ID: 928364532

View in Genome Browser
Species Human (GRCh38)
Location 2:30691124-30691146
Sequence CTGGACTAAAGGAGGTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928364532_928364538 -3 Left 928364532 2:30691124-30691146 CCTGAACACCTCCTTTAGTCCAG No data
Right 928364538 2:30691144-30691166 CAGCTTCGTGGCAGTCCTTAGGG No data
928364532_928364537 -4 Left 928364532 2:30691124-30691146 CCTGAACACCTCCTTTAGTCCAG No data
Right 928364537 2:30691143-30691165 CCAGCTTCGTGGCAGTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928364532 Original CRISPR CTGGACTAAAGGAGGTGTTC AGG (reversed) Intergenic
No off target data available for this crispr