ID: 928395250

View in Genome Browser
Species Human (GRCh38)
Location 2:30938760-30938782
Sequence GTGACCTACTCAATAGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928395250 Original CRISPR GTGACCTACTCAATAGCACA TGG (reversed) Intronic
902133681 1:14285641-14285663 GTGACCCACTCAGTTGCACAGGG + Intergenic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
908358509 1:63345236-63345258 GTGACTTGCTCAAAGGCACATGG - Intergenic
912708706 1:111934113-111934135 GTGACCTACCCAGAACCACACGG - Intronic
916208393 1:162337398-162337420 GTGACTTATTCTTTAGCACATGG - Intronic
917186967 1:172368171-172368193 GTGCTCTTCTCATTAGCACATGG + Intronic
919519882 1:198574775-198574797 GTGACCTACATAATATCAGAGGG + Intergenic
919604751 1:199668435-199668457 GTGACTTAGTAAATGGCACATGG - Intergenic
921690385 1:218141782-218141804 AGGACCTATACAATAGCACAAGG + Intergenic
1063644831 10:7868600-7868622 GTAACCCACCCAATAGAACATGG - Intronic
1065071915 10:22033516-22033538 GTGACCTATGCAATTACACAGGG + Intergenic
1066217819 10:33305061-33305083 ATAAACTACTCCATAGCACATGG + Intronic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067565032 10:47330331-47330353 GTGATCTTCTCAATGTCACATGG + Intergenic
1068299413 10:55119236-55119258 GTGACCTATGCAATCTCACATGG - Intronic
1068767214 10:60777123-60777145 GTGATATACTCTATATCACAAGG + Intergenic
1069274422 10:66571486-66571508 GTGGCTTACTCAAAGGCACATGG + Intronic
1071111124 10:82157992-82158014 GTGACCTAGACAATTTCACAGGG - Intronic
1075410963 10:122227744-122227766 CTGACCAAGTCAATATCACAAGG - Intronic
1078517220 11:12032885-12032907 TTGCCCTACTGAACAGCACAGGG + Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1079697852 11:23506072-23506094 CTGTCCTACACAATAGGACATGG + Intergenic
1085668772 11:78441283-78441305 GTAACTTAACCAATAGCACAAGG + Intronic
1086310298 11:85528696-85528718 GTGACCCATGCAATTGCACAGGG + Intronic
1088458498 11:110058388-110058410 CTCACATACTCAGTAGCACAGGG - Intergenic
1089735311 11:120546710-120546732 GTGACATACTAAATAACTCAAGG - Intronic
1092225636 12:6746516-6746538 GTGACCTGCCCAAGACCACAAGG + Intergenic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102811200 12:115825378-115825400 TTGCCCTAGCCAATAGCACATGG - Intergenic
1103150738 12:118636464-118636486 GTAATCTGCTCAATAGTACACGG + Intergenic
1104166128 12:126231319-126231341 GTGACTTACTCATTACTACAGGG - Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1106262499 13:28079719-28079741 GAGACTTATTCACTAGCACAAGG + Intronic
1110509558 13:76333310-76333332 TATACCTACTCCATAGCACATGG - Intergenic
1111978390 13:94991695-94991717 TAGACATATTCAATAGCACATGG - Intergenic
1112985885 13:105449102-105449124 ATGACTTGCTTAATAGCACAAGG - Intergenic
1113067181 13:106384473-106384495 GTGACCTACTCAGTGACCCACGG - Intergenic
1118988521 14:70777487-70777509 CTGACATACTCAAAAGCAGAGGG + Intronic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1122237949 14:100343270-100343292 CTGACCTGGTCAATGGCACATGG + Exonic
1123687949 15:22813039-22813061 CTGACGCAGTCAATAGCACATGG + Intronic
1127561233 15:60138375-60138397 CTGACCTACTGAATAGCATCCGG + Intergenic
