ID: 928383886

View in Genome Browser
Species Human (GRCh38)
Location 2:30847350-30847372
Sequence TGAGTGCCAGGTCAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928383879_928383886 30 Left 928383879 2:30847297-30847319 CCTCTGGTTGAGAAAAGGAGAGG No data
Right 928383886 2:30847350-30847372 TGAGTGCCAGGTCAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928383886 Original CRISPR TGAGTGCCAGGTCAGCTGCA GGG Intergenic
No off target data available for this crispr