ID: 928375466

View in Genome Browser
Species Human (GRCh38)
Location 2:30769901-30769923
Sequence GGATGGGCAGGATTTCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928375466 Original CRISPR GGATGGGCAGGATTTCAGCA AGG (reversed) Intronic
902262513 1:15237417-15237439 GGATGGGTAGGATTTCAGGAGGG - Intergenic
903032657 1:20475022-20475044 GAGTGGGCGGGATTTCAGCGGGG - Intergenic
903588838 1:24438731-24438753 GAATGGGCAGGATTTCACCAGGG + Intronic
903598587 1:24516418-24516440 AGCTGGGTAGGATTTTAGCAGGG + Intronic
903808297 1:26020895-26020917 GGATGGGCATAATGTCAGCCAGG - Intronic
904810607 1:33161254-33161276 GGATGGGCAGGATGTCAGTTGGG + Intronic
904999497 1:34657296-34657318 GTATGGGTCTGATTTCAGCATGG - Intergenic
905273160 1:36800282-36800304 GGAGGGGCAGGTTTTGAACAGGG - Exonic
905406185 1:37733926-37733948 GGAAGGGCAGGCTTGGAGCAAGG - Intronic
905648645 1:39641614-39641636 GGAAGGGCTGGAATTCAACAAGG + Intergenic
905826797 1:41031903-41031925 GGAGGGGTAGGATTTCAACATGG - Intronic
906679506 1:47716153-47716175 GGATGGGTTGGTTTTTAGCAGGG - Intergenic
907308284 1:53525598-53525620 GCCTGGGCAGGAATTCAGGAGGG - Intronic
909597371 1:77421779-77421801 TGATGGAGAGGAGTTCAGCAAGG - Intronic
909763425 1:79323561-79323583 GTATGGGAAGGAATGCAGCAAGG + Intergenic
910224363 1:84921233-84921255 GGATGAGGAGCATCTCAGCATGG - Intergenic
911070529 1:93828560-93828582 GGAGGGGCAGGAACCCAGCAAGG - Intronic
911091257 1:94019190-94019212 GGTGGGGCAGGATTTGAGAAGGG + Intronic
912647460 1:111407540-111407562 AGATGGGCAGAACTGCAGCATGG + Intergenic
915153271 1:153852694-153852716 GTATGAGCAGGCTCTCAGCAGGG - Intronic
915569489 1:156736636-156736658 AGATGGGCAGGAGCTCAGCATGG - Exonic
915626903 1:157119403-157119425 CGATGGGCAGTTTGTCAGCATGG + Intergenic
915909755 1:159907248-159907270 GGATAGGCATGATTGAAGCATGG - Intergenic
916700352 1:167286899-167286921 GGATGTGAAGGATTTCCCCAGGG + Intronic
917037203 1:170761682-170761704 GGATGTGAAGGATTTCTTCAAGG + Intergenic
917397387 1:174608543-174608565 AGATGAGCAAGATTTCAGTAGGG + Intronic
919938121 1:202268335-202268357 GGAAGGCAAGGATTCCAGCAGGG - Intronic
920562282 1:206947315-206947337 GGATGGGCAGCATTTCTGTGGGG - Intergenic
920814892 1:209321945-209321967 GGATGTGTAGGAGTTAAGCAGGG + Intergenic
921359567 1:214318193-214318215 GGTTGGGCAGGATTGAAGCGAGG + Intronic
922337021 1:224626043-224626065 GAATGGCAAGGATTTCAGCCTGG - Intronic
922545554 1:226453909-226453931 GGAGGGGCAGGATTTGAGGGTGG + Intergenic
922613434 1:226946313-226946335 GGGTGGCCAAGATTCCAGCAGGG + Intronic
924455980 1:244219312-244219334 AGATGGGCAGGAGAGCAGCAAGG - Intergenic
1063629716 10:7722425-7722447 GGATGGTCAGGAGTCCAGCTGGG + Intronic
1065524808 10:26609333-26609355 GGTTAGGTAGGATTTCAGAAGGG - Intergenic
1067812958 10:49444598-49444620 GCATGGGCAGAATATCAGAATGG + Intergenic
1070517823 10:77224621-77224643 GGATGGTCAGCACTTCAGCAGGG - Intronic
1070639625 10:78158364-78158386 GGAAGGGAAGGAGCTCAGCAAGG + Intergenic
1070683669 10:78466302-78466324 GGATAGGAAGGATTTCCGCCGGG + Intergenic
1070869164 10:79733389-79733411 GAATGGGCAGGGTTGCAGTAGGG - Intergenic
1071636078 10:87255564-87255586 GAATGGGCAGGGTTGCAGTAGGG - Intergenic
1071659163 10:87482380-87482402 GAATGGGCAGGGTTGCAGTAGGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072445759 10:95497275-95497297 GCGTGGGCAGGACTTCATCATGG + Intronic
1072464158 10:95647793-95647815 GGATAGGCATGATTGAAGCATGG - Intronic
1074122968 10:110506940-110506962 GGAAGGGAAGGATTTCAACTGGG - Exonic
1074549508 10:114429503-114429525 GGATGTGGAGGATAACAGCATGG + Intergenic
1074988962 10:118685215-118685237 GGATGGGCGGTACTTTAGCACGG - Exonic
1075511289 10:123074670-123074692 GGATGGGCAGGGGGACAGCAGGG - Intergenic
1075706883 10:124507186-124507208 GGATAGACAGGATTTCAGGTGGG + Intronic
1075706896 10:124507235-124507257 GGGTAGGCAGGATTTCAGGTCGG + Intronic
1075707088 10:124507874-124507896 GGGTAGGCAGGATTTCAGGTCGG + Intronic
1075709303 10:124522208-124522230 GGCTGGGCAGGATTTCCACAGGG - Intronic
1077287131 11:1772695-1772717 GGAGGGGCAGGACTGGAGCAGGG - Intergenic
1081610398 11:44559319-44559341 GGCAGGGCAGGATTTGAGCAGGG + Intergenic
1083254968 11:61490193-61490215 GGATGGGGAGGATCTGAGCAAGG + Intronic
1083626833 11:64076184-64076206 GGAGGGGCAGGAGCACAGCAAGG - Intronic
1084352544 11:68612842-68612864 GGGTGAGCAGGCATTCAGCAAGG - Intronic
1084711550 11:70846994-70847016 GGATGGGCAGGACTGCAGCTGGG + Intronic
1085235074 11:75008364-75008386 GGATGGGCAGGATTGGTGCAGGG + Exonic
1086119952 11:83295304-83295326 GGGTGGGAACAATTTCAGCAAGG - Intergenic
1087613871 11:100466519-100466541 GGATGTGAAGGATTTCTTCAAGG - Intergenic
1088444772 11:109914068-109914090 GGATGGGCAAGACTTCAGAAAGG + Intergenic
1091358697 11:134957719-134957741 GGAAGGGCAGGATGTCAGCTTGG + Intergenic
1094320433 12:29176973-29176995 TGATGGACAGGAGGTCAGCATGG - Intronic
1095241655 12:39866888-39866910 GGATGGGGAGGATTAAAGAAAGG + Intronic
1096463386 12:51835141-51835163 GGTTGGGCAGGAGTTGAGCCAGG - Intergenic
1096705859 12:53421604-53421626 GGATGTGGAGAGTTTCAGCATGG - Intergenic
1100836667 12:98572980-98573002 GGATAGGCATGATTGAAGCATGG + Intergenic
1100892037 12:99136304-99136326 GGATGCTGAGGACTTCAGCAGGG + Intronic
1101304376 12:103513096-103513118 GGATGGGGAGCATTTCTCCAAGG - Intergenic
1103563646 12:121804887-121804909 CGATGGGCAGCATTTCAGCCTGG + Exonic
1103608487 12:122106258-122106280 GGACGGGCAGGAGTTAACCAGGG - Intronic
1106280390 13:28262861-28262883 AGATAGGTAAGATTTCAGCAGGG + Intronic
1107332618 13:39318325-39318347 GGATTAGGAGGGTTTCAGCATGG - Intergenic
1107626537 13:42291661-42291683 GGATGGGTAGGATTTCTACATGG + Intronic
1111245901 13:85540739-85540761 GGATGGGCAGGATTCTAACATGG + Intergenic
1112946482 13:104933966-104933988 GGATGTGAAGGACTTCATCAAGG + Intergenic
1113407690 13:110056834-110056856 GTATGGTCAGGAATTCAGCCTGG - Intergenic
1113886780 13:113665209-113665231 GAATGAGGAGGAATTCAGCAGGG - Intergenic
1114200017 14:20511375-20511397 GGATGGCCAGGACTACAGTACGG - Intergenic
1114398356 14:22387214-22387236 GAATCGGGGGGATTTCAGCACGG + Intergenic
1115075538 14:29385376-29385398 GGATGGGGATGATGTGAGCAGGG - Intergenic
1116764977 14:49059426-49059448 GAATTGGCAGAATTTCACCATGG - Intergenic
1118252041 14:64171251-64171273 GGCTGTACAGGATTTCAGGAGGG - Intronic
1119731614 14:76954852-76954874 GGATGGGCAGAGATTGAGCAAGG - Intergenic
1119797677 14:77413958-77413980 AGATCCGCAGGCTTTCAGCAGGG + Exonic
1120887289 14:89461777-89461799 AGATAGGTAGGATTTAAGCAGGG + Intronic
1121849200 14:97204016-97204038 GGAGGGACAGGATTTCAGGTAGG - Intergenic
1122964794 14:105117754-105117776 GGAAGAGCAGGGTTTCAGCTGGG + Intergenic
1124180061 15:27464633-27464655 GGATGGCTAGGATTTTAACAAGG - Intronic
1125157085 15:36600088-36600110 GTGTGGGGAGAATTTCAGCAGGG + Intronic
1125676668 15:41505729-41505751 GGATGAGCTGGATTTCCTCATGG - Exonic
1126793710 15:52243341-52243363 GGATAGGCAGGAGGCCAGCAGGG + Intronic
1126853798 15:52817737-52817759 GGATGTGAAGGATTTCTTCAAGG - Intergenic
1127432756 15:58926983-58927005 GGTTGGACAGTATTCCAGCAAGG + Intronic
1127942182 15:63709954-63709976 GGAAAGACAGGATATCAGCAAGG + Intronic
1128619559 15:69137347-69137369 GCATGGGCAGGTGTTGAGCATGG + Intergenic
1130187799 15:81701468-81701490 GGATGGGAAGGATCTCTTCAAGG + Intergenic
1130895842 15:88169882-88169904 GGATAGGGAGGATTCTAGCAAGG - Intronic
1130925477 15:88382637-88382659 GAGTGGGTAGGTTTTCAGCAGGG - Intergenic
1131047816 15:89327131-89327153 GGGTGGGCAGGATCTAGGCAGGG - Intronic
1131290383 15:91101654-91101676 GCATGGCGTGGATTTCAGCAGGG + Intronic
1132335973 15:101048983-101049005 GGACGGGCAGGATGGCTGCAAGG - Intronic
1132349751 15:101132501-101132523 GAATGGGCAGGACTCCAGCCAGG - Intergenic
1132896149 16:2230308-2230330 GGATGGGCAGGCTCTCATCGGGG + Intronic
1133390898 16:5409083-5409105 GGGTGGGCATAATTTCTGCAGGG + Intergenic
1133888887 16:9859767-9859789 GAGTGGGTAGGATTTCAGTAGGG - Intronic
1134314427 16:13105507-13105529 GGATGGGTAGGATGTCCCCATGG + Intronic
1135357323 16:21780438-21780460 GGATGGGGAGAAGGTCAGCATGG - Intergenic
1135455827 16:22596554-22596576 GGATGGGGAGAAGGTCAGCATGG - Intergenic
1135734218 16:24917958-24917980 TGCTGGGCAGGATGTCAGCATGG + Intergenic
1137264838 16:46860149-46860171 GGATGGCAGGGAGTTCAGCAAGG + Intergenic
1137870577 16:51946620-51946642 GGAAAGGAAGGATTTGAGCAGGG - Intergenic
1138249307 16:55490003-55490025 GGATGGGCAGGATCTAAGCAGGG - Intronic
1139681354 16:68566600-68566622 GGATGGTCAGCATCTCAGAAGGG - Exonic
1141950734 16:87337667-87337689 GGAAAGGAAGGTTTTCAGCAAGG + Intronic
1143307069 17:5955853-5955875 GGATGGCTGGGAGTTCAGCAGGG - Intronic
1143456226 17:7069729-7069751 GGATGGGAAGGATTTCAGGGTGG + Intergenic
1143849373 17:9798480-9798502 GGCTGGGCAGGAATTGAACAAGG - Intronic
1143923513 17:10349562-10349584 TGATGGGCAGGATTCTAGGATGG + Intronic
1144825632 17:18104185-18104207 GGATGGGCAGGAGTTAGACATGG - Intronic
1147287024 17:39410429-39410451 CCATGGGGAGGACTTCAGCAAGG - Exonic
1148598663 17:48877467-48877489 GGATGGGCAGGATGGATGCAGGG - Intergenic
1152487045 17:80601299-80601321 GCAGGGGCAGGAATTCAGGAAGG - Intronic
1152677895 17:81651044-81651066 GGAGGGTCTGGACTTCAGCAGGG + Exonic
1203168046 17_GL000205v2_random:116868-116890 GGATGGGAAGGACTTCTTCAAGG + Intergenic
1157326070 18:46669558-46669580 GGAGGGTCAGGACTTCAGCTAGG - Intronic
1157697223 18:49732583-49732605 GGGTGGGCAGGAATGCAGGAGGG - Intergenic
1158868459 18:61660973-61660995 GGGTGGACAGGAGTTCGGCAGGG - Intergenic
1159048646 18:63395836-63395858 GGAGGGGCAGGATAGCAGAATGG + Intronic
1160370189 18:78365630-78365652 AGATGGCCAGGCTTTCAGCAGGG - Intergenic
1161863990 19:6820797-6820819 CGATGTGCAGGATTTTGGCAAGG + Exonic
1163187614 19:15650018-15650040 TGATGGGCAGCGTTTCCGCAGGG + Exonic
1163217183 19:15889566-15889588 TGATGGGCAGCGTTTCCGCAGGG - Exonic
1163386109 19:17001529-17001551 GGAAGGGCAGGACTTGAGGAAGG + Intronic
1164462572 19:28461641-28461663 GGCTGGGCAGTATCTCAGTAAGG + Intergenic
1167384561 19:49156282-49156304 GGAAGGGCAGGAACTCAGAAAGG - Intergenic
1168576712 19:57517855-57517877 GCTTGGGCAGAATTCCAGCAAGG + Intronic
925316873 2:2933462-2933484 GGCTGGGCCGGATTTATGCAAGG - Intergenic
925347961 2:3183633-3183655 GGAGGAGCAGGCCTTCAGCAGGG - Intergenic
925810886 2:7699276-7699298 GAATGGGTAGAATTTCAACATGG - Intergenic
926693120 2:15751040-15751062 GGATTGACAGGATTCCAGCCTGG + Intergenic
927955674 2:27205824-27205846 GGATGGGAATGATGTCAACAGGG - Intronic
928375466 2:30769901-30769923 GGATGGGCAGGATTTCAGCAAGG - Intronic
928438752 2:31273830-31273852 GGATGGGCAGGAGAACAGGAGGG - Intergenic
928619292 2:33072364-33072386 GGATAGGCATGATTGAAGCATGG + Intronic
934651017 2:96091457-96091479 GGGTGGCCAGGATTTCATGATGG - Intergenic
934762676 2:96865121-96865143 GGAAGGGGAGGAGGTCAGCAGGG + Intronic
935933412 2:108154583-108154605 GGAGGGCCAGGGATTCAGCATGG + Intergenic
936483378 2:112906315-112906337 GGATGGGATGGATTCCTGCATGG + Intergenic
939046590 2:137257378-137257400 CAATTGGCTGGATTTCAGCAAGG + Intronic
939489409 2:142859151-142859173 GGGTGGGCATGATTTGAGTAAGG - Intergenic
940136946 2:150447792-150447814 GGATGGGCAAGGTTTGAGGATGG + Intergenic
941157997 2:162002152-162002174 GTATGGTCTGGCTTTCAGCAGGG + Intronic
942370496 2:175279248-175279270 GGATGGGAAATAATTCAGCAGGG - Intergenic
944489326 2:200241892-200241914 GGATGAGTTGGATTTCAGGAGGG - Intergenic
946048106 2:216837877-216837899 GGAAGGGCAGGATTTAGACAAGG - Intergenic
947489217 2:230579370-230579392 GGCTTGGCTGGATCTCAGCAGGG - Intergenic
1170286330 20:14713918-14713940 GGATGGGCAGGATTTAGACAGGG + Intronic
1170397427 20:15942296-15942318 GGGTGGGCAGGAGTTGAGCTGGG + Intronic
1170695045 20:18650414-18650436 GGATGGCCAGGATGTGGGCAGGG - Intronic
1170849825 20:19994667-19994689 GGAGGGTCAGGATTTGAGCAAGG - Intronic
1172105957 20:32517454-32517476 GGATCTGCAGGCTTTCAGCGGGG + Intronic
1172618346 20:36304977-36304999 GTTTGGGCAGGGTGTCAGCAAGG - Intergenic
1172807221 20:37621025-37621047 TGATGGGTAGGATTTAAGGAAGG + Intergenic
1173163795 20:40671840-40671862 GGATGGGAAGGATGTTAGGAGGG + Intergenic
1174329558 20:49807313-49807335 GGATGGGAAGGGTCTCTGCATGG - Intergenic
1175516936 20:59576007-59576029 GGTTGGGTAGGAGTTCACCAGGG + Intergenic
1176168875 20:63688252-63688274 GCAGGGGCAGGATGTCTGCAGGG - Intronic
1176325417 21:5444194-5444216 GGATGGGAAGGACTTCTTCAAGG + Intergenic
1176385645 21:6137553-6137575 GCATGGGGAGGGTTTCAGCAGGG + Intergenic
1176403711 21:6342268-6342290 GGATGGGAAGGACTTCTTCAAGG - Intergenic
1176433446 21:6646836-6646858 GGATGGGAAGGACTTCTTCAAGG + Intergenic
1177217735 21:18151306-18151328 GGATAGGCATGACTGCAGCATGG - Intronic
1178828604 21:36035882-36035904 GGACATGCAGGATTTCTGCAGGG - Exonic
1178941979 21:36914076-36914098 TGATGGGCAGGATTTGAGAGAGG - Intronic
1179100250 21:38350312-38350334 GGATGGGAAAGATTTTGGCAGGG + Intergenic
1179156995 21:38859379-38859401 GGAGAGGCAGGATTTCAGCGAGG + Intergenic
1179737828 21:43400699-43400721 GCATGGGGAGGGTTTCAGCAGGG - Intergenic
1179891108 21:44335494-44335516 GGGTGGGCAGGCGTACAGCAGGG + Intronic
1180249325 21:46570251-46570273 AGAAGGGCAGGATGACAGCATGG + Intergenic
1181673883 22:24439508-24439530 GGATGGGTAGGGTTTCTGCCAGG + Intronic
1184340426 22:43882899-43882921 GGCTGGGAAGGGTTTAAGCAGGG - Intronic
1184499671 22:44863994-44864016 GGATGGGGAGGGTTGCAGAATGG + Intergenic
1185218846 22:49618709-49618731 GGATGGGCCGGATGTCATCGGGG + Intronic
950190800 3:10974873-10974895 GGGAGGACAGGGTTTCAGCAAGG + Intergenic
952550187 3:34468008-34468030 GGATGTGAAGGATTTCTTCAAGG - Intergenic
952609905 3:35195918-35195940 GGAGGAGCAGGATTTTAGAAAGG + Intergenic
954460025 3:50621082-50621104 GGCTGGGCAGGATGTCAGGAGGG - Intronic
955575026 3:60351831-60351853 GGAAGGGCATGGTTTCTGCATGG - Intronic
955765851 3:62343298-62343320 GGATGGGCAGAAAGTCAGTATGG - Intergenic
955933572 3:64081040-64081062 GGATGTGTAAGAGTTCAGCAGGG - Intergenic
958489158 3:94749776-94749798 GGATGTGAAGGATTTCTTCAAGG + Intergenic
958662191 3:97084694-97084716 GGAGGTGAAGGATTTCTGCAAGG + Intronic
960873395 3:122273691-122273713 GGAGGGGCACGATTACAGCATGG + Intronic
961628015 3:128276921-128276943 GGACAGGCAGGAGGTCAGCAGGG + Intronic
961634401 3:128323801-128323823 GGATGGGCTGGCATTCAACATGG - Intronic
962354558 3:134682476-134682498 GAATGGGCAGGAATGCAGGAGGG + Intronic
962932184 3:140048851-140048873 GCATGGGCAGGATTTGAGTTTGG - Intronic
963610267 3:147458195-147458217 AGATGGGTAGGATTTCACCAAGG - Intronic
964257830 3:154797266-154797288 GGATAGGCATGATTGCATCACGG + Intergenic
966107620 3:176356224-176356246 ATATGGGAAGGAGTTCAGCATGG - Intergenic
967903851 3:194485894-194485916 GGATTGGCAGGAACTCAGCTGGG - Intronic
968665456 4:1819337-1819359 GGATGTGCAGGACTACAGCGAGG - Exonic
968880565 4:3296724-3296746 GGATGGGCAGGGTTTGTCCAGGG + Intronic
969123101 4:4924202-4924224 AGATGGGCAGGTCTTCACCAAGG + Intergenic
969516272 4:7649772-7649794 GGATGTGCAGAATCTCAGAAGGG - Intronic
971661280 4:29419556-29419578 GGAAGAGCAGGTTTTCAACATGG - Intergenic
972381571 4:38524772-38524794 GGGTGGGCAGGAGTTCCCCAAGG - Intergenic
972485858 4:39539877-39539899 GCTTGGGCAGAATTCCAGCAAGG - Intergenic
972549269 4:40112885-40112907 GTATAGACAGGATTTCACCATGG + Intronic
973587519 4:52408361-52408383 GGATGGGTAGGATTCCTCCAGGG + Intergenic
973859835 4:55052176-55052198 GGATAGGAAGGTTTTCAACATGG - Intergenic
974134992 4:57804032-57804054 GGGTGGGCAGAATGGCAGCAGGG + Intergenic
976195161 4:82524966-82524988 CGATGAGGAGGATTACAGCATGG + Intronic
978667698 4:111205615-111205637 CGAAAGGCAGGATTTTAGCAGGG + Intergenic
981222917 4:142257649-142257671 GGATGTGAAGGATTTCTTCAAGG + Intronic
981747018 4:148061985-148062007 GGAAGGGCAAGATTAGAGCAGGG + Intronic
985229241 4:187797451-187797473 GTAGAGGCAGGGTTTCAGCAGGG + Intergenic
985421184 4:189786525-189786547 GGATAGGCAGGATTTCTGGACGG - Intergenic
985978083 5:3437970-3437992 GGGTGGGCAGGAGTGCAGAAAGG + Intergenic
986570109 5:9155507-9155529 GGATTTGCAGGGTGTCAGCAAGG - Intronic
989140489 5:38196767-38196789 GGAAGGGCATGATTTTAGCCTGG + Intergenic
990247057 5:53873666-53873688 TGATGGACAAGAGTTCAGCAAGG - Intergenic
990457637 5:56003638-56003660 AGATGGTCAGATTTTCAGCACGG - Intergenic
990566252 5:57032414-57032436 GGATGGGCAGTCTGGCAGCATGG + Intergenic
990893925 5:60676709-60676731 GGAGGAGCAGGACTTCAGCCTGG - Intronic
992081220 5:73235206-73235228 GGATTGGCAGGAATCAAGCAGGG - Intergenic
993987492 5:94614623-94614645 GGATGGAAAGGATTTTGGCAGGG - Intronic
994045882 5:95309151-95309173 GGATGGGCATGAGTGAAGCAGGG - Intergenic
995692402 5:114842235-114842257 GGATGGGAAGGACTTCCTCAAGG + Intergenic
997318154 5:132955106-132955128 GGTTGGAGAGGATTTCAGCTAGG - Intronic
998622597 5:143811487-143811509 GGATGGGCAGGATTTCTGGCAGG + Intergenic
999154758 5:149450333-149450355 GGCTGGGAAGGAATCCAGCAGGG + Intergenic
1000202679 5:159027105-159027127 GTATGTCCAGCATTTCAGCAGGG + Intronic
1000688536 5:164284885-164284907 GGATGGGAAAGATCTCTGCAAGG - Intergenic
1001283780 5:170407359-170407381 GGATGGGCAGGAATTTAGAAAGG + Intronic
1001368665 5:171172991-171173013 GGATAGGAATGATTTCAACATGG + Intronic
1002461983 5:179378449-179378471 CCATGGGCAGGTTTTCAGCAAGG - Intergenic
1003231395 6:4256869-4256891 AGAAGGGCAGAATTTCAGAAAGG + Intergenic
1004673355 6:17817976-17817998 GGCTGGGCAGGATATCAACTTGG + Intronic
1005870658 6:29972239-29972261 GAATGGGCAGGACCTCAGAAGGG - Intergenic
1006506906 6:34495119-34495141 AAATGGGCAGGATCTCAGCTAGG + Intronic
1006949838 6:37812603-37812625 GGATGGTCAGGATTTTCTCATGG + Intergenic
1007098968 6:39231520-39231542 GGGTAGGCAGGAGGTCAGCAAGG - Intergenic
1007450282 6:41936828-41936850 GGTGGGGCAAGATATCAGCAAGG + Intronic
1008233809 6:49018982-49019004 GGATGGTCAGGCTCTCAGAATGG + Intergenic
1011047290 6:83098778-83098800 GGATAGGCATGATTGAAGCATGG + Intronic
1011705465 6:89996643-89996665 GGATGGACAGGACTTCACTAGGG - Intronic
1013648523 6:112169656-112169678 GCATGAGCAAGATTTCAGGAAGG - Intronic
1014134693 6:117874917-117874939 GGATGTGCAGGACTTCTTCAAGG - Intergenic
1017033970 6:150250729-150250751 GAATGGGCAGGATTTCTGTTAGG + Intergenic
1018037416 6:159893302-159893324 GGCAGGGCAGGATATCTGCATGG + Intergenic
1018836434 6:167487739-167487761 GGATGACCAGGACTGCAGCAGGG - Intergenic
1019032377 6:169024363-169024385 GGATGGGCTGGAGTGCAGCCGGG + Intergenic
1022191560 7:28021112-28021134 GGATGGGCAGGACCCCATCACGG + Intronic
1023604883 7:41920872-41920894 GGATTGGCAGGAGTGCAGCTGGG + Intergenic
1023628729 7:42141856-42141878 TGATGGGCAGGCTGTGAGCATGG + Intronic
1023685646 7:42732211-42732233 GGCTGGGCAGGATGACATCATGG - Intergenic
1028910817 7:96205541-96205563 GGAATGGAAAGATTTCAGCAGGG - Intronic
1029551663 7:101239939-101239961 GGACGGTCAGGGTTTCCGCAGGG - Intronic
1030052258 7:105548611-105548633 GGATGGGCAGGATGACAGAAGGG - Exonic
1035714821 8:1745925-1745947 GCATGGGCAGAATTTCAGTGAGG - Intergenic
1037569934 8:20149470-20149492 GAATAGGCAGGAATTTAGCACGG - Intronic
1040712073 8:50200654-50200676 GGATTGGAAGCATTTGAGCAAGG + Intronic
