ID: 928378510

View in Genome Browser
Species Human (GRCh38)
Location 2:30798638-30798660
Sequence GCCTGCGGCCCTCTCCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928378505_928378510 -7 Left 928378505 2:30798622-30798644 CCTGCCCAGGAGTGCTGCCTGCG 0: 1
1: 0
2: 2
3: 19
4: 248
Right 928378510 2:30798638-30798660 GCCTGCGGCCCTCTCCTGGCTGG 0: 1
1: 0
2: 4
3: 34
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928378510 Original CRISPR GCCTGCGGCCCTCTCCTGGC TGG Intronic
900117035 1:1033322-1033344 GCCCGCGGCCCCGCCCTGGCGGG - Intronic
900143063 1:1146562-1146584 GCCTTCATGCCTCTCCTGGCCGG - Intergenic
900270236 1:1783215-1783237 ACCTGAGGCTCTTTCCTGGCTGG - Intergenic
900376811 1:2358715-2358737 GCCTGCTCCTCTCTCCTGGAAGG - Exonic
900531387 1:3155161-3155183 TCCTGCGGACCTCTCCAGGAAGG + Intronic
900553138 1:3266535-3266557 CCCTGGGGCCCTCTCCTCGTCGG - Intronic
900600040 1:3498981-3499003 ACCTGTGCCCCTCTCCAGGCAGG - Intronic
900665293 1:3811060-3811082 GCCCACTGCCCTCTGCTGGCTGG + Intergenic
900778163 1:4600089-4600111 GCCTCCAGCCTTCTCCCGGCTGG - Intergenic
900799258 1:4727360-4727382 GCCTCCAGCCCTCTCCTGTGGGG + Intronic
900991447 1:6100141-6100163 GCCTGCTGTCCAGTCCTGGCCGG + Exonic
901003327 1:6159990-6160012 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003339 1:6160027-6160049 GGCTGAGGCCCTTCCCTGGCTGG - Intronic
901003359 1:6160101-6160123 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003367 1:6160118-6160140 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003388 1:6160169-6160191 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003418 1:6160260-6160282 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003430 1:6160297-6160319 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003451 1:6160348-6160370 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003481 1:6160439-6160461 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901003494 1:6160476-6160498 GGCTGGGGCCCTTCCCTGGCTGG - Intronic
901207212 1:7504028-7504050 GGCTGCCACCCTCTCCTGCCCGG - Intronic
902586458 1:17441750-17441772 GCCTGCGTGACTCTCCCGGCTGG + Intergenic
902896811 1:19485266-19485288 GCCGGCGGCACCCTCCTGGGCGG + Intronic
902920216 1:19661589-19661611 GCATGAGGCCCGCACCTGGCTGG - Intergenic
903028232 1:20444561-20444583 GCCTGCGGCTCCATCCTGCCTGG + Intergenic
903377862 1:22877629-22877651 GCCTGCCCCCCTCACCTGCCTGG - Intronic
903945572 1:26960255-26960277 GCCCGGGACCCTCTCCTGTCCGG + Intronic
904547718 1:31289288-31289310 AGCTGAGGGCCTCTCCTGGCTGG + Exonic
906742142 1:48192978-48193000 GCCAGCCGCCCTGTCCTGGAGGG + Intergenic
907248235 1:53121509-53121531 GCTTTCGGCCCTCTCCTTTCTGG + Intronic
