ID: 928379076

View in Genome Browser
Species Human (GRCh38)
Location 2:30802701-30802723
Sequence CCTAAAAACCAGCTCTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928379076 Original CRISPR CCTAAAAACCAGCTCTTGCA GGG Intronic
902827357 1:18985801-18985823 CCTAAAATCCAGTTCTGGAAGGG + Intergenic
913568913 1:120100921-120100943 CCCAAAAACCAGGGCTTGAATGG + Intergenic
913581815 1:120233909-120233931 CCTAAAAGCCAACTGTTGCCTGG - Intergenic
913626360 1:120664479-120664501 CCTAAAAGCCAACTGTTGCCCGG + Intergenic
914563746 1:148845356-148845378 CCTAAAAGCCAACTGTTGCCTGG - Intronic
914609081 1:149284870-149284892 CCTAAAAGCCAACTGTTGCCTGG + Intergenic
916968764 1:169985117-169985139 GGTAAAAACCAGATCATGCAGGG + Intronic
917658517 1:177153194-177153216 CTTAACAACCAGCTCTTAGAGGG - Intronic
919651641 1:200155430-200155452 TCTAAAAACCAATTCTTGAAAGG - Intronic
920966596 1:210706246-210706268 TTTAGACACCAGCTCTTGCAGGG + Intronic
921156916 1:212446013-212446035 CCCAAGAACCTGCTCCTGCAGGG - Exonic
922178497 1:223215477-223215499 CCTAAACACCAGCAGATGCATGG - Intergenic
922400107 1:225244789-225244811 TCAAAAAAACAGCTCTTGGATGG + Intronic
922477478 1:225916590-225916612 CCTCAATGCCAGCTCTTGCAGGG + Intronic
1062952744 10:1516910-1516932 CCTAAAACCCAGCACGTGAAAGG - Intronic
1064155169 10:12897888-12897910 CCTGAAAATCAGCACGTGCAGGG - Exonic
1068085803 10:52372171-52372193 CAAAAAAACCAGCTCCTGGATGG + Intergenic
1075388937 10:122078309-122078331 CCTGAAAACCTGGTCGTGCAGGG + Intronic
1075969581 10:126641053-126641075 CCTAAAAACCAGGTGTTTCAGGG + Intronic
1080671364 11:34382185-34382207 CCTCAAAGCCAGCTCCTGAAGGG - Intergenic
1089806519 11:121095470-121095492 CCTGAAAATCAGCTCTCTCATGG - Intergenic
1090030582 11:123202761-123202783 AATAAAAACCAGCTCTTCCCTGG - Intergenic
1092006139 12:5072048-5072070 CATAGAAAGCAGTTCTTGCAGGG + Intergenic
1092605224 12:10111486-10111508 CCCACAAACCAGCTCCCGCAGGG - Intronic
1100354862 12:93819333-93819355 TCTAGAAACCAGCTCAAGCAAGG + Intronic
1100745783 12:97644220-97644242 CCTCAAAACAAGCTATTCCAGGG - Intergenic
1101293954 12:103401736-103401758 CCTAAAAACCATCTCAGGAATGG - Intronic
1101329043 12:103742573-103742595 TCAAAAAACAAGCTCTAGCACGG - Intronic
1115073721 14:29359599-29359621 CCTCAAATTCAGCTCTTACAGGG + Intergenic
1118759712 14:68872744-68872766 ATAAAAAACCAGCTCTAGCAGGG - Intergenic
1125983061 15:44021338-44021360 CCTTAAAACCAGCTCATAAAAGG + Intronic
1128809052 15:70556660-70556682 TCTAAGATCCAGCTTTTGCAAGG + Intergenic
1129826274 15:78637147-78637169 CCTAAATACCGCCTCATGCAGGG + Intronic
1133837668 16:9381125-9381147 TTAAACAACCAGCTCTTGCAGGG + Intergenic
1144597191 17:16580620-16580642 CTTAAAAACCAGCTGTTGGCCGG + Intergenic
1152517308 17:80833217-80833239 CTGAAAACCCAGCTCTTGCCTGG + Intronic
1152895169 17:82906854-82906876 CATAAAGGCCAGGTCTTGCACGG - Intronic
1152946863 17:83202732-83202754 CCCGAAAACCAGCCCTGGCATGG + Intergenic
1155571838 18:27203064-27203086 CCTAAAAACCAGCCAATTCAGGG + Intergenic
1156346807 18:36264377-36264399 CCTAGAAAACAGCTGATGCATGG - Intronic
1156356246 18:36343579-36343601 TTTAACAGCCAGCTCTTGCATGG - Intronic
1158436856 18:57440183-57440205 CCCCAAGACCAGCCCTTGCAGGG + Intronic
1160544548 18:79644059-79644081 CCTAAAGAGCCTCTCTTGCACGG + Intergenic
1160885459 19:1344843-1344865 CCTCAAATGCAGATCTTGCAGGG - Intergenic
1164438648 19:28254356-28254378 CCTCAAAAGCAGCTGTTCCATGG - Intergenic
1164564757 19:29317861-29317883 CTTAAAAACCATCCCTTGTAGGG + Intergenic
1164897843 19:31892641-31892663 CTTTAAGAACAGCTCTTGCAAGG + Intergenic
1165136957 19:33675582-33675604 CCAGGAAACCAGCTCTTGCGTGG - Intronic
1165273213 19:34727920-34727942 CCTAAGAACCAGCACTTCTAGGG + Intergenic
1165286263 19:34844835-34844857 TTTAACAATCAGCTCTTGCAGGG - Intergenic
1166235954 19:41456767-41456789 CCTAATAAACAGCTCTCGCCTGG - Intergenic
1166875971 19:45897545-45897567 ACCAAAAACAAACTCTTGCAGGG - Intronic
927580168 2:24236455-24236477 ACTAAAAACCACCAATTGCATGG + Intronic
928379076 2:30802701-30802723 CCTAAAAACCAGCTCTTGCAGGG + Intronic
928894627 2:36246433-36246455 TCTAAAAACCACTTCCTGCATGG + Intergenic
932896760 2:75647320-75647342 CCTACACACCTGCTCGTGCAGGG - Intronic
933825864 2:86160316-86160338 AATAAACAGCAGCTCTTGCAAGG + Intronic
935814491 2:106834568-106834590 ACCAAAAAGCAGCCCTTGCAGGG - Intronic
936070121 2:109363621-109363643 CTTTAAAAACAGTTCTTGCAAGG + Intronic
939569269 2:143820997-143821019 GCTAAAATACAGCTCTTGGAAGG + Intergenic
941640132 2:167978267-167978289 CCAAAAAACCACCTCTTGCCTGG - Intronic
944907248 2:204274845-204274867 CCTAAAAGCCAGCACTCACAAGG + Intergenic
945936300 2:215905972-215905994 CCTCACCACTAGCTCTTGCAGGG - Intergenic
947115068 2:226761075-226761097 CATGAAAACCAACACTTGCAGGG + Intronic
948097159 2:235344572-235344594 CACACACACCAGCTCTTGCAAGG + Intergenic
948618058 2:239214264-239214286 CCTCAACACCAGCACCTGCATGG + Intronic
1169675293 20:8146214-8146236 CCTAAAAAGCCTCCCTTGCAGGG + Intronic
1170395022 20:15916470-15916492 CTTAAAACCCATCTCTTGAAGGG + Intronic
1170766025 20:19290701-19290723 CCTGAGACCCACCTCTTGCATGG + Intronic
1173527645 20:43745216-43745238 CCTCAACCCCAGCTCTTGCTGGG - Intergenic
1174558076 20:51410692-51410714 CAAAAATACCAGCTCTTGTATGG - Intronic
1182970848 22:34575085-34575107 CCTCAAAAGCAGTTCTTGGAGGG - Intergenic
1183147719 22:36009990-36010012 CCTAAAACCCATCTCTTCTAAGG + Intronic
1184377721 22:44125009-44125031 CTTACAGACCAGCTCTTGGAGGG + Intronic
949252439 3:2002725-2002747 TCTAAAAATCAACTTTTGCATGG + Intergenic
950945271 3:16939439-16939461 CTTGAAAACCACCTCTTTCAAGG - Intronic
952096307 3:29959115-29959137 TTTAAATCCCAGCTCTTGCATGG + Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
952819915 3:37477424-37477446 CCCAGCAACCAGCTCTGGCAAGG + Intronic
961626386 3:128266667-128266689 CCTAACACCCAGCTCTGGCCAGG - Intronic
967044062 3:185720241-185720263 TTTAAAAAACGGCTCTTGCAGGG + Intronic
