ID: 928362249

View in Genome Browser
Species Human (GRCh38)
Location 2:30674647-30674669
Sequence TTACAATCCTGGGCTAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928362249_928362252 22 Left 928362249 2:30674647-30674669 CCAAGGTTAGCCCAGGATTGTAA No data
Right 928362252 2:30674692-30674714 CTATTCATTCACTACATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928362249 Original CRISPR TTACAATCCTGGGCTAACCT TGG (reversed) Intergenic
No off target data available for this crispr