908573235 1:65431815-65431837 GCCTGCGGCCTTGTGTTGGCAGG + Exonic
913975121 1:143449841-143449863 CTCTGCGGCCCTCTCCAGGGAGG + Intergenic
914069513 1:144275457-144275479 CTCTGCGGCCCTCTCCAGGGAGG + Intergenic
914109642 1:144690897-144690919 CTCTGCGGCCCTCTCCAGGGAGG - Intergenic
915525848 1:156475834-156475856 GCCCCCGCCCCACTCCTGGCTGG + Intronic
916611712 1:166398149-166398171 GCCTGCAGCCGTCTCCAGGTGGG + Intergenic
917923605 1:179771039-179771061 TCCTGCTGCCCTCTGCTGACAGG + Intronic
917964309 1:180168866-180168888 GCCTGCTGCCCTCTGGGGGCTGG + Intronic
920043005 1:203116142-203116164 CCTTCCCGCCCTCTCCTGGCAGG + Intronic
921814095 1:219545890-219545912 GCCAGCGGCCCCGTCCTGGAGGG + Intergenic
922882378 1:228990527-228990549 GCCCCCGGCCCTCCCCTGCCAGG - Intergenic
1062906439 10:1182842-1182864 GCCTGAGGCTCACTCCTGCCTGG + Exonic
1062980573 10:1718756-1718778 GCCTGGAGCCCCCTCCTGGGAGG - Intronic
1063963723 10:11328474-11328496 GCCTGTTGGCCTCACCTGGCTGG + Intronic
1067225432 10:44373224-44373246 GCCTGGGGCCCTGCCCTGGCAGG + Intronic
1067346599 10:45442751-45442773 GCCTGCTGCCCTCCTGTGGCTGG + Intronic
1067658143 10:48212772-48212794 ACCTGCCACCCTCTCCTGGGGGG - Intronic
1067696301 10:48537871-48537893 TCCTGCTGTCCACTCCTGGCGGG - Intronic
1069416041 10:68201690-68201712 GCCTGCACCCCTCCCCTGCCAGG - Intronic
1069635074 10:69920066-69920088 CCCTGCTGCCCTGTCCTGCCTGG - Intronic
1069683259 10:70300229-70300251 GCCCCAGGCCCTCTCCTGGTAGG + Exonic
1072824222 10:98589909-98589931 GCCAGCGGCCTTCTCCTGACAGG - Intronic
1072973567 10:100038325-100038347 GGCCTCAGCCCTCTCCTGGCTGG - Intergenic
1073214411 10:101828696-101828718 GCCTGGTGCCCTCTCCTTCCAGG - Exonic
1074757246 10:116633107-116633129 ACCTGCGGACCACTCCTGGGGGG - Intronic
1075709315 10:124522232-124522254 GGGGGCGGCCCTCACCTGGCTGG + Intronic
1075797993 10:125134812-125134834 GCCTGACTCCCTCTCCAGGCTGG - Intronic
1076395910 10:130136961-130136983 GCCTGCCGCTCCCTCCCGGCGGG - Intronic
1077536850 11:3128670-3128692 GCCTGAGCCCCAGTCCTGGCAGG - Intronic
1079338188 11:19589679-19589701 GGCTGTGGCTCTCTCTTGGCTGG - Intronic
1081289258 11:41305250-41305272 GCCAGCCGCCCTCTCCGGGAGGG + Intronic
1082001311 11:47395034-47395056 GCCTCCGGCCCTCGCCAGCCTGG + Intergenic
1083766277 11:64843063-64843085 GGCTTCGGCCCTCTTCTGGCGGG - Intronic
1084425121 11:69080247-69080269 GGCTGGGCCCCTCTGCTGGCGGG + Intronic
1086423955 11:86665687-86665709 GCCTGCAGCAGCCTCCTGGCTGG - Intronic
1090243745 11:125201536-125201558 GCCTGTGTCCCTCTCCGAGCTGG + Intronic
1090989952 11:131808060-131808082 GCCTGGGGCTCTGTCTTGGCTGG + Intronic
1091744480 12:2982466-2982488 GCCTCCAGCTCTCCCCTGGCAGG + Intronic
1092192954 12:6533702-6533724 ACCAGCGGCTCTCTCCGGGCTGG - Intergenic
1096080190 12:48827905-48827927 TCCTGCTGCCCTACCCTGGCAGG + Exonic
1096436366 12:51593245-51593267 GCTTGCAGCCCTCTCCAGGGAGG - Intronic
1096524987 12:52205156-52205178 GCCTGCAGGCCGCTCCTGGGTGG - Intergenic
1096969116 12:55651447-55651469 GCCTGCGGCCCTGTGATGGGAGG - Intergenic
1101437813 12:104679315-104679337 CCCTTCGCCTCTCTCCTGGCCGG - Intronic
1101883445 12:108641564-108641586 GCCTGAGCACCTCTCCTGGCTGG + Intergenic
1102058595 12:109915304-109915326 GCCTGCGGCCCTACCCAGACTGG - Intronic
1102438764 12:112945865-112945887 GCCTGTGGTCCTCTCCACGCAGG + Intronic
1104661691 12:130616020-130616042 GACTGCGTCACTCTCCTGCCAGG - Intronic
1105023648 12:132834603-132834625 GCCTGCCCTCCTCTCCTGGCTGG + Intronic
1105541333 13:21319761-21319783 GCCTGTGGCCCGCACCTGGCAGG - Intergenic
1105827727 13:24137296-24137318 GCCAGGGGCCTGCTCCTGGCTGG + Intronic
1107851566 13:44577073-44577095 GCCTGCGGCCCTCTCCCGCCCGG - Intronic
1113636379 13:111921650-111921672 GCCGCCGGCGCCCTCCTGGCCGG + Intergenic
1113732566 13:112652364-112652386 GTCCGTGGCCGTCTCCTGGCAGG - Intronic
1113880507 13:113622978-113623000 CCCTGCGGCCCTCCCCTTACGGG + Intronic
1116749967 14:48870886-48870908 GCCTGTAGCTCTCTCCTGGTAGG + Intergenic
1116817867 14:49599818-49599840 GCCTGCGGCCCTCTCCCCTCCGG + Intronic
1118257478 14:64217658-64217680 GCCTGTGTTCCTCACCTGGCCGG + Intronic
1118816309 14:69316723-69316745 GCCTGAGGCGCTCTCTGGGCAGG - Intronic
1121085217 14:91140873-91140895 TCTTGCTGCCCTCTCCTGGCTGG + Intronic
1122167526 14:99839927-99839949 CCCTGCGTACCACTCCTGGCTGG - Intronic
1122264816 14:100541630-100541652 GCCTGCAGCCCTCTGGTGCCAGG - Intronic
1122691512 14:103533985-103534007 GCCCGGGTCCCTGTCCTGGCAGG - Intronic
1122779788 14:104138776-104138798 GCCCGCCTCCCTCTCCAGGCCGG - Intronic
1123964232 15:25439066-25439088 GCCTGGAGCCCTCGCCCGGCCGG - Intergenic
1124558021 15:30745909-30745931 GCCCGTGGCCCTCCCCTCGCTGG + Intronic
1124621113 15:31274663-31274685 GCCTGCAGTCCTCTACTTGCAGG + Intergenic
1125510730 15:40291153-40291175 GGCTCCGGCGCTCTCCTCGCGGG + Exonic
1126122769 15:45268321-45268343 CAATGCTGCCCTCTCCTGGCTGG + Exonic
1129385957 15:75196165-75196187 GCCTGCAGCCCCCTCCTTGGAGG - Intronic
1129739905 15:77985145-77985167 GCCTGGGGGCCTCTCCTGCCGGG + Intronic
1129757685 15:78108508-78108530 GCCCGCCGCCCTCTGGTGGCTGG + Intronic
1129845879 15:78767528-78767550 GCCTGGGGGCCTCTCCCGCCGGG - Exonic
1130147517 15:81285611-81285633 CCCAGGGGCCCACTCCTGGCTGG - Intronic
1130255988 15:82326332-82326354 GCCTGGGGGCCTCTCCTGCCAGG + Intergenic
1130557788 15:84935137-84935159 CAATGCTGCCCTCTCCTGGCTGG + Exonic
1130598966 15:85263654-85263676 GCCTGGGGGCCTCTCCTGCCAGG - Intergenic
1130690796 15:86079923-86079945 GCCTGCGGCCAGATCCAGGCTGG - Intergenic
1132546801 16:536952-536974 GCCGGGGGCCCTGCCCTGGCTGG - Intronic
1132661989 16:1065752-1065774 GCCTCCGACCCTCCCCCGGCCGG - Intergenic
1132694193 16:1194769-1194791 GCCTGGGGCCTGCGCCTGGCCGG - Intronic
1132889709 16:2197481-2197503 GCCTCAGGCCCTCTCCCGTCAGG + Intergenic
1132935270 16:2476888-2476910 GCCTGCTGGACACTCCTGGCAGG - Intronic
1133026810 16:2992164-2992186 TCCAGCTGCCCTCACCTGGCTGG - Intergenic
1133027870 16:2996524-2996546 CCCAGCTGCCCTCACCTGGCTGG - Intergenic
1135303406 16:21349742-21349764 CACTGGGGCCCTCCCCTGGCAGG - Intergenic
1136172745 16:28498321-28498343 CCCAGGGGCCTTCTCCTGGCTGG - Exonic
1136261757 16:29082187-29082209 GCCTGCGGCCCGCGCCCGCCCGG + Intergenic
1136300154 16:29328936-29328958 CACTGGGGCCCTCCCCTGGCAGG - Intergenic
1136375218 16:29861370-29861392 GCCTGCGTTCCTCCCCAGGCAGG - Intronic
1136617748 16:31408922-31408944 GCCTCCAGCCCTCTCCTTCCAGG - Intronic
1137459690 16:48649382-48649404 CCCTGCAGGCCCCTCCTGGCAGG - Intergenic
1137674757 16:50298796-50298818 GCACCCGGCTCTCTCCTGGCTGG - Intronic
1138199268 16:55077080-55077102 GCCTGCAGCAGTCACCTGGCTGG - Intergenic
1139721678 16:68861198-68861220 GCCAGTGGTCCTCTCATGGCGGG - Intronic
1140471621 16:75218712-75218734 GCCTGGTGCCGTCTCCTGGCAGG + Intergenic
1141841997 16:86579329-86579351 GCCGGCGCCCCTCCACTGGCCGG + Exonic
1142324160 16:89403301-89403323 GCCTGCTCCCCCCTCCTGACCGG + Intronic
1142582730 17:952125-952147 TCCTGTGGCCTTGTCCTGGCAGG - Intronic
1142692971 17:1617905-1617927 GGCTGAGGAGCTCTCCTGGCCGG + Intronic
1143674584 17:8422532-8422554 GCCTGCTTCCCTCTCCTGGAAGG + Intronic
1144848747 17:18233506-18233528 TCCTGCTGTCCTCTCCTGGTGGG + Intronic
1146445218 17:32927906-32927928 GCCTGCGCCCCGCCCCGGGCTGG - Intronic
1146558913 17:33851241-33851263 GCCTAGGGCCCTCCCCTGGTGGG - Intronic
1147187978 17:38722841-38722863 TGCTCCTGCCCTCTCCTGGCTGG - Intronic
1147919190 17:43906078-43906100 ACCTGGAGCCTTCTCCTGGCTGG + Intronic
1148238876 17:45986807-45986829 GCCTGCTGCCCCCTCTTGCCAGG + Intronic
1148698595 17:49575545-49575567 GCGTGCCGTCCTCTCCTGGCTGG + Intergenic
1148731111 17:49837205-49837227 GCCTGCTTCCCCCTCCAGGCTGG + Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1149678436 17:58487508-58487530 GCCACCGGCCCTCCCCTGGAGGG - Intronic
1151697455 17:75724797-75724819 CCCTGCAGCCCCCTCCTGGCAGG + Intronic
1151939120 17:77281692-77281714 GACAGCGGCCCTGTCCTGGGAGG - Intronic
1152241416 17:79163277-79163299 GCCTGCGGCTTTCCCCAGGCGGG - Intronic
1152433052 17:80260368-80260390 GCATGCGCCCCACGCCTGGCGGG + Intergenic
1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG + Intergenic
1155098980 18:22589964-22589986 CCCTGCAGCCCTCTCCTGGTGGG + Intergenic
1156452313 18:37273899-37273921 GCCTTCTGGTCTCTCCTGGCAGG - Intronic
1159900552 18:74040901-74040923 GCCTGCTGCCCCCTGCTGGCGGG - Intergenic
1160455805 18:78998843-78998865 GCCTCCGGGGCCCTCCTGGCTGG - Exonic
1160492299 18:79348529-79348551 GCAGGCTGCCCTCCCCTGGCTGG + Intronic
1161026174 19:2038425-2038447 GCCTGCTGCCCCCTCCCCGCGGG - Exonic
1161264893 19:3359609-3359631 GCCTGCGGCCCCCCCCTCGCCGG + Intronic
1161531492 19:4792570-4792592 CCCTGCGACCTGCTCCTGGCCGG - Exonic
1161777464 19:6271433-6271455 GCCTGCGGCCCCCTGGTGACCGG + Intronic
1162792506 19:13070297-13070319 GCCTGCGGCCCTATCGGGGCAGG + Intronic
1163035171 19:14565668-14565690 GCCTGCCGCCCTCCCTCGGCGGG + Intronic
1163252422 19:16133973-16133995 TCTAGGGGCCCTCTCCTGGCTGG + Exonic
1163443491 19:17333583-17333605 GCCTTGGGCCCCCTCGTGGCAGG - Intronic
1164616408 19:29669218-29669240 GCCTGCAGCTCTCTTCTGCCTGG + Intronic
1165092400 19:33394010-33394032 GCCTGCAGCCGTCCCCTGGACGG + Intronic
1165825575 19:38703878-38703900 GCCTGCGACCCTCAACTGGCTGG - Intronic
1166752283 19:45170058-45170080 ACCTCCGGCCCCCTCCTGGAGGG - Intronic
1167103520 19:47418284-47418306 GCCTCGGACCCTCGCCTGGCTGG + Intronic
1167494015 19:49807495-49807517 CCCCGAGGCCCTCCCCTGGCAGG - Intronic
925139421 2:1539746-1539768 GCCTGTGGTCCTCTTCAGGCAGG + Intronic
925293360 2:2762791-2762813 GCCTGTGCCCCTCTCCAGGAAGG - Intergenic
926233482 2:11022251-11022273 CCGTGCAGCCCCCTCCTGGCAGG - Intergenic
927867352 2:26598668-26598690 CCCTGGGACACTCTCCTGGCAGG - Intronic
928378510 2:30798638-30798660 GCCTGCGGCCCTCTCCTGGCTGG + Intronic
929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG + Intronic
931356135 2:61538697-61538719 CCCTGCGGCCCTCTCCCTCCCGG + Intergenic
932303756 2:70686992-70687014 CCCGTCCGCCCTCTCCTGGCTGG - Intronic
932469730 2:71945907-71945929 CTCTGTGGCCCTCTCCTGCCAGG - Intergenic
934290114 2:91685075-91685097 CTCTGCGGCCCTCTCCAGGGAGG + Intergenic
934655044 2:96113001-96113023 GACTGTGACCCTCTGCTGGCCGG - Exonic
934951774 2:98580551-98580573 CCCTGCCAGCCTCTCCTGGCAGG + Intronic
936277948 2:111117088-111117110 GCCTTCGGTCCTGACCTGGCTGG - Intronic
938310707 2:130286677-130286699 GGCTGTGGTCCTCTCCTGTCGGG - Intergenic
940639802 2:156333858-156333880 GCTCGGGCCCCTCTCCTGGCTGG - Intronic
946365349 2:219245582-219245604 GGCTCAGGCCCACTCCTGGCAGG - Intronic
947851813 2:233294407-233294429 TCCTGCAGCCCTGTCCTGGCAGG + Exonic
948338705 2:237231866-237231888 GGCTGCGCCCCTCACTTGGCTGG - Intergenic
948437193 2:237961672-237961694 ACCTGGGGCCCTGACCTGGCAGG + Intergenic
948598916 2:239097059-239097081 GCCTGCGCCCCTCAGCTGGCCGG - Intronic
