ID: 928364683

View in Genome Browser
Species Human (GRCh38)
Location 2:30691889-30691911
Sequence CAGCCCCCACTCAGAGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928364675_928364683 -8 Left 928364675 2:30691874-30691896 CCCACCACCCCACCACAGCCCCC No data
Right 928364683 2:30691889-30691911 CAGCCCCCACTCAGAGGCCTTGG No data
928364676_928364683 -9 Left 928364676 2:30691875-30691897 CCACCACCCCACCACAGCCCCCA No data
Right 928364683 2:30691889-30691911 CAGCCCCCACTCAGAGGCCTTGG No data
928364674_928364683 18 Left 928364674 2:30691848-30691870 CCATGGGCTTCATTCACAGAAGC No data
Right 928364683 2:30691889-30691911 CAGCCCCCACTCAGAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928364683 Original CRISPR CAGCCCCCACTCAGAGGCCT TGG Intergenic
No off target data available for this crispr