ID: 928362800

View in Genome Browser
Species Human (GRCh38)
Location 2:30679356-30679378
Sequence TCTGATGTGAAAGTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928362800_928362805 1 Left 928362800 2:30679356-30679378 CCCTCCACCACTTTCACATCAGA No data
Right 928362805 2:30679380-30679402 GCCACGCCTTACAGAGACAGCGG No data
928362800_928362807 2 Left 928362800 2:30679356-30679378 CCCTCCACCACTTTCACATCAGA No data
Right 928362807 2:30679381-30679403 CCACGCCTTACAGAGACAGCGGG No data
928362800_928362809 10 Left 928362800 2:30679356-30679378 CCCTCCACCACTTTCACATCAGA No data
Right 928362809 2:30679389-30679411 TACAGAGACAGCGGGTGCCTTGG No data
928362800_928362810 19 Left 928362800 2:30679356-30679378 CCCTCCACCACTTTCACATCAGA No data
Right 928362810 2:30679398-30679420 AGCGGGTGCCTTGGATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928362800 Original CRISPR TCTGATGTGAAAGTGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr