ID: 928392542

View in Genome Browser
Species Human (GRCh38)
Location 2:30920515-30920537
Sequence CAGTGTTAGCAGAAGGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928392535_928392542 5 Left 928392535 2:30920487-30920509 CCATAAGAGGAGAGAATGTGACA 0: 1
1: 0
2: 1
3: 20
4: 221
Right 928392542 2:30920515-30920537 CAGTGTTAGCAGAAGGGGTTGGG 0: 1
1: 0
2: 1
3: 17
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928392542 Original CRISPR CAGTGTTAGCAGAAGGGGTT GGG Intronic
901135434 1:6990029-6990051 AGATGTTAGCAGAAGGGCTTGGG - Intronic
901211166 1:7526810-7526832 CTCTGTTAGCAGATGGGGCTGGG + Intronic
903007472 1:20308320-20308342 CAGTGTGGGCAGATTGGGTTGGG + Intronic
907803191 1:57791978-57792000 GACTGTTAACAGAAGAGGTTGGG - Intronic
908574128 1:65441285-65441307 CTGATTTAGCAGAAGGGGTGGGG + Intronic
919762283 1:201105793-201105815 CAGTGCTGGCAGAAGGGATATGG + Intronic
920801940 1:209196626-209196648 GATGGTTAGCAGAAAGGGTTGGG - Intergenic
920811394 1:209289163-209289185 AACTGTTAGCAGAAGATGTTTGG + Intergenic
920991139 1:210941167-210941189 TAGTGTTAGCACATGTGGTTAGG - Intronic
924879501 1:248144658-248144680 CAGTGTTAACAGAAACTGTTTGG - Intergenic
924927301 1:248695720-248695742 CCGGGGTAGGAGAAGGGGTTGGG - Intergenic
1063276793 10:4578123-4578145 CAGTCTTTCCAGAAGGTGTTTGG - Intergenic
1063494018 10:6490210-6490232 CAGTGGAGGCAGGAGGGGTTAGG - Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG + Intergenic
1071728423 10:88222789-88222811 CAGAGTTAGTACAAAGGGTTTGG + Intergenic
1071962057 10:90816750-90816772 TAGTTTTAGCAGCAGGGGATTGG - Intronic
1072134829 10:92535452-92535474 CAGTGTTAACAGCATGCGTTTGG + Intronic
1073073091 10:100807140-100807162 CAGTGTCTGCAGAAAGTGTTGGG - Intronic
1073307169 10:102512184-102512206 CAGTGTCAGCAGAAGGATTTGGG + Intronic
1075453658 10:122570650-122570672 CTGTGGCAGCAGAAGAGGTTGGG + Intronic
1075453858 10:122572074-122572096 CTGTGGCAGCAGAAGAGGTTGGG + Intronic
1076049951 10:127324427-127324449 CAGTGAGAGCCAAAGGGGTTTGG - Intronic
1076822411 10:132945978-132946000 GAGTGTCAGCAGGAGGGGGTGGG + Intergenic
1077888912 11:6405046-6405068 AGGTGTGAGCAGAAGGGGCTGGG - Intronic
1079349775 11:19682648-19682670 CAATGATAGCAGAAGGGATGGGG + Intronic
1080142661 11:28941518-28941540 AAGTTCTAGAAGAAGGGGTTAGG - Intergenic
1080412569 11:32039666-32039688 CAGTGTTATTAGATGAGGTTTGG + Intronic
1087789685 11:102393136-102393158 CAGTGTTTGCAGCAGTGGTAAGG + Intergenic
1090640359 11:128724602-128724624 CAGTGTAGGCAGGAGGGCTTGGG - Intronic
1091322860 11:134664277-134664299 CAGTGTGAGCAGAATGTGTGTGG - Intergenic
1091345438 11:134849924-134849946 AAGTGTTTCCAGGAGGGGTTAGG + Intergenic
1092758811 12:11790559-11790581 CAGTGGGAGAAGAAGGGGTAGGG + Intronic
1093240699 12:16668429-16668451 CAGTGTTTGCAGAAGAGCTTTGG - Intergenic
