ID: 928368906

View in Genome Browser
Species Human (GRCh38)
Location 2:30724627-30724649
Sequence CTGGACACCCTGGCATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928368903_928368906 -9 Left 928368903 2:30724613-30724635 CCAGCTCCAGAAGGCTGGACACC 0: 1
1: 0
2: 0
3: 7
4: 206
Right 928368906 2:30724627-30724649 CTGGACACCCTGGCATCTCAAGG 0: 1
1: 0
2: 0
3: 21
4: 182
928368899_928368906 18 Left 928368899 2:30724586-30724608 CCAGTTGGATACATTTTTCTTCC 0: 1
1: 0
2: 6
3: 32
4: 307
Right 928368906 2:30724627-30724649 CTGGACACCCTGGCATCTCAAGG 0: 1
1: 0
2: 0
3: 21
4: 182
928368901_928368906 -3 Left 928368901 2:30724607-30724629 CCAAAGCCAGCTCCAGAAGGCTG 0: 1
1: 0
2: 3
3: 25
4: 236
Right 928368906 2:30724627-30724649 CTGGACACCCTGGCATCTCAAGG 0: 1
1: 0
2: 0
3: 21
4: 182
928368898_928368906 19 Left 928368898 2:30724585-30724607 CCCAGTTGGATACATTTTTCTTC 0: 1
1: 1
2: 4
3: 57
4: 593
Right 928368906 2:30724627-30724649 CTGGACACCCTGGCATCTCAAGG 0: 1
1: 0
2: 0
3: 21
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928368906 Original CRISPR CTGGACACCCTGGCATCTCA AGG Intronic
900308861 1:2023966-2023988 CTGGAAACCCTGGCCTCCCCTGG + Intronic
900900980 1:5515667-5515689 CTGGCCCACCAGGCATCTCATGG + Intergenic
900975338 1:6012879-6012901 GTGGAGAGCCAGGCATCTCATGG - Intronic
901022388 1:6261754-6261776 CTGCAGACCCTGGCCTCTCCCGG - Intergenic
901127986 1:6942799-6942821 CTGGCCACACTGGCCTCACAGGG - Intronic
903220266 1:21865407-21865429 GAGGACACCCTGGCACCCCAGGG - Intronic
903564893 1:24257859-24257881 CTGGACACCTTGTCAGCTGATGG + Intergenic
903971073 1:27119244-27119266 CTGGTCACCCTGGCAACCCAGGG - Intronic
904610411 1:31722947-31722969 ATGCCCACCCTGGCACCTCATGG - Intergenic
904950891 1:34237757-34237779 CTGGACTCCCTCCCATGTCAGGG + Intergenic
905169163 1:36099318-36099340 CTGGGCCCCCTGGCTTCTCCCGG - Exonic
905946640 1:41906928-41906950 CTGGAAACACTTGCAGCTCAGGG - Intronic
906675217 1:47688395-47688417 CTGGGCCCCCTGGCACCACACGG - Intergenic
908390858 1:63682409-63682431 CTGGCTACCCTGGCCTGTCATGG + Intergenic
908404082 1:63796827-63796849 CTGGACCACCTGCCAGCTCAGGG - Intronic
909588366 1:77317244-77317266 CTGGACTCCATAGCAGCTCAGGG + Intronic
911400327 1:97366797-97366819 GTAGCCTCCCTGGCATCTCATGG - Intronic
913262276 1:117010262-117010284 GTGGAGACTCTGGCTTCTCAGGG - Intronic
915334005 1:155130118-155130140 CTGCAAAGCCTGGCCTCTCAGGG + Intronic
916480558 1:165210800-165210822 GTAGACACACTGGCATCTCAGGG + Intronic
917545355 1:175961152-175961174 CTGGCCTCCCTGGCATATCATGG + Intronic
919792812 1:201303019-201303041 CTGGTCACACTGGCACATCATGG + Intronic
920330358 1:205203237-205203259 CTGGCCACCTTGGCCTCCCAAGG - Intronic
920452425 1:206069611-206069633 CTGGTCACCCTAGCAGCTGAGGG + Intronic
920583153 1:207132182-207132204 CAGGAAGCCCTGCCATCTCATGG - Intronic
920717578 1:208355193-208355215 GTGGACATCCAGGCATCCCAAGG - Intergenic
922768793 1:228170897-228170919 CTGGAAACCCTTGGATCTGATGG + Intronic
924283686 1:242463670-242463692 CTGGCCACACTCCCATCTCAAGG + Intronic
1062847268 10:717711-717733 CTGCACACCCTTGGCTCTCAGGG - Intergenic
1062898256 10:1121593-1121615 CTGGAAACCACGGCATCACACGG - Intronic
1063949170 10:11206593-11206615 CTGGTCTCCCTGGGGTCTCATGG - Intronic
1065204190 10:23342591-23342613 CTGGACTCCTTGGCATTCCATGG - Intronic
1066663507 10:37759847-37759869 CTGGACACCGATGCATCTCCAGG - Intergenic
1069852981 10:71422650-71422672 CTAGGCCCCCTGGGATCTCAAGG + Intronic
1074267517 10:111919405-111919427 CTACACTCTCTGGCATCTCAAGG + Intergenic
1075004532 10:118820496-118820518 GTGGCCAAGCTGGCATCTCATGG + Intergenic
1078067796 11:8089554-8089576 CTGTATATCCTGGCACCTCACGG + Intronic
1079043582 11:17080319-17080341 CTGGCCTCCATGTCATCTCAGGG + Intronic
1079521922 11:21338520-21338542 CTGGAAACCCTGGAAACTCTGGG - Intronic
1079835570 11:25328757-25328779 CTGTACCCTGTGGCATCTCAAGG + Intergenic
1079927792 11:26517116-26517138 CTGGACACTATGTCATTTCAAGG + Intronic
1082083261 11:48028348-48028370 CTGGAAATCTTGGCATTTCATGG + Intronic
1082174797 11:49048196-49048218 CTGGGCACCATGGCAGCTCCCGG - Intergenic
1082239029 11:49852551-49852573 CTGGACACCATGGCCGCTCCCGG + Intergenic
1082953388 11:58842523-58842545 CTGGACACCTTTCCATCACAGGG - Intronic
1083842021 11:65310038-65310060 CTGGACACCCTGCTACCTCAGGG - Intergenic
1083883240 11:65558479-65558501 CTGCACACCCTCGCTTCTCCAGG - Intronic
1085213441 11:74804212-74804234 CTGGACACCATTCCATCACAGGG - Intronic
1085830176 11:79891875-79891897 CTGGGGACCCTGGAATATCATGG - Intergenic
1086620428 11:88881996-88882018 CTGCCCACCTTGGCATCCCAAGG - Intronic
1086676088 11:89608664-89608686 CTGGACACACAGACATCCCAGGG - Intergenic
1086690979 11:89787892-89787914 CTGGGCACCGTGGCAGCTCCCGG + Intergenic
1087288599 11:96295219-96295241 CTGGAAACACTGGTATCTTAAGG + Intronic
1088575492 11:111267304-111267326 CTGGACCCCCTGGCCTCGTAGGG + Intronic
1088711288 11:112511236-112511258 CTGAATTCCCTGGCCTCTCAGGG - Intergenic
1089116954 11:116103133-116103155 CGGGAGCTCCTGGCATCTCAGGG + Intergenic
1089297522 11:117479011-117479033 CTGGACAGAGTGGCTTCTCAAGG + Intronic
1090450587 11:126802605-126802627 CAGGACACCCTCCCATCGCAGGG - Intronic
1091727069 12:2853773-2853795 CCGGCCACCCTGGGAACTCACGG - Intronic
1098342892 12:69470306-69470328 CTGGAGGCCCTGGCAGCTCCGGG + Intergenic
1100890467 12:99120093-99120115 CGGGACACCCTCCCATCGCAGGG + Intronic
1100895541 12:99178377-99178399 CAGGACATCATGGCACCTCATGG + Intronic
1101835599 12:108292844-108292866 CTGGTCACCCTGGCTTCCAAGGG + Exonic
1102201561 12:111061015-111061037 CTGGAGGTCCTGGCATCCCAAGG - Intronic
1102255929 12:111415008-111415030 CTGTTCACCGTGGTATCTCAGGG + Intronic
1102982679 12:117254518-117254540 CTGGAGACACTGGCATCTCCTGG - Intronic
1103998864 12:124847530-124847552 GTGGAAACCCTGGGGTCTCAGGG - Intronic
1107629221 13:42326455-42326477 CTGGAAGCCATGGCTTCTCAGGG - Intergenic
1108839001 13:54588541-54588563 CTGTAAACACTGGCATCTTAAGG - Intergenic
1109613207 13:64793818-64793840 CAGGACACCATTCCATCTCAGGG - Intergenic
1113617617 13:111692379-111692401 GTGGGCAGCCTGGCAGCTCAGGG - Intergenic
1113623147 13:111777639-111777661 GTGGGCAGCCTGGCAGCTCAGGG - Intergenic
1113781656 13:112980851-112980873 CTGGACACCCTGGCGTGTGCGGG - Intronic
1115569245 14:34651639-34651661 CTGTACACTGTAGCATCTCAAGG - Intergenic
1119294235 14:73520218-73520240 CTGGAAGCCCAGGCATCTAAGGG + Intronic
1119395441 14:74322888-74322910 CTGCCCACCTTGGCCTCTCAAGG - Intronic
1119639999 14:76307823-76307845 CGGGACACCAGGGCATCTCTGGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122367057 14:101200567-101200589 CTGCACCCCCTTGCTTCTCAGGG - Intergenic
1122938781 14:104972010-104972032 CAGGCCACCCTGGCATCCCGTGG - Intronic
1125504226 15:40257727-40257749 CTGGTGGCCCTGGCATCCCAGGG + Intronic
1125599769 15:40908959-40908981 CTGGGCATCCTGGCATCTTATGG - Intergenic
1125921612 15:43528697-43528719 CAGGACACACTGGCTGCTCAGGG - Exonic
1129066368 15:72907866-72907888 CTGGGCATCCTGCCAACTCATGG - Intergenic
1130622194 15:85475306-85475328 CTGGACCTCCTGGCAGCTTATGG + Intronic
1130892054 15:88141712-88141734 CTGCACATCCCAGCATCTCATGG + Intronic
1132418904 15:101647435-101647457 TTGCACAGCCTGGCAACTCAGGG + Intronic
1133442189 16:5830138-5830160 CTGGATACATTGGCAGCTCAGGG + Intergenic
1135188413 16:20334702-20334724 CAGCACACCCTGGGACCTCAGGG + Intronic
1135221940 16:20621480-20621502 CTGGCCTCTCTGGCATCTCAGGG + Intronic
1138458247 16:57133347-57133369 CTGGCCTCCCTGGCAGCCCAGGG - Intronic
1139324338 16:66140368-66140390 TTTGACACCATGGGATCTCAAGG - Intergenic
1139518415 16:67465434-67465456 CTTGCCACCCTGGCCTCTCCAGG - Intronic
1141618149 16:85221769-85221791 CCAGACACCCTGGCATCTCGGGG + Intergenic
1143445414 17:7006331-7006353 CTAAACACACTAGCATCTCATGG - Intronic
1143666526 17:8365229-8365251 CTGGAAACCCAGGCATCTCTGGG + Intergenic
1146639215 17:34527426-34527448 CTGGGGACCTTGGCATCTCCTGG + Intergenic
1151655065 17:75491961-75491983 CTGGCCAGCCTGGCCTCACAAGG + Intronic
1151797881 17:76358585-76358607 CTGCCCACCCTGGCCTCTCAAGG - Intronic
1152204870 17:78969202-78969224 CCGTGCTCCCTGGCATCTCACGG - Intergenic
1152342783 17:79734369-79734391 GTAGAGACCCTGGCATCACAAGG + Intronic
1152760977 17:82106912-82106934 GTGGGCACCCTAGCATCTCAGGG + Intronic
1153232326 18:2950724-2950746 TTGGACACCATGTCATCTCTGGG - Intronic
1154370955 18:13762739-13762761 CTGGATACCTGGCCATCTCATGG - Exonic
1157717014 18:49894713-49894735 CTGGACACTATGGCATCCCCTGG - Intronic
1158034187 18:53004759-53004781 CTGCACACACAGGCATCTCTGGG - Intronic
1162461140 19:10815128-10815150 CTGGACAGCCTTGCAGCACAGGG - Intronic
1163253702 19:16142164-16142186 CTGGACAGGCTGGGGTCTCATGG - Intronic
1164274578 19:23705352-23705374 CTGGACCTCCAGGCATCTGATGG - Intergenic
925210024 2:2037510-2037532 CTGGCCACCTTGGCTTCCCAAGG - Intronic
928368906 2:30724627-30724649 CTGGACACCCTGGCATCTCAAGG + Intronic
930219118 2:48727754-48727776 CTGGCTACACTGTCATCTCATGG + Intronic
931824957 2:65990736-65990758 CTGGACACCCTGGGATAGGATGG - Intergenic
932792342 2:74665470-74665492 CTGCCCACCTCGGCATCTCAAGG + Intronic
934588684 2:95527275-95527297 CTGGGCACCATGGCAGCTCTCGG + Intergenic
935096055 2:99945450-99945472 CTGCCCACCCAGGCATCCCAGGG + Intronic
938341598 2:130539906-130539928 CTGGACAGCATGACCTCTCAGGG - Exonic
938348231 2:130580803-130580825 CTGGACAGCATGACCTCTCAGGG + Intronic
938668332 2:133563028-133563050 CTGAACACTCTGGCAAGTCATGG - Intronic
941063236 2:160871744-160871766 CTGTCCACCTTGGCCTCTCAAGG + Intergenic
941776263 2:169396714-169396736 CTGGACATCCTCACCTCTCATGG - Intergenic
946989223 2:225309063-225309085 TTGGACACCCTGGCATCCACAGG + Intergenic
948332195 2:237178402-237178424 GGGGGCATCCTGGCATCTCATGG + Intergenic
948820576 2:240541964-240541986 CTGCCCACCTTGGCCTCTCAAGG - Intronic
948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG + Intronic
1171338665 20:24410086-24410108 CTGGACAACCTGTCATGTGAGGG - Intergenic
1173060621 20:39656493-39656515 CTGGATTCCTTGGCATCTCTAGG + Intergenic
1173147583 20:40537979-40538001 TGGGGCACCCTGGCATCTCTGGG - Intergenic
1175329025 20:58149954-58149976 CTGGACACCTGCTCATCTCATGG + Intergenic
1175415076 20:58795733-58795755 CTGGGCACCTTGGCAGCACAGGG + Intergenic
1175818480 20:61895991-61896013 CCTGAGATCCTGGCATCTCAGGG - Intronic
1175871561 20:62211736-62211758 CTGGGCACCCTGAGAGCTCAGGG + Intergenic
1176373164 21:6074585-6074607 CTGGACACACTGGCAGCTCTGGG + Intergenic
1177731373 21:25031032-25031054 ACGGACACCCTGGCATCTCTAGG + Intergenic
1179750313 21:43463658-43463680 CTGGACACACTGGCAGCTCTGGG - Intergenic
1182527227 22:30927969-30927991 CTGGACCACCTGGTCTCTCAGGG - Intronic
1184712978 22:46263682-46263704 CTGGGCGCCCAGGGATCTCACGG - Intergenic
1184795332 22:46728844-46728866 CAGCACACCCTGGCTTCTCTGGG - Intronic
1184797614 22:46741089-46741111 CTGGCCTACCTGGCAGCTCAGGG - Intergenic
1184842626 22:47061325-47061347 CTGCACACCTGGGCATCTCTGGG - Intronic
950499939 3:13357415-13357437 CTGGTCTCCCTGTCATCTCTGGG + Intronic
950610956 3:14126133-14126155 ATGCACACCCTGGCCTCTCAAGG - Intronic
951918102 3:27822958-27822980 ATGGACACCCTGAGATCTTAGGG - Intergenic
953948290 3:47167251-47167273 CTGGCAACCCTGGAATCTCCTGG - Intergenic
954208283 3:49076905-49076927 CTGGACTCACTGGCCTCTAAGGG - Exonic
954405313 3:50342134-50342156 CTGGACACCCTTGCAGCTTCGGG - Exonic
960950436 3:122995411-122995433 GTGGCCACCCTGTCATCCCAGGG - Intronic
961535180 3:127566273-127566295 CTGGACTCCATGGCAACACAAGG + Intergenic
962101307 3:132345726-132345748 CAGGACACCCTGTCATATGAAGG + Intronic
967050411 3:185778231-185778253 CAGGACACCATTCCATCTCACGG + Intronic
967145906 3:186605782-186605804 CTGGAGACCCTTCCACCTCAGGG + Intergenic
969277671 4:6147829-6147851 ATGGCCACCCTGGCCTCACAGGG + Intronic
969728268 4:8938742-8938764 CTGGACACCTGAGCTTCTCATGG - Intergenic
979021994 4:115513639-115513661 CTGGAAACCCTGGATTCTCAGGG - Intergenic
981320296 4:143384486-143384508 CTGTACAGCCTGGAAACTCAAGG - Intronic
985609920 5:881717-881739 CTGGACATCATGCCATGTCAGGG + Intronic
986891690 5:12316960-12316982 CTCCAAACCCTGGAATCTCAAGG + Intergenic
989297613 5:39848216-39848238 CTTGATACCCTGCCAGCTCAGGG - Intergenic
992839851 5:80677616-80677638 ATGGACACCCAGGGATCTTATGG - Intronic
995908914 5:117161848-117161870 CTGAACACCCATGGATCTCAAGG + Intergenic
