ID: 928359656

View in Genome Browser
Species Human (GRCh38)
Location 2:30652956-30652978
Sequence TGCAAATATCCAAATGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928359646_928359656 21 Left 928359646 2:30652912-30652934 CCAGATGAAAAGAAGGTCAGGGG No data
Right 928359656 2:30652956-30652978 TGCAAATATCCAAATGGGGGTGG No data
928359651_928359656 -9 Left 928359651 2:30652942-30652964 CCATGAGAGGGGCTTGCAAATAT No data
Right 928359656 2:30652956-30652978 TGCAAATATCCAAATGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928359656 Original CRISPR TGCAAATATCCAAATGGGGG TGG Intergenic
No off target data available for this crispr