1095894816 12:47269647-47269669 CAGAGTTAGCAGACAGGGATTGG - Intergenic
1096724562 12:53550711-53550733 AAGTGTTCACATAAGGGGTTGGG + Intronic
1098474098 12:70879504-70879526 CAGTGGTAACAGAATGGTTTTGG - Intronic
1098772765 12:74575404-74575426 CAGTCATAGCAGAAGGGGAAGGG - Intergenic
1103808892 12:123597652-123597674 CAGTGTCAGCATTAGGGTTTTGG + Exonic
1105883125 13:24620974-24620996 CAGTGTTTCCAGAGGGGATTAGG + Intergenic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1116723759 14:48534224-48534246 CAGTGATGGCAGAAGGAGTTGGG + Intergenic
1118158116 14:63261397-63261419 CAATGTTAGCATAGGTGGTTAGG - Intronic
1118374948 14:65168635-65168657 CAGTTATAGGAGAAAGGGTTTGG - Intergenic
1120096743 14:80397730-80397752 CACTGTTAGCTGACGTGGTTTGG + Intergenic
1121149051 14:91614122-91614144 TAGTGTTACCAGGAGGGGTGCGG - Intronic
1126033690 15:44526780-44526802 CTGTGTGAGCTGAAGGGGCTGGG - Exonic
1126074536 15:44896475-44896497 CACAGTAAGCACAAGGGGTTGGG - Intergenic
1126455353 15:48855580-48855602 CAGAGTTGGCAGGAGAGGTTTGG + Intronic
1126657642 15:50996478-50996500 CAGAGTTGGAAGAAGGTGTTGGG + Intronic
1126893984 15:53238220-53238242 CAGTGTAAGCAGAATAGGCTGGG + Intergenic
1128364048 15:66984417-66984439 CAGTGTTGGGAGGTGGGGTTGGG - Intergenic
1132589169 16:718929-718951 TAGTGTTTGCAGAAGTGTTTGGG - Exonic
1134989490 16:18686493-18686515 TGGTGTCAGCAGAAGGGGTGAGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138399551 16:56734417-56734439 GAGTGGTAACAGAAGGAGTTGGG + Intronic
1143274502 17:5700053-5700075 CAGTGTCAGAAGAGGGGGTGGGG + Intergenic
1146832593 17:36082563-36082585 GAGTGTGAGCAGAAGAGGATAGG + Intergenic
1148086048 17:44994463-44994485 CAGTGTTAGGAGGCTGGGTTGGG - Intergenic
1148194998 17:45706906-45706928 CAGTGTGATCAGATGGGGTTGGG + Intergenic
1150127180 17:62644950-62644972 CAGTGTTCACAGAAGGGGAGGGG + Intronic
1150495585 17:65605610-65605632 TAGTGCTGGCAGAAGGGATTTGG - Intronic
1150943741 17:69722089-69722111 TCTTATTAGCAGAAGGGGTTGGG - Intergenic
1150943756 17:69722289-69722311 CCTTATTAGCAGAAGGGGTTGGG - Intergenic
1151486825 17:74406166-74406188 CAGTGGCTGCATAAGGGGTTGGG + Intergenic
1152218698 17:79049143-79049165 CAGTGGGGGCAGAAGGGGTCTGG - Exonic
1153309601 18:3665272-3665294 CATTTTTAGAGGAAGGGGTTGGG - Intronic
1154134310 18:11762292-11762314 CAGTGCTGGCAGAAGAGCTTCGG - Intronic
1159009958 18:63049562-63049584 CACTGTTACCAGAAAGTGTTAGG + Intergenic
1159704309 18:71667755-71667777 AAATGTTAGCAGAAGATGTTGGG + Intergenic
1160260951 18:77293858-77293880 CAGTGTTGGGAGGAGGGGTCTGG + Intergenic
1162258694 19:9514701-9514723 CTGTTTTAAAAGAAGGGGTTGGG + Intergenic
1167245494 19:48370774-48370796 CAGTGTTGGCGATAGGGGTTGGG - Intronic
926271429 2:11369601-11369623 CAGTGTTAGCGTAAGAGATTTGG + Intergenic
926329458 2:11812649-11812671 CAGTCATTGCAGATGGGGTTGGG + Intronic