998806160 5:145919513-145919535 CTGCAAACCCTTGCAACTCAGGG - Intergenic
1000991075 5:167912645-167912667 CCTGAGATCCTGGCATCTCATGG + Intronic
1003309587 6:4957801-4957823 CGGGACTCCCTGGCATGTCCTGG - Intergenic
1003568588 6:7241024-7241046 CTGGGCTCCCTGGGATATCAGGG + Intronic
1006151250 6:31991415-31991437 CTGGGGAGCCTGACATCTCACGG - Exonic
1006157551 6:32024153-32024175 CTGGGGAGCCTGACATCTCACGG - Exonic
1006464211 6:34181696-34181718 CTGTCCACCCTGGCCTCCCAAGG - Intergenic
1007067640 6:39007987-39008009 CTGGTCAACCCAGCATCTCAGGG + Intronic
1010939938 6:81904851-81904873 CTGCCCACCTTGGCCTCTCAAGG - Intergenic
1014289650 6:119543493-119543515 CTGGACCTCATGGCATGTCATGG - Intergenic
1019476122 7:1245282-1245304 CTGGAGGCCCTGGCGTTTCAGGG - Intergenic
1022173965 7:27856034-27856056 CCGGACACACTTGCATCCCAGGG - Intronic
1023174753 7:37425041-37425063 CTGGAAACCCTAGCATTTCCTGG - Intronic
1023176726 7:37442735-37442757 CTGGATACCATGGCAACCCAGGG + Intronic
1023912891 7:44567982-44568004 CTGGAGACCCTGGCAGCACGCGG - Intronic
1028143013 7:87292076-87292098 CTGGACACCCTGTGATCACAGGG + Intergenic
1029529772 7:101117555-101117577 CTGGGCATGCTGGCATCCCATGG + Intergenic
1029684165 7:102134089-102134111 CTGCCCACCTTGGCCTCTCAAGG - Intronic
1034275947 7:149823939-149823961 CTGCAAACTCTAGCATCTCAGGG - Intergenic
1038193053 8:25341539-25341561 CTGTACCCCCTGGCATCTTCAGG + Intronic
1039387298 8:37147411-37147433 CTGGAACCCCTGGCACCACAAGG + Intergenic
1041254845 8:55971265-55971287 CTGGAAACCTTGGAATCCCATGG - Intronic
1043150078 8:76704587-76704609 CTGGACTCCCTGGCATCTGCTGG + Exonic
1045907894 8:107370445-107370467 CTGCACACCTTGGCCTCCCAAGG - Intronic
1048057954 8:130886649-130886671 GAGGGCACCCTGGCATCCCAAGG - Intronic
1049539699 8:143202643-143202665 CTGGGCACCCTGGCTGCCCAGGG + Intergenic
1049999073 9:1056911-1056933 ACGGACTCCCTGGCAGCTCAAGG + Exonic
1052340338 9:27358858-27358880 GTGGACATCTTGGCATCTCCTGG + Intronic
1053308693 9:37001977-37001999 CTGGAGACCCAGGCACCACAGGG + Intronic
1053545591 9:39020015-39020037 CTGCCCACCTTGGCCTCTCAAGG + Intergenic
1056904571 9:90634123-90634145 CTGGACACCCTTGCATTTCTAGG - Intronic
1060248879 9:121969720-121969742 CTAGAAACCCTGGCTTCTAAAGG + Intronic
1060545014 9:124454416-124454438 CTGAACAGGCTGGCATCTCTGGG + Intronic
1061573849 9:131494177-131494199 CTGACCACCCTGGCACCTCCAGG - Intronic
1062402204 9:136377673-136377695 CTGGCCACCCTGGCCCCCCAAGG - Exonic
1062550665 9:137084842-137084864 AGGGAAACCTTGGCATCTCAAGG - Intergenic
1185612171 X:1399180-1399202 CTGGGCTCCGTGGCATCTCCTGG + Intergenic
1185699247 X:2217942-2217964 CTGAACACACAGCCATCTCATGG + Intergenic
1190515450 X:51219312-51219334 TTGGACAACCTTGCATCCCAGGG + Intergenic
1192699083 X:73448311-73448333 CTCTTCACCCTGGCCTCTCAGGG + Intronic
1192731085 X:73803295-73803317 CTGTACCCTCTAGCATCTCAAGG + Intergenic
1194057370 X:89151951-89151973 TTGCACCCCATGGCATCTCAGGG + Intergenic
1196735348 X:118976846-118976868 CAGGACACCCTCGGATCCCAGGG - Intronic
1199983390 X:152933478-152933500 CTGGACACGCTGGTCTCTCCAGG - Intronic