ID: 928394734

View in Genome Browser
Species Human (GRCh38)
Location 2:30934745-30934767
Sequence GCTCAGAGGCAGAGCGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928394734_928394741 30 Left 928394734 2:30934745-30934767 CCCTCAACGCTCTGCCTCTGAGC 0: 1
1: 0
2: 0
3: 10
4: 139
Right 928394741 2:30934798-30934820 CCAGAGTTCACTCTATGCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928394734 Original CRISPR GCTCAGAGGCAGAGCGTTGA GGG (reversed) Intronic
903558534 1:24210819-24210841 CTTCAGAGGCAGAGCGCCGATGG + Intergenic
904409873 1:30319047-30319069 ACTCAGGGGCAGGGCGTTAATGG - Intergenic
905467897 1:38169388-38169410 GTTCAGAGGCAGTGCGGTGATGG - Intergenic
907237359 1:53061797-53061819 GCTCAGAGGCACTGGGTCGAAGG + Intergenic
907365354 1:53954284-53954306 GCCCAGAGACAGAGCTTTCAAGG - Intronic
909609242 1:77535648-77535670 GCTCTGAGGCAGTGTGTAGAAGG + Intronic
909679848 1:78279399-78279421 GGTCAGAGGCAGGAAGTTGATGG - Intergenic
911064588 1:93776896-93776918 GATCACAGGCACAGCGTTGGTGG - Intronic
911857382 1:102896879-102896901 GCCCAGAGTCAGAGCCTGGAAGG - Intronic
914247015 1:145893721-145893743 GCTGAGAGGCATAATGTTGAGGG + Intronic
914450455 1:147786952-147786974 GCTCAAAGGCAGAGCATGGCAGG + Intergenic
915972331 1:160363389-160363411 CCTGAGAGGTAGATCGTTGAGGG - Intergenic
923446731 1:234078122-234078144 GCACAGGGGCAGAGAGATGAAGG - Intronic
1065862182 10:29881270-29881292 CCTCAGAGCCAGAACTTTGAGGG - Intergenic
1066071714 10:31822335-31822357 GCTCAGAGACTGAGCCTTGTTGG + Intronic
1067221360 10:44346525-44346547 GCTCAGAGACAAGGCGGTGAGGG + Intergenic
1067471351 10:46541001-46541023 GCTCAGAGGCACAGCTTAGGGGG + Intergenic
1067533683 10:47092730-47092752 GCACAGAGGCTGAGGGTTGCAGG - Intergenic
1070756583 10:78997160-78997182 GCTCAGAGCCAAAGAGTTCAGGG - Intergenic
1070804288 10:79261630-79261652 GCTCCAAGGCAGAGGGCTGAGGG + Intronic
1070993490 10:80754001-80754023 GCTCAGAGGCATGTCGGTGAAGG + Intergenic
1071289500 10:84177890-84177912 GCTCAGAGGCAGGAAGTTGAGGG + Intronic
1072392295 10:94999760-94999782 TCTCAGAGACAGAGCCTAGAAGG - Intergenic
1075806466 10:125192666-125192688 TCTCAGAGACAGACAGTTGAAGG - Intergenic
1077326006 11:1964408-1964430 GCTGAGAGGGAGTGAGTTGAAGG - Intronic
1078841556 11:15080318-15080340 GATCAGAGGCTGAGGGTGGAAGG - Intronic
1079408486 11:20165281-20165303 GCTCAGAGGCTGGGAGTTGCTGG - Intergenic
1080284820 11:30597923-30597945 GCTCAGAGGCAGGGGCTTGAAGG - Intergenic
1081376319 11:42362860-42362882 TATCAGAGGCAGAGGGATGATGG - Intergenic
1081698099 11:45132653-45132675 GCTCAGAGGCAGATTGTGAAAGG - Intronic
1084955515 11:72689271-72689293 GCTCGGAGGCAGAGGGATGGGGG + Intronic
1085305303 11:75482398-75482420 GATCAGAGGCAGAGCCTGGGTGG - Intronic
1089293989 11:117457263-117457285 GCTCTGGGGCAGAGGGCTGAAGG + Intronic
1089733598 11:120534818-120534840 GAGCAGAGGCAGAGGTTTGAGGG + Intronic
1090398059 11:126432194-126432216 GCTCAGAGGGGCAGCCTTGAGGG - Intronic
1202808986 11_KI270721v1_random:19587-19609 GCTGAGAGGGAGTGAGTTGAAGG - Intergenic
1094328456 12:29266500-29266522 GCTGAGAGGGATAGTGTTGAAGG + Intronic
1096560048 12:52429678-52429700 GGGCAGAGGCAGCGCCTTGACGG - Intronic
1101933690 12:109037789-109037811 GCTGACAGGCTGAGTGTTGAAGG - Intronic
1104360721 12:128130202-128130224 GCACAGAGGCAGAGCATTTAAGG + Intergenic
1104871850 12:132005060-132005082 GCTCAGCTGCAGAGGGTTGCGGG - Exonic
1106031328 13:26007790-26007812 GCTCAGAGGCAGAGGTTTCATGG + Intronic
1106903868 13:34384412-34384434 GCTCATAGACAAAGAGTTGAAGG - Intergenic
1108462664 13:50682698-50682720 TCTCAGAGGCTCAACGTTGAGGG - Intronic
1112520565 13:100091086-100091108 GCTCTGATGCAGAGAGTAGATGG + Intronic
1114672023 14:24416528-24416550 TCTCATAGGCAGCGAGTTGAAGG + Exonic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1122848193 14:104512293-104512315 GCTCAGAGGCTGGAAGTTGAGGG + Intronic
1124552718 15:30696415-30696437 ACTCAGAAGCAGAGAGCTGAGGG - Intronic
1124678524 15:31709255-31709277 ACTCAGAAGCAGAGAGCTGAGGG + Intronic
1126392541 15:48175271-48175293 ACTCAGAAGCAGAGAGTAGAAGG + Intronic
1126765240 15:52004910-52004932 GCTCTGAGGCTGAGCGTGGAAGG + Intronic
1127332844 15:57955624-57955646 GCTCAGAGGCTGAGTGCTGTGGG + Intronic
1128949778 15:71865641-71865663 GCTCAGAGGAAGAGAGAAGAGGG + Intronic
1132147867 15:99439001-99439023 GCTCAGAGTGAGGGCTTTGAAGG + Intergenic
1133555581 16:6903749-6903771 GGTGAGAGGCAGAGGGCTGAGGG + Intronic
1133976173 16:10601249-10601271 GCCCAGAGGCTGGGCGTTGGAGG + Intergenic
1136621030 16:31428308-31428330 CCTCAGAGGCAAAGCCATGATGG + Exonic
1139374712 16:66489734-66489756 GCACAGAGGCAGAGGCTGGAGGG + Intronic
1140948829 16:79796548-79796570 GGTCAGAGGCTGAGCGTGAACGG + Intergenic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1142484880 17:240483-240505 GCACAGAGGCAGACAGTAGATGG - Intronic
1142909569 17:3076490-3076512 GCTCAGAGTTAGAGAGTAGAAGG - Intergenic
1144433113 17:15213343-15213365 CCTCAGGGGCAGAGCGTTTTAGG - Intergenic
1144711406 17:17403948-17403970 GCGCACAGGCAGAGCGGTGGTGG - Intergenic
1145009124 17:19357422-19357444 GCTCAGATGAAGAAAGTTGAGGG + Intronic
1150292341 17:63988904-63988926 GCTCAGAGGCAGGGCTGTGGGGG - Intergenic
1153545979 18:6205185-6205207 TGTCAGAGGCAGAGGTTTGAAGG + Intronic
1153905096 18:9654129-9654151 GCTCGGAAGCAGATCTTTGAGGG + Intergenic
1157021208 18:43784407-43784429 GCACAGAGGCAGAGGGTGGTGGG + Intergenic
1157319559 18:46623840-46623862 GCAGAGAGGCAGAGCCATGAGGG + Intronic