1129276294 15:74447871-74447893 GTGACATACTCAAAACTACAAGG - Intronic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137843399 16:51662769-51662791 GTTATCTACTCATTAGCACAGGG + Intergenic
1139327907 16:66166322-66166344 GTGACCTGCTCCAAAGCTCATGG + Intergenic
1140536426 16:75714102-75714124 GTCACCCACACAGTAGCACAAGG - Intronic
1142782965 17:2195786-2195808 ATGACCTGCCCAATAACACAAGG + Intronic
1143671703 17:8400767-8400789 GTAACCTACCCAAAGGCACATGG - Intergenic
1145803448 17:27707435-27707457 GTGAAATACTCAAGAGCACAAGG - Intergenic
1146667246 17:34713307-34713329 GTGACATGCTCAAGAGCACATGG - Intergenic
1152265666 17:79293225-79293247 GTGACCTGCTCAAGCCCACATGG + Intronic
1154045070 18:10896665-10896687 GTTGTCTACTCAGTAGCACAGGG - Intronic
1156458734 18:37309284-37309306 GTGACTTCCTCAACAACACATGG - Intronic
1157443152 18:47725363-47725385 ATGACCTTCTCAGTAGAACAGGG + Intergenic
1158021535 18:52847840-52847862 GTGACCTACTCAAAGTTACAAGG - Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
1167761433 19:51452329-51452351 GTGACCTACTGCATAGCATGGGG + Exonic
928395250 2:30938760-30938782 GTGACCTACTCAATAGCACATGG - Intronic
929872904 2:45773546-45773568 GTGGCCTAATCATTAGCACAAGG - Intronic
930030680 2:47056460-47056482 GTACCCTGCTCATTAGCACAGGG + Intronic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
931975527 2:67639926-67639948 GTGACCTAGGCAGAAGCACAGGG - Intergenic
938212865 2:129483229-129483251 GTGATTTACTCAAAAGCACTTGG - Intergenic
941157349 2:161995668-161995690 GTGTCCTATGCATTAGCACAGGG + Intronic
942401578 2:175609007-175609029 GTGACCTACCCAATTAAACATGG - Intergenic
945973286 2:216251281-216251303 GAGCCCTACTCAATAGTAAAGGG + Intergenic
946564804 2:220952518-220952540 GTAACCTACTCAGTTGGACAAGG - Intergenic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
1174089547 20:48036161-48036183 GTGACCTACTCAAGGCCCCAGGG + Intergenic
1177577086 21:22972030-22972052 GTGACATATTCAATAACTCATGG + Intergenic
1181330322 22:22086088-22086110 GTGACCTTCTCATTAACTCAGGG - Intergenic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1184040711 22:41941585-41941607 GTGACCTATTCAAAGTCACACGG + Intronic
1184271494 22:43387073-43387095 GTGACCTGCCCAAGGGCACAAGG + Intergenic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
951358744 3:21700595-21700617 GTGAGTTACTGAATATCACAAGG - Intronic
952518517 3:34130363-34130385 ATGACCTCCTCACTACCACATGG - Intergenic
952523671 3:34187160-34187182 GTGGCCTACTTAATGTCACATGG + Intergenic
954364320 3:50138228-50138250 GTGAGCTCCTCAATGGCCCAAGG + Intergenic
956221434 3:66908028-66908050 CTCACCCACTCAATGGCACATGG + Intergenic
958827436 3:99048709-99048731 GTGACTTAGTCAAGAGCACATGG + Intergenic
962866591 3:139452466-139452488 GTGACCCCCTCCACAGCACAGGG + Intergenic
963151897 3:142053302-142053324 GTGAACTACTCATTACCATAGGG - Intronic
963757375 3:149249671-149249693 GTGACATATTCAATTGCAAAGGG - Intergenic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966137452 3:176715237-176715259 GTGACCTGAGCAGTAGCACACGG - Intergenic
969956942 4:10900384-10900406 GTGACTTTCTCAATAGAGCATGG - Intergenic
975224085 4:71849319-71849341 ATGAGCTAATCAATAGCATATGG - Intergenic
