAAAAGGGG - Intronic
1014218437 6:118775818-118775840 GCAGCTATCTGTACTAAAAGTGG - Intergenic
1018395379 6:163374196-163374218 GCACAGTTCTGGGCTGGAAGGGG + Intergenic
1020847856 7:13310389-13310411 GCAAATTTCTGTTCTAAACTGGG + Intergenic
1028746278 7:94330300-94330322 GTAAATTACTGTGCTAAAACAGG + Intergenic
1032621871 7:133542491-133542513 CCACATTTCTGTGTAAAAACTGG - Intronic
1033331181 7:140418026-140418048 GCACATTTGAGTGCTACAATAGG - Intronic
1038144462 8:24882103-24882125 TCACCGTTCTGTGATAAAAGAGG - Intergenic
1038261788 8:26002430-26002452 GCACATGTCTGGGCTACAAAAGG - Intronic
1040130463 8:43789905-43789927 GGACATTTAAGTGCTCAAAGAGG + Intergenic
1040346100 8:46497233-46497255 ACACATTTCTGAGCTAACTGAGG - Intergenic
1041760586 8:61362073-61362095 GCAGAGTTCTTTGCTAAAACTGG + Intronic
1042666267 8:71209928-71209950 TCACATTTCTTTGCTGAAACAGG + Intronic
1044332743 8:90940806-90940828 GCAGATGTCTGTGATAGAAGAGG + Exonic
1050679486 9:8093593-8093615 GCACTTTTCTGGTCTAAAGGTGG + Intergenic
1052764952 9:32631661-32631683 GCACATTTGTTTGATAATAGAGG + Exonic
1053590430 9:39508898-39508920 GAACTTTTCTGTCTTAAAAGAGG + Intergenic
1053848288 9:42264287-42264309 GAACTTTTCTGTCTTAAAAGAGG + Intergenic
1054575871 9:66856391-66856413 GAACTTTTCTGTCTTAAAAGAGG - Intergenic
1055528619 9:77160334-77160356 GCACATTTGTTTTCTAAACGGGG - Intergenic
1058541923 9:106020564-106020586 GCACATTTCTGTGCTACTTGGGG + Intergenic
1060134522 9:121139655-121139677 GCAAATTTCTATACTAAAAATGG - Intronic
1060382614 9:123190828-123190850 ACACATCCCTTTGCTAAAAGAGG + Intronic
1060867138 9:127009483-127009505 GATCCTTTCTCTGCTAAAAGGGG - Intronic
1061222507 9:129260317-129260339 GCACATTTCTGTTCCAAGGGAGG - Intergenic
1062134762 9:134919469-134919491 GCAAATCCCTGTGCAAAAAGAGG - Intergenic
1186155481 X:6721364-6721386 AACCATTTCTGTCCTAAAAGAGG + Intergenic
1186455183 X:9705035-9705057 ACACATGTCTGTGCTACAGGAGG - Exonic
1187895823 X:23978546-23978568 GCAGATTACTTTGTTAAAAGAGG - Intergenic
1190413472 X:50159569-50159591 GAGCCTTTCTGTGCTAAAAGTGG - Intergenic
1194336955 X:92659921-92659943 GCACAATTATTTGCTAAAACTGG - Intergenic
1195310640 X:103629155-103629177 CCACATTTCTGTGCAAAATATGG + Intronic
1195983052 X:110600739-110600761 GCACAGTTCTGTGGAAAAACTGG - Intergenic
1197061587 X:122187603-122187625 GCACATGCCTGAGCTAGAAGAGG - Intergenic
1197447322 X:126566354-126566376 GCACATTTGAGTGCTAGAAACGG + Intergenic
1197638041 X:128938551-128938573 TCACATTTCTTTTCTAAATGTGG - Intergenic
1200408896 Y:2842401-2842423 GCACTTTTCTGTGCAACAAAGGG + Intronic
1200765948 Y:7080774-7080796 ACACATGTCTGTGCTACAGGAGG - Exonic
1201463565 Y:14255415-14255437 GCAGGGTTCTGTGCTAAAACTGG - Intergenic
1201530178 Y:14983289-14983311 GAACTTTCCTGTGTTAAAAGAGG + Intergenic
1201673398 Y:16551176-16551198 GCACATATTTGGGATAAAAGAGG + Intergenic