928224073 2:29432378-29432400 CAGTCATAGCAGAAGGGGCGGGG - Intronic
928392542 2:30920515-30920537 CAGTGTTAGCAGAAGGGGTTGGG + Intronic
928708865 2:33982078-33982100 TAGTGGTAGAAGATGGGGTTTGG + Intergenic
930580978 2:53211452-53211474 TAGGGGTAGCAGAAGGGGTTTGG + Intergenic
930834471 2:55778386-55778408 CAGTTTTAGTTGAAGGGGCTCGG + Intergenic
931889477 2:66655326-66655348 CAGTGTTTGAAGATGGGATTTGG - Intergenic
933832796 2:86224378-86224400 CAGTGGTGGCAGATGGTGTTGGG - Intronic
935673942 2:105578322-105578344 CAGTGTTTGCAGTTGGGGTGAGG - Intergenic
938544073 2:132311551-132311573 CAATGTAGGGAGAAGGGGTTAGG - Intergenic
939696344 2:145329401-145329423 CAGTTTCAGCAGAAGGATTTTGG - Intergenic
939766624 2:146258079-146258101 CAGAGAAAGAAGAAGGGGTTTGG - Intergenic
942408054 2:175676415-175676437 CTGGGTTAGATGAAGGGGTTGGG + Intergenic
943738505 2:191385002-191385024 CCTTGTTAGCAGAAGGGGAGAGG + Intronic
944688854 2:202141192-202141214 CAGTGGGAGCAGAAACGGTTAGG + Intronic
945033188 2:205683791-205683813 CAATGTTAACTGAAGGGCTTGGG + Intronic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
946044471 2:216810110-216810132 CAATGCTTGCAGAAGGAGTTTGG + Intergenic
946415379 2:219537474-219537496 CAGAGTCAGGAGAAGGGGATGGG + Intronic
1168789820 20:568485-568507 TAGTGTCAGCAGCAGGGGCTAGG - Intergenic
1173014757 20:39215029-39215051 CAGTGTTGCCAGGAGGGGTGGGG - Intergenic
1173354317 20:42272790-42272812 CAGTGTGACCAGATGAGGTTAGG - Intronic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1178083088 21:29085933-29085955 CAGTTTTACAGGAAGGGGTTGGG - Intronic
1178295595 21:31407473-31407495 CAGTGGTAGCAGTAGTGCTTGGG - Intronic
1178763796 21:35429975-35429997 CAGAGTTCGCAGAAGAGGTGGGG + Intronic
1179995467 21:44971957-44971979 CAGTGTGAGCAGGAAGGGATGGG + Intronic
1180572219 22:16736868-16736890 TAATGTTAGCAGAAGGAGTGTGG + Intergenic
1180672789 22:17566244-17566266 GAGTGTTAGAAGCAGGGGGTAGG - Intronic
1180707155 22:17817003-17817025 CAGTGCTACCAGGAGGGGCTGGG - Intronic
1180907828 22:19427615-19427637 CAGTGTTATGAAAAGGGATTTGG - Intronic
1181372354 22:22428589-22428611 CAATGTCAGGAGATGGGGTTAGG + Intergenic
1181473752 22:23156378-23156400 CTGTCTTAGCAGAGGGGGCTGGG + Intronic
1182046229 22:27276255-27276277 CAGTCATAGCAGAAGGGGAAGGG - Intergenic
1182270895 22:29152645-29152667 AAGAGTCAGCAGGAGGGGTTGGG - Intronic
1183275413 22:36893757-36893779 GTGTGTTGGAAGAAGGGGTTGGG + Intergenic
950576838 3:13837168-13837190 AAGTGTTCACAGAAGGGTTTTGG - Intronic
950633953 3:14302305-14302327 TGGTGTTGGCAGAAGGGGTCAGG - Intergenic
951747877 3:25999361-25999383 CAGGGTGAGCACAAGGGGTCAGG - Intergenic
952993330 3:38852621-38852643 CAGTAATAGAACAAGGGGTTTGG - Intronic
954825838 3:53372654-53372676 CAGTGTTAGGAGGAGATGTTAGG - Intergenic
956796286 3:72721771-72721793 CAGAGTTACCAGATGGGGCTGGG - Intergenic