1158921731 18:62199651-62199673 CCTCAGAAACAGAGCTTTGATGG - Intronic
1161335254 19:3709467-3709489 GCTCAGAGCCAGAGAGGGGAGGG + Intronic
1165074029 19:33270751-33270773 GCTCAGAGGCTGAGAGTGGCAGG - Intergenic
1165378269 19:35459335-35459357 GCTGAGAGGCAGGACGTTTAAGG - Intergenic
1166329093 19:42068567-42068589 GCTCAGAGGCAGAGAGAGGGAGG + Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166520702 19:43478367-43478389 TCTCAGAGGCCGAGCATTCAGGG - Intronic
1168706374 19:58472592-58472614 GAACAGAGGCAGTGGGTTGAGGG - Exonic
925518296 2:4709572-4709594 ACTCAGAAGCAGAGAGTAGAGGG + Intergenic
928394734 2:30934745-30934767 GCTCAGAGGCAGAGCGTTGAGGG - Intronic
930002508 2:46870609-46870631 ACTCAGAGGCAGAGGGGTGGGGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932035110 2:68237032-68237054 GCTCAGAGCCAGAGAGTTACAGG - Intronic
933180948 2:79226948-79226970 GCTCAGATGGAGAGCTCTGAGGG + Intronic
935724809 2:106014233-106014255 GCACAGAAGCAGAGAGTAGAAGG - Intergenic
937912001 2:127080304-127080326 GCTCACAGGCAGACCACTGAGGG + Intronic
941318827 2:164029616-164029638 GCTCAGAGGCATAGCATTACAGG + Intergenic
941588198 2:167385618-167385640 GCTGAGGGGCAGAGGGTTTATGG + Intergenic
947161751 2:227222231-227222253 GCTCAGGGGCAGGGGGCTGAAGG - Intronic
947741183 2:232485703-232485725 GCACAGAGGCAGAGCGCGGGAGG - Intronic
948682857 2:239648273-239648295 GCTCAGAGGCAGGGCGTGTGGGG - Intergenic
948716041 2:239864510-239864532 GCTCAGAGGAAGAGGCCTGAAGG + Intergenic
1170044633 20:12072253-12072275 GGTCAGAGGCAGAGGCTGGAGGG + Intergenic
1171239360 20:23552364-23552386 GCTCAGAGGGAGGGCGTGCAGGG + Intergenic
1172791462 20:37508750-37508772 GCTCAGAGCCAGAGCCAAGAAGG - Intronic
1174614276 20:51823967-51823989 TCTCAGAGGTAGAGCCTCGAGGG - Intergenic
1175442872 20:59003240-59003262 GCCCAGAGGCAGAGCTCGGATGG + Intronic
1180670396 22:17548530-17548552 CCCCAGAGGCAGAACGTTGCAGG + Exonic
1182222900 22:28772869-28772891 GCTCAGAGGGAGGCCGCTGAAGG - Exonic
1182475275 22:30573724-30573746 GCCCAGAGCCAGAGAGGTGATGG - Intronic
1182677489 22:32051005-32051027 GCTCAGGGGCTGAGCTTCGAAGG + Intronic
1183359974 22:37378458-37378480 GCGAAGAGGCTGAGCGTGGAGGG + Intronic
1184445425 22:44544340-44544362 GCTGAGAAGCAGAGCCTGGAGGG + Intergenic
1185100745 22:48839648-48839670 GCTCAGAGCCAGAGCTGTGAGGG + Intronic
1185210623 22:49568696-49568718 GGGCAGAGGCACAGGGTTGAGGG - Intronic
1185222902 22:49637882-49637904 GCCAAGAAGCAGAGCGTGGATGG + Intronic
949202488 3:1395506-1395528 GGTCAGAGGCAGAGATGTGAAGG - Intronic
951173481 3:19571654-19571676 GTTCAGAGCCAGAGTTTTGATGG + Intergenic
952971468 3:38653443-38653465 GCTCAAAAGCAGGGTGTTGAGGG - Intergenic
955292335 3:57703735-57703757 GTTCAGAGGCAGACTGTTGCTGG - Intergenic