979758702 4:124373750-124373772 GTGGCCTTGTCAGTAGCACAGGG + Intergenic
982166147 4:152615248-152615270 GTGACCTACAAAATAACACTTGG + Intergenic
987258923 5:16184025-16184047 GTGACTTACTGTCTAGCACAAGG - Intergenic
988098367 5:26646241-26646263 GAGACCTATTCACTACCACAAGG - Intergenic
989409104 5:41096915-41096937 GTGACCTACTGTATAGCAGATGG + Intergenic
997440385 5:133905034-133905056 GTGACCTACTTTATACCTCATGG - Intergenic
998779007 5:145635478-145635500 GTGATCTATTCAATATTACATGG + Intronic
999165267 5:149544286-149544308 ATGACCCAGTCAATATCACATGG + Intronic
1002069293 5:176669909-176669931 GTGGCCTGCTGAATATCACATGG + Intergenic
1002404165 5:179016268-179016290 ATGACCTCCTTATTAGCACAAGG - Intergenic
1003978707 6:11369045-11369067 GTAATTTGCTCAATAGCACATGG + Intronic
1005633111 6:27727648-27727670 GCGACCTACGCATTTGCACAAGG - Intergenic
1007223619 6:40297560-40297582 GAGACCTATTCACTATCACAAGG - Intergenic
1007729308 6:43936192-43936214 GTGTCCCACTCATTAGAACAGGG + Intergenic
1008838474 6:55867604-55867626 GTGACCTGCGCAGTTGCACAGGG + Intronic
1009057563 6:58355363-58355385 GTGACCTACACAGTTGCACAGGG - Intergenic
1009233251 6:61091716-61091738 GTGACCTACACAGATGCACAGGG + Intergenic
1013760055 6:113507743-113507765 GTGATCTATGCAATTGCACAGGG + Intergenic
1017257805 6:152353576-152353598 GTGACCCACTCACCAGCACTTGG + Exonic
1021340925 7:19461747-19461769 GAGACCTACTATATAGCACAGGG - Intergenic
1022779482 7:33564414-33564436 GTTACTTACTCAAAATCACATGG - Intronic
1025557338 7:62325070-62325092 GTGACCTGCTCAATTGCAGCGGG - Intergenic
1029214196 7:98933783-98933805 GTGATGTTCTCAACAGCACATGG - Intronic
1031104009 7:117516861-117516883 GTAACCTACCCAAAATCACATGG - Intronic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1032524967 7:132573137-132573159 TGAACCTACTCAATAGCCCAGGG + Intronic
1037254317 8:16935008-16935030 GAGACTTATTCAATACCACAAGG - Intergenic
1037304263 8:17488839-17488861 GTGACTTACTCATTTGCAAAAGG - Intergenic
1037723393 8:21463869-21463891 GAGACTTACTCACTATCACAAGG + Intergenic
1039581213 8:38668206-38668228 CTGACCTCCTCAATGGCTCATGG + Intergenic
1041530473 8:58860140-58860162 GTTGCCTCCACAATAGCACACGG - Intronic
1042923327 8:73941109-73941131 GAGACTTACTCACTATCACAAGG - Intronic
1051017116 9:12491782-12491804 GAGACTTACTCACTACCACAAGG - Intergenic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1054869521 9:70036380-70036402 GTGACTTGCTCAAAAGTACAGGG - Intergenic
1057691781 9:97292340-97292362 GTGACCTTCCCAAGACCACATGG - Intergenic
1058082091 9:100711614-100711636 GTGACCCATTCACTATCACAAGG + Intergenic
1058381561 9:104382841-104382863 GTGTCCGATTCAATAGCACAGGG + Intergenic
1060789360 9:126475609-126475631 GTGCCCTTCTCACCAGCACAGGG - Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1190633684 X:52413642-52413664 GTGAGCAACTCATTAGCAAATGG + Intergenic
1193337362 X:80306655-80306677 GTGACCTCCTCTATGGCCCAGGG + Intergenic
1194668863 X:96706201-96706223 GTGGCCAATTCAAGAGCACATGG - Intronic
1197664390 X:129208148-129208170 ATGTTCTATTCAATAGCACATGG - Intergenic
1197841267 X:130749532-130749554 GTGTTCTACCTAATAGCACATGG + Intronic
1201545876 Y:15161525-15161547 GTGACCTCCTCATTACCACAAGG + Intergenic