960522157 3:118667737-118667759 CAGTGATGGCAGAAAGGGTCGGG - Intergenic
962920253 3:139943907-139943929 CAGGTTTATCAGAAGGGGTATGG - Intronic
964046837 3:152338547-152338569 CAGTGGTAGCAGCAGGTGTTGGG + Intronic
969894789 4:10293278-10293300 CCGTATGAGCAGAAGGTGTTAGG - Intergenic
970519552 4:16868478-16868500 CTGGGGTGGCAGAAGGGGTTGGG - Intronic
977564105 4:98564129-98564151 CAGTGATAACAGGAGGGGCTGGG - Intronic
982308141 4:153955055-153955077 CTGTGTCAGCAGAATGAGTTGGG - Intergenic
982730398 4:158950045-158950067 CATTGTTGGTAGATGGGGTTCGG - Intronic
982757579 4:159240737-159240759 CAGTGCTAACAGAATGGCTTTGG - Intronic
986591981 5:9380378-9380400 CTGTGTTTGCGCAAGGGGTTAGG - Intronic
987803790 5:22734604-22734626 CAGTGTTTGGAGAAGAAGTTGGG - Intronic
988889410 5:35598768-35598790 CAGTGTGGGCAGATGGGGATGGG + Intergenic
989429766 5:41339078-41339100 CAGTATTAGAGGAAGGGGTAGGG + Intronic
989662740 5:43816649-43816671 CAGTGTTAGAGGAAGGGGTCTGG + Intergenic
994087004 5:95770001-95770023 CAGTGTTTGGAGAAGGGGGTAGG + Intronic
995359134 5:111274051-111274073 CAGTGTGAGCAGAAAGGAGTGGG - Intronic
995538883 5:113165052-113165074 TAGTGTTGGCAGATGGGGTGGGG - Intronic
996187750 5:120499922-120499944 CAGTGTTAACAGAAGAGTGTTGG - Intronic
996619568 5:125483862-125483884 CAGTGTAAGCCTAAAGGGTTAGG + Intergenic
996845540 5:127895150-127895172 CACTGTTAGAAGAAGGTGGTGGG - Intergenic
997837734 5:137209690-137209712 CATTGTTAGGCGAAAGGGTTGGG - Intronic
1001046743 5:168379320-168379342 TAGTGTCAGCAGAAGGGGCTGGG + Intronic
1005147730 6:22710734-22710756 AAGTGTTAGCAAATGGGGCTAGG + Intergenic
1006616583 6:35332133-35332155 CACAGGAAGCAGAAGGGGTTGGG + Intergenic
1007132731 6:39491687-39491709 CAGTGTTAGCAGAAGCCTTGAGG + Intronic
1007267389 6:40607281-40607303 TAGAGTTAGCAGAAGGGGATTGG + Intergenic
1007359363 6:41344030-41344052 CAGTGTGAGGTGAAGGGGCTTGG - Intronic
1011250857 6:85370709-85370731 AAGTGTTAGCATTTGGGGTTGGG - Intergenic
1012043336 6:94238566-94238588 CTGTGGGAGCACAAGGGGTTGGG + Intergenic
1017802707 6:157912036-157912058 CTGGGTTAGAAGCAGGGGTTCGG - Intronic
1019075516 6:169384434-169384456 CAGGGTCAGCAGAAGGGATCAGG - Intergenic
1019471060 7:1221230-1221252 CACTGCCAGCAGAAGGGGCTGGG + Intergenic
1020428516 7:8095809-8095831 CCTTGGAAGCAGAAGGGGTTGGG + Intergenic
1021002257 7:15346264-15346286 CTGTCTTAGCAAAAGTGGTTTGG - Intronic
1021778113 7:24073674-24073696 CAGTTTTAGCAAAAGTGCTTTGG + Intergenic
1026035150 7:66825221-66825243 CCCTGTTTGCAGAAGGGCTTTGG - Intergenic
1026036933 7:66836662-66836684 CCCTGTTTGCAGAAGGGCTTTGG - Intergenic
1026202377 7:68225629-68225651 CAATGCTAGCTGAAGCGGTTTGG - Intergenic
1026984390 7:74545862-74545884 CCCTGTTTGCAGAAGGGCTTTGG + Intronic
1027338112 7:77175961-77175983 CAGTGTTATCAGAAGGGAAAGGG + Intronic
1027775841 7:82463329-82463351 TAGTGTTACCAGTGGGGGTTGGG + Intergenic
1027929195 7:84509245-84509267 GAGTGTGAGCAGGAGGGATTGGG - Intergenic
1029777615 7:102694832-102694854 CAGTGTTATCAGAAGGGAAAGGG - Intergenic
1034276931 7:149827994-149828016 GAGTGGTAGCAGAGGGGGTTCGG - Intergenic
1035496910 7:159335864-159335886 CAGTGTTAGGGTTAGGGGTTAGG + Intergenic
1037555464 8:20017992-20018014 CAGTGGTAGCAGAGGAGGTTAGG + Intergenic
1043533937 8:81179663-81179685 CAGTAGTTGGAGAAGGGGTTGGG + Intergenic
1043780273 8:84325351-84325373 CAGTCATAGCAGAGGGTGTTAGG - Intronic
1047200266 8:122759419-122759441 CACTGTTAGGAGCAGGGCTTTGG - Intergenic
1048210985 8:132453931-132453953 CAGTGTTCGCATCTGGGGTTTGG + Intronic
1048513174 8:135080621-135080643 CAGTGTCAGCAGAAGGGGTGGGG - Intergenic
1048787364 8:138064181-138064203 CAGTGGCTGCAGAAGGGGCTGGG - Intergenic
1049505559 8:142994639-142994661 CAGTTTTAGGGGAAGGAGTTGGG + Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1051251745 9:15166340-15166362 CATTGTAAGCAGAAGGGAATGGG + Exonic
1052862205 9:33444021-33444043 CAATTACAGCAGAAGGGGTTTGG - Intronic
1054746469 9:68858590-68858612 CAGTGTTAAGCTAAGGGGTTTGG + Intronic
1058707797 9:107651779-107651801 CAGTGTTGACAGAATGGATTGGG - Intergenic
1059181604 9:112219007-112219029 CAGTGTGAACAGAATGGATTAGG - Exonic
1060997781 9:127884899-127884921 CAGTGAATGCAGAAGGGGTGAGG - Intergenic
1061396034 9:130343721-130343743 CAGTGCTATCAGAGGGGATTTGG - Intronic
1061412293 9:130428210-130428232 AAGAGCTAGCAGAAGGGGTGGGG + Intronic
1061708193 9:132469099-132469121 CCTTGTTAGCAAAAGGGGTGGGG + Intronic
1062206211 9:135338871-135338893 CAGGGTTAGCTGCAGGGGCTGGG - Intergenic
1062400008 9:136368281-136368303 CAGTCTGGGCAGAAGGGGTTAGG - Intronic
1062689330 9:137833374-137833396 CAGTGTGCGCAGCAGGGGTTGGG + Intronic
1189173744 X:38933755-38933777 AAGTGTTAGGAGAGGGGCTTGGG + Intergenic
1189247380 X:39574085-39574107 CAGTGTTAGCTGAATTGGCTGGG - Intergenic
1190385110 X:49877884-49877906 TAGGGTTAGCAGCAGGAGTTGGG - Intergenic
1190536666 X:51435336-51435358 CAGTTTGAGCAGAAAGGCTTTGG + Intergenic
1191731780 X:64344045-64344067 CAGAGTTAGCATAAGTGGGTGGG - Intronic
1195967141 X:110439057-110439079 CAGTGTTAGGGGAAGAGGGTAGG + Intronic
1196113217 X:111969550-111969572 CAGTGTTAGCTGAAGTTATTGGG + Intronic
1197825591 X:130587090-130587112 CAGTGTAAGAAGAAGAGATTAGG + Intergenic
1199696888 X:150348900-150348922 CAGCGTTGGAAGCAGGGGTTGGG - Intergenic
1200006406 X:153088103-153088125 CAGTCCTTGCAGAAGGGATTCGG - Intergenic
1201672812 Y:16543229-16543251 CAGTCATAGCAGAAGAGCTTGGG - Intergenic
1201781264 Y:17725178-17725200 TAGGGTTAGGAGAAGGGGTTAGG - Intergenic
1201820289 Y:18180812-18180834 TAGGGTTAGGAGAAGGGGTTAGG + Intergenic
1201855268 Y:18534432-18534454 GAGGGTTAGGATAAGGGGTTAGG + Intergenic
1201878054 Y:18785953-18785975 GAGGGTTAGGATAAGGGGTTAGG - Intronic