ID: 928393069

View in Genome Browser
Species Human (GRCh38)
Location 2:30924102-30924124
Sequence TCCCAGGTAAAGTAACTGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 152}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928393069_928393072 3 Left 928393069 2:30924102-30924124 CCAGCCAGTTACTTTACCTGGGA 0: 1
1: 0
2: 1
3: 13
4: 152
Right 928393072 2:30924128-30924150 TGCATCTTCGCCTTTGACCTTGG 0: 1
1: 0
2: 0
3: 4
4: 117
928393069_928393074 10 Left 928393069 2:30924102-30924124 CCAGCCAGTTACTTTACCTGGGA 0: 1
1: 0
2: 1
3: 13
4: 152
Right 928393074 2:30924135-30924157 TCGCCTTTGACCTTGGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 84
928393069_928393079 28 Left 928393069 2:30924102-30924124 CCAGCCAGTTACTTTACCTGGGA 0: 1
1: 0
2: 1
3: 13
4: 152
Right 928393079 2:30924153-30924175 CAGGGGCTCAACTTTAGGTTTGG 0: 1
1: 0
2: 0
3: 11
4: 83
928393069_928393073 9 Left 928393069 2:30924102-30924124 CCAGCCAGTTACTTTACCTGGGA 0: 1
1: 0
2: 1
3: 13
4: 152
Right 928393073 2:30924134-30924156 TTCGCCTTTGACCTTGGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 121
928393069_928393075 11 Left 928393069 2:30924102-30924124 CCAGCCAGTTACTTTACCTGGGA 0: 1
1: 0
2: 1
3: 13
4: 152
Right 928393075 2:30924136-30924158 CGCCTTTGACCTTGGCACAGGGG 0: 1
1: 0
2: 1
3: 1
4: 128
928393069_928393081 30 Left 928393069 2:30924102-30924124 CCAGCCAGTTACTTTACCTGGGA 0: 1
1: 0
2: 1
3: 13
4: 152
Right 928393081 2:30924155-30924177 GGGGCTCAACTTTAGGTTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 84
928393069_928393078 23 Left 928393069 2:30924102-30924124 CCAGCCAGTTACTTTACCTGGGA 0: 1
1: 0
2: 1
3: 13
4: 152
Right 928393078 2:30924148-30924170 TGGCACAGGGGCTCAACTTTAGG 0: 1
1: 0
2: 0
3: 14
4: 143
928393069_928393080 29 Left 928393069 2:30924102-30924124 CCAGCCAGTTACTTTACCTGGGA 0: 1
1: 0
2: 1
3: 13
4: 152
Right 928393080 2:30924154-30924176 AGGGGCTCAACTTTAGGTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928393069 Original CRISPR TCCCAGGTAAAGTAACTGGC TGG (reversed) Exonic
901046136 1:6396868-6396890 TCATAGGTAAAGAAACTGCCAGG - Intergenic
901613263 1:10516519-10516541 TCCCAGGTAAAGTTTCAGGCAGG - Intronic
902519001 1:17005272-17005294 TCCCATGGAAAGTCAGTGGCCGG + Intronic
903981945 1:27195103-27195125 TCCCAGGCAAAATAACTATCAGG - Intergenic
908668791 1:66522648-66522670 TCCCAGGTGACATAACTAGCAGG - Intergenic
910168706 1:84355116-84355138 TCCCATGTCAAGTAAATGTCGGG - Intronic
913213062 1:116597715-116597737 TCCTGGGTAAAGTAGCTGGAGGG - Intronic
917740605 1:177958590-177958612 TCACAGGTATATTATCTGGCTGG + Intronic
921191073 1:212709148-212709170 GCCCAGGTAGAGTCACTTGCTGG - Intergenic
1063040621 10:2333658-2333680 TCCCAAGTAAAGATACTGGAAGG + Intergenic
