ID: 928359646

View in Genome Browser
Species Human (GRCh38)
Location 2:30652912-30652934
Sequence CCCCTGACCTTCTTTTCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928359646_928359655 18 Left 928359646 2:30652912-30652934 CCAGATGAAAAGAAGGTCAGGGG No data
Right 928359655 2:30652953-30652975 GCTTGCAAATATCCAAATGGGGG No data
928359646_928359652 15 Left 928359646 2:30652912-30652934 CCAGATGAAAAGAAGGTCAGGGG No data
Right 928359652 2:30652950-30652972 GGGGCTTGCAAATATCCAAATGG No data
928359646_928359650 -4 Left 928359646 2:30652912-30652934 CCAGATGAAAAGAAGGTCAGGGG No data
Right 928359650 2:30652931-30652953 GGGGATATAAGCCATGAGAGGGG No data
928359646_928359653 16 Left 928359646 2:30652912-30652934 CCAGATGAAAAGAAGGTCAGGGG No data
Right 928359653 2:30652951-30652973 GGGCTTGCAAATATCCAAATGGG No data
928359646_928359654 17 Left 928359646 2:30652912-30652934 CCAGATGAAAAGAAGGTCAGGGG No data
Right 928359654 2:30652952-30652974 GGCTTGCAAATATCCAAATGGGG No data
928359646_928359657 24 Left 928359646 2:30652912-30652934 CCAGATGAAAAGAAGGTCAGGGG No data
Right 928359657 2:30652959-30652981 AAATATCCAAATGGGGGTGGTGG No data
928359646_928359649 -5 Left 928359646 2:30652912-30652934 CCAGATGAAAAGAAGGTCAGGGG No data
Right 928359649 2:30652930-30652952 AGGGGATATAAGCCATGAGAGGG No data
928359646_928359648 -6 Left 928359646 2:30652912-30652934 CCAGATGAAAAGAAGGTCAGGGG No data
Right 928359648 2:30652929-30652951 CAGGGGATATAAGCCATGAGAGG No data
928359646_928359656 21 Left 928359646 2:30652912-30652934 CCAGATGAAAAGAAGGTCAGGGG No data
Right 928359656 2:30652956-30652978 TGCAAATATCCAAATGGGGGTGG No data
928359646_928359658 28 Left 928359646 2:30652912-30652934 CCAGATGAAAAGAAGGTCAGGGG No data
Right 928359658 2:30652963-30652985 ATCCAAATGGGGGTGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928359646 Original CRISPR CCCCTGACCTTCTTTTCATC TGG (reversed) Intergenic
No off target data available for this crispr