1041165522 8:55088849-55088871 GAATTAGCAGGAATTCAGCAGGG - Intergenic
1043485683 8:80697073-80697095 GGATGAACAGGATTTCAAGATGG + Intronic
1044224298 8:89702027-89702049 ATATGGGAAAGATTTCAGCAGGG - Intergenic
1045480892 8:102591262-102591284 TGATGGGAAGGTTATCAGCAAGG + Intergenic
1045832765 8:106483838-106483860 GAATGAGAAGGTTTTCAGCAAGG - Intronic
1045911588 8:107416582-107416604 GGACAGGCAGGATTGAAGCATGG + Intronic
1048008537 8:130438544-130438566 GGATGGGCAGGGTGTGAGCTGGG - Intronic
1049641771 8:143719192-143719214 GGCTGGGCAGGAGGGCAGCAGGG - Intronic
1050077548 9:1880841-1880863 GGAGTGCCAGGATTTCAGGAAGG + Intergenic
1050706749 9:8408460-8408482 GCCTGGCCAGGATTTCAGCTTGG - Intronic
1052010749 9:23405958-23405980 GTATGGTTGGGATTTCAGCAAGG - Intergenic
1052048095 9:23818574-23818596 AGATGGGCAGGTTTTCCACAGGG + Intronic
1053240261 9:36488947-36488969 GGATGAGCAGGAGTTCACCAAGG + Intergenic
1055754550 9:79543783-79543805 GGGTGGGTAGAATTTCAGTAGGG - Intergenic
1056904407 9:90632850-90632872 GGCTGGGCAGGATCTCAGATGGG + Intronic
1057372007 9:94482161-94482183 GAATGGGCAGAATTACAGGATGG + Intergenic
1057987275 9:99729956-99729978 GGATGTGCATGATTTCTGGAGGG - Intergenic
1058872479 9:109214593-109214615 GGATGTGTAGGAGTTCAACAAGG + Intronic
1059052308 9:110939271-110939293 GAATGGGCAGGATGTGGGCAGGG - Intronic
1060291450 9:122306843-122306865 GGCTGGGCTGTATTTCAGAATGG + Intronic
1060451098 9:123741163-123741185 GGTTTGGCATGATTTCAGCCAGG - Intronic
1061780378 9:132992605-132992627 GGATGGACAGGACTTCAAAAAGG - Intergenic
1061972166 9:134050720-134050742 GGATGGGGGGCATCTCAGCATGG - Intronic
1062014215 9:134283148-134283170 GGAGGGGCAGGATGGCGGCACGG - Intergenic
1062387412 9:136318431-136318453 GGCTGGGGAGGAGTGCAGCATGG - Intergenic
1203438090 Un_GL000195v1:161834-161856 GGATGGGAAGGACTTCTTCAAGG - Intergenic
1186574415 X:10750330-10750352 GGATGGCCAGGAATTCATAATGG - Intronic
1188881486 X:35497253-35497275 GAATTGGAAGGATTTCTGCATGG - Intergenic
1190504753 X:51116158-51116180 GGATGTGAAGGATTTCTTCAAGG + Intergenic
1193249900 X:79278651-79278673 GGATGGGAAGGATCTCTTCAAGG + Intergenic
1193284190 X:79692706-79692728 GGATGTGAAGGACTTCATCAAGG - Intergenic
1196945471 X:120820675-120820697 GGATGTGAAGGATTTCTTCAAGG - Intergenic
1197150267 X:123213139-123213161 GGTTGGGGAGGAGTTCAGGATGG - Intronic
1199619699 X:149688084-149688106 GGATAGGCATGATTGAAGCATGG + Intergenic
1202336701 Y:23819414-23819436 ATTTGGGCAGAATTTCAGCAAGG - Intergenic
1202369772 Y:24188707-24188729 GGATGGGCAGGAGGTCAGTTTGG + Intergenic
1202501013 Y:25481410-25481432 GGATGGGCAGGAGGTCAGTTTGG - Intergenic
1202534064 Y:25850657-25850679 ATTTGGGCAGAATTTCAGCAAGG + Intergenic