1066023233 10:31322529-31322551 TATCAGGTAATGTAACTGACAGG + Intronic
1066216004 10:33288255-33288277 TCCCAAGAATAGTAACTGGTAGG - Intronic
1067558537 10:47288735-47288757 TCACAGGAAAAGCAGCTGGCAGG - Intergenic
1067740779 10:48894794-48894816 TCCCAGGTCAAGGTACTGGTGGG - Intronic
1067741018 10:48896292-48896314 TCCCAGGTCAAGGTACTGGTGGG - Intronic
1068080932 10:52315835-52315857 TACACAGTAAAGTAACTGGCCGG + Intronic
1070446595 10:76510599-76510621 CCCCAGATAAATTGACTGGCTGG - Intronic
1071234257 10:83626138-83626160 TCCCAGGGATAGTAAGTGACAGG - Intergenic
1072319888 10:94238932-94238954 TCCCAGGCAATGTGACTGGAAGG - Intronic
1073641088 10:105253160-105253182 TCCCAGGAAGAGTCACTGGGAGG - Intronic
1076144300 10:128104945-128104967 TGCCAGGTAAATTTCCTGGCAGG + Exonic
1076144484 10:128106397-128106419 TGCCAGGTAAATTTCCTGGCTGG + Exonic
1076144701 10:128108221-128108243 TGCCAGGTAAAGTTCCTGCCAGG + Exonic
1076600714 10:131655266-131655288 CCCCAGGCAAAGTCTCTGGCTGG + Intergenic
1076692585 10:132231263-132231285 TCCCAGGTGGGGTAACAGGCTGG - Intronic
1079527516 11:21408284-21408306 TCCCAGGCAAGGTATCTGGTAGG - Intronic
1080232942 11:30038146-30038168 TCATAAGTAAAGTAACTGGATGG + Intergenic
1081065914 11:38538604-38538626 TACCAAGTACAGTAACTGACTGG - Intergenic
1083732736 11:64661502-64661524 TCCCAGTCTAAGGAACTGGCTGG - Intronic
1083789743 11:64976814-64976836 TCCCAGGTCAATTACCTGCCAGG + Intergenic
1085583608 11:77678868-77678890 TCCAAGGTCAAGATACTGGCAGG - Intronic
1085833139 11:79923943-79923965 ACACAGGTATAGTAATTGGCTGG - Intergenic
1087974324 11:104525629-104525651 TCCAAGGTCAAGTTGCTGGCAGG - Intergenic
1088717106 11:112558540-112558562 TCCCAGTCAAAGCAATTGGCTGG + Intergenic
1089833647 11:121350872-121350894 TCCCTGGTAAAGTATCTGCAAGG - Intergenic
1090125412 11:124078554-124078576 TCCCAGGTACAGTACCTTCCAGG + Intergenic
1093786805 12:23201240-23201262 TCCTAGGGTAAGTAACTGGCTGG + Intergenic
1095480793 12:42633475-42633497 GCCCAGGTAGAATAACTGGCTGG - Intergenic
1095489142 12:42714927-42714949 TCCAAGGTCAAGGCACTGGCAGG + Intergenic
1096548476 12:52356987-52357009 GCCCAGGTCAAGTCACTGCCTGG - Intergenic
1096919710 12:55071196-55071218 TCCAAGGTCAAGACACTGGCAGG + Intergenic
1102619008 12:114178806-114178828 TCACAGGTATAGCAGCTGGCGGG - Intergenic
1104518599 12:129451887-129451909 TCCCAGGTAAAACAACTTCCAGG - Intronic
1104880908 12:132069591-132069613 TCCCAGGCCCAGAAACTGGCCGG + Exonic
1109763375 13:66860722-66860744 TCACAGGTAAAGTACTTAGCAGG - Intronic
1110453868 13:75668237-75668259 GTCCAGGTAAATTAACTGCCTGG - Intronic
1112849506 13:103687352-103687374 TCCCAGGTTATTGAACTGGCTGG + Intergenic
1115373861 14:32651515-32651537 TCCAAGGTCAAGGCACTGGCAGG + Intronic
1115852259 14:37597969-37597991 CCTCAGGGAAAGTGACTGGCTGG - Intronic
1117466639 14:56000753-56000775 GCCAAGGTAAAGTACCTTGCCGG + Intergenic
1119023706 14:71136330-71136352 TCCCATGGAAGGTAATTGGCTGG + Intergenic
1120381671 14:83788741-83788763 TCCCATGTAAAATAGCTGTCTGG + Intergenic
1121456735 14:94043243-94043265 TCCCAGGCAAAGTGAGGGGCTGG + Intronic
1121621810 14:95355421-95355443 TTCCAGGTACAGTAAATGGTGGG - Intergenic
1122407746 14:101510250-101510272 TCCCATGGAAAGTAGCTGTCCGG - Intergenic
1122578102 14:102754653-102754675 TCCCAGGTGAAGTCACGGGAAGG + Intergenic
1125600279 15:40911867-40911889 TGCCAGGTCAAGGAACAGGCAGG - Intergenic
1127821998 15:62666467-62666489 TCCAAGGTCAAGGCACTGGCAGG - Intronic
1128910366 15:71508330-71508352 TGCCAGTTATAGTAACGGGCAGG + Intronic
1131095422 15:89651616-89651638 TCCCAGGGAAAGAAACTGGAAGG + Intronic
1133459560 16:5975606-5975628 TCACAGATAAAGTAACTTTCTGG - Intergenic
1133934336 16:10256602-10256624 TCCCAGAAAAAGTGAATGGCAGG - Intergenic
1134863247 16:17579750-17579772 TCCCAGCAAAACTAACTGCCTGG + Intergenic
1138549509 16:57739917-57739939 TCCCAGGGAAAGTGTCTGGCTGG - Intronic
1140519209 16:75567008-75567030 TCCCAGTTACAGTAGCTGACGGG + Intronic
1144819973 17:18065646-18065668 TACCAGACAAAGCAACTGGCGGG - Exonic
1146630359 17:34465166-34465188 TCCCAGGGAAAAAAACTGTCAGG - Intergenic
1148088220 17:45007123-45007145 TCTCCAGTAAAGTTACTGGCTGG + Intergenic
1152760991 17:82106980-82107002 TCTCAGGCAAAGTGAGTGGCAGG - Intronic
1152943082 17:83182655-83182677 CCCTGGCTAAAGTAACTGGCGGG + Intergenic
1153111539 18:1596115-1596137 TCCCAGATAAATTAATTAGCAGG - Intergenic
1155386981 18:25288752-25288774 TCCTAGGTACAATAACTGTCAGG + Intronic
1157692013 18:49691525-49691547 ACCCATGCACAGTAACTGGCAGG + Intergenic
1157795942 18:50575279-50575301 TCCAAGATCAAGGAACTGGCAGG - Intronic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1158765610 18:60447071-60447093 TCCCACTTAAAGAAACAGGCTGG + Intergenic
1159768531 18:72520524-72520546 TCTCAGGAAAAGCAACTGGCAGG + Intergenic
1160604266 18:80037551-80037573 GGCCAGGTAAAGTAAGTGCCAGG - Intronic
1164334618 19:24301560-24301582 TCCCAGGTTAAATAACTGGAAGG + Intergenic
1165175504 19:33926552-33926574 TCCCAGGGAAATTAAGTGTCTGG + Intergenic
1168246302 19:55114489-55114511 CCCCAGGTGGAGAAACTGGCCGG + Intronic
925198984 2:1950994-1951016 TGCCAGCTCAGGTAACTGGCAGG + Intronic
925509028 2:4603735-4603757 TCACAGTTAAAGAATCTGGCAGG - Intergenic
927729274 2:25456304-25456326 TCCCAGGTGAAATAATTGCCTGG - Intronic
928392399 2:30919636-30919658 CCGCAGGTAAAGTAACTGGCTGG - Intronic
928393069 2:30924102-30924124 TCCCAGGTAAAGTAACTGGCTGG - Exonic
929616726 2:43315761-43315783 TCCAAAATAATGTAACTGGCTGG - Intronic
929688268 2:44053336-44053358 TCCCAGGTAAAGTCACCTGATGG + Intergenic
929812307 2:45200956-45200978 CCCCAGGTAAAGTGCCTGGATGG - Intergenic
