ID: 928362805

View in Genome Browser
Species Human (GRCh38)
Location 2:30679380-30679402
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928362798_928362805 11 Left 928362798 2:30679346-30679368 CCTTCCATTGCCCTCCACCACTT No data
Right 928362805 2:30679380-30679402 GCCACGCCTTACAGAGACAGCGG No data
928362797_928362805 12 Left 928362797 2:30679345-30679367 CCCTTCCATTGCCCTCCACCACT No data
Right 928362805 2:30679380-30679402 GCCACGCCTTACAGAGACAGCGG No data
928362804_928362805 -6 Left 928362804 2:30679363-30679385 CCACTTTCACATCAGAGGCCACG No data
Right 928362805 2:30679380-30679402 GCCACGCCTTACAGAGACAGCGG No data
928362801_928362805 0 Left 928362801 2:30679357-30679379 CCTCCACCACTTTCACATCAGAG No data
Right 928362805 2:30679380-30679402 GCCACGCCTTACAGAGACAGCGG No data
928362800_928362805 1 Left 928362800 2:30679356-30679378 CCCTCCACCACTTTCACATCAGA No data
Right 928362805 2:30679380-30679402 GCCACGCCTTACAGAGACAGCGG No data
928362803_928362805 -3 Left 928362803 2:30679360-30679382 CCACCACTTTCACATCAGAGGCC No data
Right 928362805 2:30679380-30679402 GCCACGCCTTACAGAGACAGCGG No data
928362799_928362805 7 Left 928362799 2:30679350-30679372 CCATTGCCCTCCACCACTTTCAC No data
Right 928362805 2:30679380-30679402 GCCACGCCTTACAGAGACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr