ID: 928382638

View in Genome Browser
Species Human (GRCh38)
Location 2:30832928-30832950
Sequence ATGCCCTTCTAGAAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928382638_928382641 7 Left 928382638 2:30832928-30832950 CCTTCATTCTTCTAGAAGGGCAT No data
Right 928382641 2:30832958-30832980 TAGGTCCTTTTTCCATGGTTTGG 0: 14
1: 15
2: 18
3: 7
4: 111
928382638_928382640 2 Left 928382638 2:30832928-30832950 CCTTCATTCTTCTAGAAGGGCAT No data
Right 928382640 2:30832953-30832975 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928382638 Original CRISPR ATGCCCTTCTAGAAGAATGA AGG (reversed) Intergenic
No off target data available for this crispr