962474189 3:135741244-135741266 GTTCAGAGCCAGGGCATTGAGGG - Intergenic
964473017 3:157074149-157074171 AATCAGAGTCAGAGGGTTGATGG - Intergenic
966680477 3:182637179-182637201 GCTCAGAGGCAGAAAAATGAAGG + Intergenic
966932204 3:184683051-184683073 GCACAGGGTCAGAGCATTGAGGG - Intronic
970099346 4:12503055-12503077 CTTCAGAGGCAGAGCCTTCATGG - Intergenic
982213967 4:153064621-153064643 GCTCAGAGGGAGAGGGTCGTGGG - Intergenic
984855871 4:184195621-184195643 TCACAGAGACAGAGCGTAGAAGG - Intronic
987033143 5:13994145-13994167 GCTGAGAGGCAGAGAGGTGGAGG - Intergenic
994745111 5:103668402-103668424 ACGCAGATGCAGAGGGTTGAAGG - Intergenic
997511230 5:134455956-134455978 GCTCTGAGGGAGAGCAGTGAGGG - Intergenic
997692665 5:135837245-135837267 GGGCAGAGGCAGAGAGGTGATGG - Intronic
1002107055 5:176884842-176884864 GCTCAGAGGAGGAGCATGGAGGG + Intronic
1004234836 6:13865348-13865370 GCTCAGAGGCACAGCGGCCACGG + Intergenic
1005303987 6:24496090-24496112 CTTCAGAGGGAGAGCTTTGAAGG - Intronic
1006764611 6:36493753-36493775 ACTTAGAGGCAGAGTGCTGATGG - Intergenic
1008070683 6:47096092-47096114 GCTCAGAGGCAGTGCTTGGCAGG - Intergenic
1010752807 6:79633520-79633542 GCTACGAGGCAGGGCATTGAGGG - Intronic
1011187624 6:84696507-84696529 GCTCAGAGGAAGAGGGTTATAGG - Intronic
1019336258 7:484440-484462 GCTCAGGGCCAGAGCCTTGGGGG + Intergenic
1021387586 7:20050798-20050820 GCTGAGAGGCAGACTGTAGAAGG - Intergenic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1034502871 7:151462310-151462332 GCTCAGGGGCAGAGGTTTGGAGG - Intergenic
1036137981 8:6179792-6179814 GCTCAGAAGCAGATCCTTGAGGG - Intergenic
1036380963 8:8236256-8236278 GCTGGAAGGCAGAGCGCTGATGG - Intergenic
1045189197 8:99866426-99866448 GCTCAGCAGCAGACCTTTGAGGG - Intronic
1047885794 8:129248931-129248953 GCTCAGAGGCTGAGGCTTGAAGG - Intergenic
1048210941 8:132453621-132453643 GCTCACAGGAAGAGAGTTGGAGG - Intronic
1048438689 8:134443054-134443076 CTTCAGAGACAGAGCATTGATGG - Intergenic
1048948561 8:139473703-139473725 GCTCAAAGGCAGCTCGGTGAAGG + Intergenic
1051182351 9:14424692-14424714 ACTCAGAGGCAGAGCTCCGAGGG + Intergenic
1061240112 9:129365116-129365138 CCTATGAGGCAGAGCGGTGAAGG + Intergenic
1062011856 9:134271570-134271592 GCCCAGAGGCAGAGGTTTGCGGG + Intergenic
1062263924 9:135678182-135678204 GCTCAGAGGCACAGTTTTGAGGG + Intergenic
1062589211 9:137265909-137265931 GCTCAGTGCCAGCGTGTTGATGG - Exonic
1189700354 X:43712233-43712255 GCTCAGTAGCATAGAGTTGAAGG - Intronic
1195545922 X:106112561-106112583 GGTAAGAGACAGAGCTTTGAGGG + Intergenic
1198891569 X:141402972-141402994 GCACAGGGGCAGAGCATTGGTGG + Intergenic
1198891588 X:141403083-141403105 GCACAGGGGCAGGGCGCTGATGG + Intergenic
1200979109 Y:9245443-9245465 TCTCAGAGGCAGTGCTTTGTTGG - Intergenic