931072005 2:58662464-58662486 TGCCAGGTGCAGTAGCTGGCTGG + Intergenic
934298022 2:91758395-91758417 TCCTGGGTAAAGTAGCTGGAGGG + Intergenic
936409335 2:112241228-112241250 TCCTAGGGAAAGTACCTGGGTGG - Intronic
936854580 2:116941573-116941595 TCCCTGGAAAAGTAACTCGCAGG + Intergenic
936854617 2:116941952-116941974 TCCCTGGAAAAGTAACTCACAGG + Intergenic
942870989 2:180733630-180733652 TCCAAGATCAAGTCACTGGCAGG - Intergenic
943179113 2:184520532-184520554 GCCAATGAAAAGTAACTGGCAGG - Intergenic
948273778 2:236693113-236693135 TCCCAGGGAAAGTGAGTGGCAGG - Intergenic
1171105646 20:22430162-22430184 TCCCAGCTAAAGGCACTGGGAGG + Intergenic
1174545920 20:51324982-51325004 TCCCAGGTCCAGAGACTGGCCGG - Intergenic
1174688742 20:52481607-52481629 TCCCAGGCAGAGTGGCTGGCTGG - Intergenic
1175122055 20:56723395-56723417 ACACAGGTAAAGAAACAGGCAGG - Intergenic
1177952925 21:27561059-27561081 TCCCAGGTTAATTAATTTGCTGG - Intergenic
1178925128 21:36768392-36768414 TCCCAGCTACAGAAACTGGGTGG + Intronic
1179177122 21:39016363-39016385 TCCCAGGTAAAATTACTGAGGGG + Intergenic
1179187832 21:39098198-39098220 TCCCAGGCAAAGTGACCTGCTGG - Intergenic
1179790125 21:43751616-43751638 TCCAAGGTCAAGGCACTGGCAGG + Intronic
1181097720 22:20517334-20517356 GCACAGGTCAAGGAACTGGCAGG - Intronic
1183806847 22:40219139-40219161 TCCCAGGGAGAGGAACTGGTAGG - Intronic
1184343084 22:43896685-43896707 TCCCAGGTACAGCACCTGCCTGG + Intergenic
951823639 3:26842729-26842751 TCCAAGGTAAAATAGATGGCAGG + Intergenic
952103894 3:30047460-30047482 TCCCAGGTATAATAACAGGCTGG - Intergenic
952256654 3:31701549-31701571 TCCCAACTGGAGTAACTGGCTGG + Intronic
953075290 3:39564454-39564476 TCCCAGGTACTTTATCTGGCAGG + Intergenic
963152861 3:142065070-142065092 TTTCAGGTAAAGCAACTCGCTGG + Intronic
966334151 3:178849803-178849825 TCAGAGGTAGAGTAACTTGCTGG - Intergenic
970278284 4:14425961-14425983 TCCCAGGTAGCCTAACTGGGAGG - Intergenic
974365160 4:60937938-60937960 TTCCAGTTAAAATCACTGGCTGG + Intergenic
975700565 4:77062179-77062201 TATCAGGAAAAGTATCTGGCGGG - Intronic
975861854 4:78685979-78686001 TTCCAGGTAAAGTCTCTGCCTGG + Intergenic
976923089 4:90461802-90461824 AGCCAAGTAAAGTAACTGGCAGG - Intronic
976951147 4:90833133-90833155 TCCAAGATCAAGGAACTGGCAGG + Intronic
977728475 4:100324564-100324586 TCCCAGTTAAACCAATTGGCAGG + Intergenic
981760819 4:148192792-148192814 TCCCAGGCAAACTAAAGGGCTGG + Intronic
984852312 4:184164782-184164804 TTCCAGGTAAAGTAACTGAGGGG + Intronic
996604399 5:125304181-125304203 TACCAGCTAATGTAACTGGTAGG - Intergenic
999134942 5:149312266-149312288 CCCCAGGGGAACTAACTGGCTGG + Intronic
1000593149 5:163182821-163182843 TCCCAGGGAAAGTATTTGGTTGG - Intergenic
1000683801 5:164221463-164221485 ACCAAGACAAAGTAACTGGCTGG - Intergenic