948853138 2:240718059-240718081 GCCTTCAACCCCCTCCTGGCCGG - Exonic
1168810218 20:700094-700116 GCCTGCAGCCCTGTCCTGCCAGG + Intergenic
1171459512 20:25290947-25290969 CCCTGGGCCCCTCTGCTGGCAGG + Intronic
1171459542 20:25291040-25291062 CCCTGGGCCCCTCTGCTGGCAGG + Intronic
1172428592 20:34872774-34872796 GCCCAGGGCGCTCTCCTGGCTGG + Exonic
1173163868 20:40672276-40672298 GCCAGCTGAGCTCTCCTGGCAGG + Intergenic
1173405185 20:42758329-42758351 ACCTGTGCCCCTCTCCTGACAGG - Intronic
1173464891 20:43272961-43272983 GACTGCTGCCATCTCCTAGCAGG - Intergenic
1173852579 20:46228235-46228257 GGGTGCTGCCCTCTCCTGCCGGG - Intronic
1175603026 20:60290128-60290150 GCCTCTGGGCCTCTCGTGGCGGG + Intergenic
1175823380 20:61923842-61923864 GGCTGCGGCTCCCTCCTGGAAGG - Intronic
1176172623 20:63702890-63702912 GACTCTGGCCCTGTCCTGGCAGG - Intronic
1176210820 20:63920429-63920451 GCCTGAGGCCCCCGCATGGCGGG - Intronic
1176286595 21:5022153-5022175 TCCTGCGGCCCTCCCCGAGCAGG - Intergenic
1178518332 21:33266789-33266811 TCCTGCAGCTCTCTGCTGGCGGG + Intronic
1179780212 21:43694747-43694769 TCCTGGGGCCCTCTGCTGGGAGG - Exonic
1179870586 21:44241322-44241344 TCCTGCGGCCCTCCCCGAGCAGG + Intergenic
1180163102 21:46006800-46006822 GCCGGCGGCCCATGCCTGGCAGG + Intergenic
1181593013 22:23896242-23896264 GACTGAGGCCCTCGGCTGGCAGG - Intronic
1182034541 22:27187409-27187431 GCCAGCAGCCATCTCCTAGCAGG - Intergenic
1182903998 22:33920887-33920909 CGCGGCGGCCCACTCCTGGCCGG - Intronic
1183035043 22:35134943-35134965 GCCTGCGGCCCTCCCCTATCAGG - Intergenic
1183247313 22:36703595-36703617 GCCAGCGCCCCCCTCCTGGCGGG - Intergenic
1183301433 22:37060966-37060988 GCCTCCCGCCCACTCCTTGCTGG + Intronic
1183331076 22:37221908-37221930 TCCTGGGGCTCTCTGCTGGCTGG + Intergenic
1183630614 22:39030291-39030313 CCCTGCGGCCCCCTCCTCCCAGG + Intronic
1183634069 22:39050383-39050405 CCCTGCGGCCCCCTCCTCCCAGG + Intronic
1184159165 22:42687850-42687872 GGCTGGGGTCCTCACCTGGCCGG - Intergenic
1184748716 22:46472180-46472202 GGCTGCGGGGCCCTCCTGGCAGG + Intronic
1185190674 22:49433956-49433978 GCCGCCGGCTCACTCCTGGCCGG - Intronic
949539006 3:5017836-5017858 GGGTGCGGCCCTCTCCTGGTAGG - Intergenic
950113565 3:10435746-10435768 GCCTCCGTACCTCTCCTGGCTGG + Intronic
952397541 3:32934324-32934346 ACCTGCTGCCATCTGCTGGCAGG + Intergenic
952991909 3:38837594-38837616 GGATGTGGCCCTCTCCTGGGAGG + Intergenic
954693178 3:52406639-52406661 GCCTGTGGCCTGCTCCTGGGTGG - Intronic
955290972 3:57692453-57692475 GCCTGCGGGCTTCTCCGGGTGGG + Intronic
956743315 3:72291681-72291703 GCCTGGGGCCCTCAGCTGTCCGG + Intergenic
958526651 3:95269444-95269466 GCCTGCTGCCCTCTTCTATCTGG + Intergenic
