ID: 928388259

View in Genome Browser
Species Human (GRCh38)
Location 2:30888097-30888119
Sequence TGGATTGGACTCCACTAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928388256_928388259 -5 Left 928388256 2:30888079-30888101 CCTGGACTGCTACTTAATTGGAT No data
Right 928388259 2:30888097-30888119 TGGATTGGACTCCACTAGATGGG No data
928388252_928388259 27 Left 928388252 2:30888047-30888069 CCTTTGTCAGCCTCTATGACATG No data
Right 928388259 2:30888097-30888119 TGGATTGGACTCCACTAGATGGG No data
928388251_928388259 28 Left 928388251 2:30888046-30888068 CCCTTTGTCAGCCTCTATGACAT No data
Right 928388259 2:30888097-30888119 TGGATTGGACTCCACTAGATGGG No data
928388253_928388259 17 Left 928388253 2:30888057-30888079 CCTCTATGACATGAATTGCTTGC No data
Right 928388259 2:30888097-30888119 TGGATTGGACTCCACTAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928388259 Original CRISPR TGGATTGGACTCCACTAGAT GGG Intergenic
No off target data available for this crispr