1001724322 5:173884325-173884347 TGCCAGGCAAAGTAACTGCTGGG + Intergenic
1001994364 5:176143745-176143767 TCCCAGGTAAACTAACAGGAAGG + Intergenic
1002471112 5:179436750-179436772 TCCGAGGTGAAGGAAGTGGCAGG + Intergenic
1006946476 6:37787837-37787859 TCCCATGTTTAGTAGCTGGCTGG - Intergenic
1007360730 6:41353407-41353429 TGCCTGGTCAGGTAACTGGCAGG - Intergenic
1015430883 6:133129372-133129394 TCCCAGGTAAACTGAATAGCTGG + Intergenic
1017250832 6:152277999-152278021 TGCCAGGTAAAGGAACAGGTTGG - Intronic
1018793775 6:167170694-167170716 TCCCAGCAGAAGTGACTGGCGGG + Exonic
1018822560 6:167384387-167384409 TCCCAGCAGAAGTGACTGGCGGG - Exonic
1019168015 6:170111931-170111953 TTCCAGGGAAAGTAACTTCCAGG + Intergenic
1022033918 7:26516548-26516570 TCCCAGGAACATCAACTGGCTGG - Intergenic
1024273948 7:47662412-47662434 TCCCAAGAAAATTAAATGGCTGG + Intergenic
1025549094 7:62219885-62219907 TCCCAGGAAAAAAAACTGGAAGG - Intergenic
1028293318 7:89095315-89095337 TCTAAGGTCAAGTCACTGGCAGG - Intronic
1036433453 8:8710910-8710932 TCCCAGGAAGAGGAAATGGCAGG + Intergenic
1037919733 8:22797379-22797401 TCCCAGGTAAAGTGAAGAGCTGG - Intronic
1038192248 8:25333787-25333809 GCCCAGGTAACCTAACGGGCAGG - Intronic
1038867812 8:31458813-31458835 TCCCAAGAAAAGAAAATGGCTGG + Intergenic
1044896275 8:96895466-96895488 TACCAGGTTAAGTAAATTGCAGG - Intronic
1045034607 8:98167532-98167554 TCCAAGGCAAAGCAAGTGGCAGG + Intergenic
1045968182 8:108050248-108050270 TCCCAGTGAAAGTAAGTTGCTGG + Intronic
1047524099 8:125617772-125617794 TCCTAGGCAAAGTGGCTGGCAGG + Intergenic
1047720781 8:127637261-127637283 TCCCAGGTATATTTCCTGGCTGG - Intergenic
1049917412 9:331694-331716 CTTCAGGTAAAGTGACTGGCTGG - Intronic
1051171309 9:14320917-14320939 CCCCAAGTACAGTAGCTGGCAGG - Intronic
1058223775 9:102335434-102335456 TCCCAAGTGTAGTAACTGCCAGG + Intergenic
1059254233 9:112914096-112914118 TCTCAGGTAAAGTCACTGCAGGG - Intergenic
1060363160 9:122980567-122980589 TCAGATGTAAAGAAACTGGCTGG - Intronic
1061433866 9:130548256-130548278 TCCCAGGTAATGTCACTCACTGG - Intergenic
1188099925 X:26071281-26071303 TCCCACTTAAAGGAACTGTCTGG + Intergenic
1188381461 X:29498337-29498359 TAACAGGCAAAGTAAATGGCAGG - Intronic
1188936726 X:36185136-36185158 TCCAAGATAAAGGCACTGGCAGG + Intergenic
1191204915 X:57823422-57823444 TCCTAGGTGAAGTAACTGAAAGG + Intergenic
1191675516 X:63788307-63788329 TCACAGATAAAGAAACTGTCAGG - Intergenic
1191975571 X:66867427-66867449 TTCCAGGAGAAGTAACTGGTTGG + Intergenic
1202169386 Y:22025027-22025049 CCCAAGGTAAAGGCACTGGCAGG - Intergenic
1202221979 Y:22561338-22561360 CCCAAGGTAAAGGCACTGGCAGG + Intergenic
1202321139 Y:23634329-23634351 CCCAAGGTAAAGGCACTGGCAGG - Intergenic
1202549628 Y:26035727-26035749 CCCAAGGTAAAGGCACTGGCAGG + Intergenic