ID: 928359651

View in Genome Browser
Species Human (GRCh38)
Location 2:30652942-30652964
Sequence ATATTTGCAAGCCCCTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928359651_928359658 -2 Left 928359651 2:30652942-30652964 CCATGAGAGGGGCTTGCAAATAT No data
Right 928359658 2:30652963-30652985 ATCCAAATGGGGGTGGTGGTAGG No data
928359651_928359656 -9 Left 928359651 2:30652942-30652964 CCATGAGAGGGGCTTGCAAATAT No data
Right 928359656 2:30652956-30652978 TGCAAATATCCAAATGGGGGTGG No data
928359651_928359657 -6 Left 928359651 2:30652942-30652964 CCATGAGAGGGGCTTGCAAATAT No data
Right 928359657 2:30652959-30652981 AAATATCCAAATGGGGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928359651 Original CRISPR ATATTTGCAAGCCCCTCTCA TGG (reversed) Intergenic
No off target data available for this crispr