960375840 3:116900410-116900432 GCCTGAGTCCCTCTCCTGGCTGG - Intronic
960934697 3:122891157-122891179 GCCTGCAGCACTCTCCACGCTGG + Intergenic
961778180 3:129305064-129305086 GCCTGCTGCCCTTTCCTGGCAGG + Exonic
961781536 3:129323565-129323587 GCCTGCGGCCCCTTCCAGGCCGG + Intergenic
962481144 3:135799769-135799791 ACCTGCTGCCCTCCCCTGGAAGG - Intergenic
962840148 3:139225680-139225702 CCCTGAGGCCCTCTCCAGGCAGG - Intronic
964047032 3:152340924-152340946 GCCTGCTGCAGTCTCCTGTCTGG - Intronic
967989955 3:195123342-195123364 GCAAGCCCCCCTCTCCTGGCCGG + Intronic
968300192 3:197607032-197607054 GACTGTGGCCCTCACCTGACAGG + Intergenic
968506480 4:973443-973465 GCCCGGGGCCCGCGCCTGGCTGG - Exonic
968513102 4:1003845-1003867 GGCTCCAGCCCTCTCCTGCCTGG + Intronic
968641530 4:1717348-1717370 GCCTGTGGCTGCCTCCTGGCAGG + Exonic
968729880 4:2264669-2264691 GGCTCCAGACCTCTCCTGGCAGG - Intergenic
968994910 4:3939153-3939175 GGCTGAGGCCTTTTCCTGGCAGG + Intergenic
969681916 4:8647890-8647912 TCCTGAGCACCTCTCCTGGCGGG - Intergenic
969829456 4:9782808-9782830 CTCTGCGGCCCTCTCCAGGGAGG - Exonic
971021937 4:22546003-22546025 GGGTACAGCCCTCTCCTGGCTGG + Intergenic
978795764 4:112706049-112706071 GCCTGCGGCCCGCGCCCGCCCGG - Intergenic
979142888 4:117200982-117201004 GCCTGGTGCCCTATCCTGGTAGG - Intergenic
982479027 4:155886346-155886368 GCCTGCTGCTATCTCCTAGCTGG + Intronic
982771616 4:159401825-159401847 GCCTGAGGCCCTCCCTCGGCAGG + Intergenic
984839567 4:184055717-184055739 GCCTGTGAGCCTCTCCTGGCTGG + Intergenic
984973402 4:185209864-185209886 GCCTGCGGCCCGCGCGGGGCTGG - Intronic
985697483 5:1348993-1349015 GCCTGCTGCCCTTTCCTAGTGGG + Intergenic
985732263 5:1556027-1556049 CCCTGCGGGCCTCACCTTGCAGG + Intergenic
986230775 5:5863058-5863080 ACCTGCTGGCCTCTCCTGGTGGG - Intergenic
991684280 5:69167362-69167384 TCCTGCGGCCCTCTCCCGCTCGG - Intronic
997354361 5:133252848-133252870 CCCTCCGGTCCTCTGCTGGCTGG + Intronic
997892591 5:137688246-137688268 GCCTGTGATCCTCTCCTGGGTGG - Intronic
998365217 5:141626078-141626100 GCCTGCTCCCCTCTGCTGGTTGG - Intronic
999262032 5:150244397-150244419 CCCTGGGGCCCTCGCCAGGCAGG + Intronic
1002181563 5:177433543-177433565 ACCTGTGGCCCGCACCTGGCAGG - Exonic
1002649194 5:180679372-180679394 GCCTGCGGCCCTCAACAGGGTGG + Intergenic
1002719025 5:181246792-181246814 GCCTGCGGGCATCCCCTGGGAGG - Intronic
1002789811 6:428681-428703 TCCTTGGGCCCTCTCCTGTCAGG - Intergenic
1002966373 6:1970516-1970538 GCCTGCGGCCTGCTCCTGGTCGG - Intronic
1003552120 6:7108818-7108840 GCCCGCGGCCCCCTCCCGGCCGG - Intronic
1006386151 6:33732160-33732182 GGCTGCATCCCTCTCCTGCCAGG - Intronic
1007376960 6:41463479-41463501 GCCTGAGGCCCCCTGCTGGGCGG - Intergenic
1007614561 6:43172306-43172328 CCCTTCGGCCCTCCCCGGGCAGG - Intronic
