ID: 928369252

View in Genome Browser
Species Human (GRCh38)
Location 2:30728697-30728719
Sequence CATTGAAGCGTTTTTAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928369247_928369252 6 Left 928369247 2:30728668-30728690 CCAGATTTTTCCTGTGAGCAATG 0: 1
1: 0
2: 1
3: 29
4: 302
Right 928369252 2:30728697-30728719 CATTGAAGCGTTTTTAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 85
928369246_928369252 20 Left 928369246 2:30728654-30728676 CCATGTTAATGATGCCAGATTTT 0: 1
1: 0
2: 1
3: 14
4: 248
Right 928369252 2:30728697-30728719 CATTGAAGCGTTTTTAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 85
928369251_928369252 -4 Left 928369251 2:30728678-30728700 CCTGTGAGCAATGGGAGGACATT 0: 1
1: 0
2: 4
3: 22
4: 201
Right 928369252 2:30728697-30728719 CATTGAAGCGTTTTTAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 85
928369245_928369252 28 Left 928369245 2:30728646-30728668 CCTGTGGTCCATGTTAATGATGC 0: 1
1: 0
2: 0
3: 7
4: 91
Right 928369252 2:30728697-30728719 CATTGAAGCGTTTTTAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928369252 Original CRISPR CATTGAAGCGTTTTTAAGCC TGG Intronic