969434774 4:7182182-7182204 TCTTCAAACTAGCTCTTGCAAGG - Intergenic
973560777 4:52133161-52133183 TCAAAAAACCAGGTCTTGTATGG - Intergenic
981089785 4:140720759-140720781 CTTAGAAACCAGCTCTTCAAAGG - Intronic
986636351 5:9825582-9825604 CCTAAAAAACAGCTCCTCCTGGG + Intergenic
990441274 5:55847681-55847703 ACTAAAAACCAGATCATGAATGG + Intergenic
990884857 5:60579707-60579729 ACTACAGACCAGCTCTGGCATGG + Intergenic
991554204 5:67876970-67876992 TTTAACAACCAGCTCTTGCGGGG - Intergenic
993717023 5:91285268-91285290 CATAAAAAGGAGCTTTTGCAGGG + Intergenic
995619927 5:114013930-114013952 AGGAAATACCAGCTCTTGCAGGG - Intergenic
998449955 5:142226554-142226576 CCTAAAAACCAGGGCTTTTAGGG + Intergenic
999282529 5:150374848-150374870 CCTAAACCCCAGCACCTGCATGG + Intronic
1001924830 5:175628408-175628430 CCTCCAAACCAGCTCTTGAGAGG + Intergenic
1004491691 6:16123189-16123211 ATTAAAAACCAGATCTTCCAAGG - Intergenic
1007640486 6:43335251-43335273 CCTAAAAACCAGGGCTAGAAAGG + Intronic
1008594366 6:53026484-53026506 GTTAATGACCAGCTCTTGCAAGG - Intronic
1010024454 6:71199449-71199471 CCCAAAAACCAAATCTTGGAAGG - Intergenic
1014619169 6:123644597-123644619 CCTGAAAACCAGGGCTTGTATGG - Intergenic
1015791918 6:136971916-136971938 CCAAATAACCTGCTCTTGTATGG - Intergenic
1020791857 7:12637031-12637053 GCTAAAATCAAGCTATTGCAGGG - Intronic
1021119838 7:16786762-16786784 GTTAAAAACCAGCTTTTCCAGGG + Intergenic
1023535833 7:41208595-41208617 CCTGAAAACCAACTCTTATATGG - Intergenic
1027224986 7:76238045-76238067 CTGAAAAACCAGCTCTTGAATGG + Intronic
1028474637 7:91239867-91239889 CTTACAAACCAGCTCTTCCTGGG - Intergenic
1031688591 7:124762987-124763009 TTTAAACACCAGCTCTTGGAAGG - Intronic
1033730515 7:144174202-144174224 CCTAAAAGACAGATCTAGCAAGG - Intergenic
1035934588 8:3822276-3822298 CCTAGACACAAGCTCTTACAAGG - Intronic
1036174556 8:6524598-6524620 CCTAAAAAACACCTCGTACATGG - Intronic
1043837020 8:85060127-85060149 CCCAACAACCAGCTCATGCAAGG - Intergenic
1044492653 8:92837791-92837813 CCTCAAACCCAACTCTAGCAAGG - Intergenic
1044667284 8:94642714-94642736 CCTAAAAACCGGCTGTTCCGGGG + Intronic
1045054379 8:98356684-98356706 TCTAAACACCAGTTCTTGAAAGG - Intergenic
1047561620 8:125992718-125992740 CCTAAAAGCCAACTCTCCCACGG - Intergenic
1052044503 9:23778577-23778599 CTTAAAATCCAGCCCTTGCAGGG - Intronic
1052783249 9:32802664-32802686 CCCTCAAACCAGCTCTGGCATGG + Intergenic
1056431908 9:86536062-86536084 CCAACAACGCAGCTCTTGCATGG - Intergenic
1061343446 9:130002475-130002497 TCTAACAACCAGCTCTGGCCAGG - Intronic
1185471266 X:385294-385316 ACTAAAAACAAGCACTTGGAGGG - Intronic
1189204352 X:39225143-39225165 TTTAACAACCAGCTCTGGCATGG + Intergenic
1195642152 X:107187692-107187714 CCCAAAAATCAGCTCTTGGCTGG - Intronic
1196673287 X:118392100-118392122 CCCAAAAACCAGCAGATGCAGGG - Intronic
1197465787 X:126803270-126803292 CTGAAAAACCTGCTCTTGAATGG - Intergenic
1198636127 X:138702562-138702584 CATGAAAACCAGTTCTTGAAGGG - Intronic