1010339653 6:74733565-74733587 GCCTGAGTCCTTCTCCAGGCAGG - Intergenic
1011642996 6:89432989-89433011 ATCTGCAGCCCTCTCCTGGGTGG - Intergenic
1016088392 6:139944543-139944565 GCAAGCAGCCCTCTCCAGGCTGG + Intergenic
1016920471 6:149288369-149288391 GCTTGCTGCCGTCTCCTGGAGGG - Intronic
1016997298 6:149969727-149969749 GCCTGAGGCCCTCCCCTCCCTGG + Intronic
1017811617 6:157987998-157988020 GCCCTCGGCCCTCTCTTGCCCGG - Intronic
1019522570 7:1467411-1467433 GCCTGCGGCGGGCACCTGGCAGG - Intergenic
1022537344 7:31106406-31106428 GCCTGGGGCCCTTCCCAGGCTGG - Intronic
1026619027 7:71934115-71934137 GCCTGCAGCCCTCTTTTGTCTGG - Intronic
1028985676 7:97006576-97006598 GCCTGCCGGCCTCTCCCAGCCGG + Intronic
1029476670 7:100789150-100789172 ACCTGCTGCCATTTCCTGGCTGG - Intronic
1035039862 7:155919758-155919780 CCCTGCTGCCGCCTCCTGGCTGG - Intergenic
1035607886 8:940945-940967 CGCTGCTCCCCTCTCCTGGCAGG - Intergenic
1036645753 8:10610864-10610886 GCCTGCGGGCACTTCCTGGCCGG - Exonic
1039884818 8:41648807-41648829 GCCTGCTGCCCTGGCCAGGCTGG - Intronic
1040832392 8:51691815-51691837 GCCTTCCTCCCTCTGCTGGCCGG - Intronic
1041547465 8:59061841-59061863 GCCTTCCTCCCTCTCCTGGCAGG - Intronic
1049170863 8:141159850-141159872 GCCTTTGGCCATCTCCTGGTGGG + Intronic
1049250117 8:141583752-141583774 CCCTGCGGGCTTCTCATGGCAGG + Intergenic
1049266808 8:141671935-141671957 TCCTGCCTCCCTCTCCTGGGAGG + Intergenic
1049349380 8:142155994-142156016 GCCTGCGACATCCTCCTGGCAGG - Intergenic
1049469782 8:142770158-142770180 GCCTGTGGCCGTCACCTGCCTGG - Intronic
1049672017 8:143874086-143874108 GCCTGCACCCGGCTCCTGGCAGG - Intronic
1050176783 9:2876718-2876740 GCCTGAGTCCCTCTCCAAGCAGG - Intergenic
1056832443 9:89928174-89928196 TCCTGGGGGCCTCTCCTGGCTGG + Intergenic
1057388727 9:94625850-94625872 GCGGGCGGCCCTGTCCTTGCAGG - Intronic
1057793719 9:98141249-98141271 GCTTCCTGCCCTGTCCTGGCAGG + Intronic
1057880786 9:98791331-98791353 GCCTGCTGCCACCTGCTGGCAGG + Intronic
1058161906 9:101579181-101579203 ACCTGTGGCACTCACCTGGCTGG + Exonic
1058861210 9:109119432-109119454 GCCGGCGGCCCGCTCCTGTACGG - Exonic
1058868623 9:109183717-109183739 GCCTGCAGCCCTCTGCTGGCGGG - Intronic
1058905346 9:109478079-109478101 ACCTGAGCCTCTCTCCTGGCAGG - Intronic
1061375177 9:130219866-130219888 GCCCTCGGCCCTCACCAGGCAGG + Intronic
1061542952 9:131288163-131288185 GCCTCCACCCCTTTCCTGGCAGG - Intergenic
1061876480 9:133546596-133546618 CCCTGCAGCCCTGGCCTGGCTGG - Intronic
1062278244 9:135740641-135740663 GGCTGAGACCCTCTCCTGGGAGG + Intronic
1190495568 X:51025520-51025542 GCCTGCTGCCCTCTCCCTTCCGG - Intergenic
1199743275 X:150755975-150755997 GTCTTCTGCCCTCTCCTGTCAGG + Intronic