ID: 928395682

View in Genome Browser
Species Human (GRCh38)
Location 2:30941815-30941837
Sequence TTTGAAAATTTGCAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 388}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928395682_928395686 22 Left 928395682 2:30941815-30941837 CCTTCCAACTGCAAATTTTCAAA 0: 1
1: 0
2: 1
3: 25
4: 388
Right 928395686 2:30941860-30941882 TGTATCTGACCCCTCAGACTTGG 0: 1
1: 0
2: 1
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928395682 Original CRISPR TTTGAAAATTTGCAGTTGGA AGG (reversed) Intronic
900747644 1:4372081-4372103 AGTAAAAATGTGCAGTTGGAAGG + Intergenic
901989261 1:13099382-13099404 ATTAAAAATTTACAGTTGGATGG - Intergenic
901992552 1:13127382-13127404 ATTAAAAATTTACAGTTGGATGG + Intergenic
904224634 1:29006011-29006033 TTTGAATATTTTCAGTGGTATGG - Intronic
904322152 1:29704866-29704888 TTTTAGAATTTGGAGTTGAAAGG - Intergenic
906740517 1:48178722-48178744 GATGAAAATTTGCAGTGGAAGGG - Intergenic
907708250 1:56851625-56851647 TCTGAAGTTTTGCAGTTGGACGG + Intergenic
909562347 1:77020783-77020805 TTCTGAAATTTGCAGTTAGATGG + Intronic
909662704 1:78101593-78101615 GTTGAAAGTTTGTAGTTGAATGG + Intronic
909871955 1:80752216-80752238 TTTGAAAATTTGCAGTTCAGTGG - Intergenic
910284202 1:85535606-85535628 TCTGAAAATTTGCAGAAGAATGG - Intronic
910937432 1:92496263-92496285 TTTGCAAATTTACATTTGGTAGG - Intergenic
911386600 1:97183143-97183165 TTTAAAAATGTACAGTTTGAAGG + Intronic
911790865 1:102014107-102014129 TTGGAAAATTTGCAGCCTGATGG + Intergenic
912373975 1:109195191-109195213 TTTAAAAATATGCAGGAGGAAGG + Intronic
912544108 1:110438651-110438673 TTTGAATCTTAGCATTTGGAAGG + Intergenic
913443404 1:118923928-118923950 GCTGAAAATTTGAAGCTGGAGGG - Intronic
914205821 1:145527379-145527401 TCTGAAAATTTGCAGAAGAATGG + Intergenic
915217181 1:154348256-154348278 TTTGGAGATTTACATTTGGAGGG + Intronic
916094187 1:161333893-161333915 TTTGAAATTGGGCAGTGGGAAGG - Intronic
916452265 1:164932219-164932241 TATGAAAATTTTAAGTTGCAGGG - Intergenic
916514814 1:165506350-165506372 TTTGAAGACTTGGAGTTGAAGGG - Intergenic
916960044 1:169880362-169880384 TTTGATATTTAGCAGTTTGATGG - Intronic
917546437 1:175973631-175973653 TTTGAACATTTCCAGTGGTAGGG - Intronic
917617278 1:176758939-176758961 TTTACTAATTTGCAGATGGAAGG + Intronic
917820054 1:178753815-178753837 TATGAAAATTTGCAGGTTGAAGG + Intronic
918142288 1:181729828-181729850 TTTGAGAATTTGCAAATAGATGG + Intronic
918165985 1:181948356-181948378 TTAGAAAATTTGCAGACTGATGG + Intergenic
919322928 1:196065702-196065724 TTTGAACATATGAATTTGGAAGG - Intergenic
919521743 1:198598035-198598057 TTTAAAAATATGAAGTTGTATGG - Intergenic
919567395 1:199206121-199206143 TAGGAAAATTTGCAGTGGCACGG - Intergenic
921257129 1:213352606-213352628 TTTGAAGCTTCTCAGTTGGAAGG + Intergenic
921854679 1:219969010-219969032 TTTGAAAAATTGCAATGGAAAGG - Intronic
922208895 1:223471970-223471992 TTAGAAGATTTGCAGTTGATTGG - Intergenic
922623356 1:227009916-227009938 TTAGAAAATTAGCTGTAGGATGG - Intronic
923747933 1:236719993-236720015 TTGGAAAATGTGCATATGGATGG - Intronic
924190388 1:241545676-241545698 CTTGAACATATGAAGTTGGAAGG + Intronic
924371232 1:243352453-243352475 TTTGCAAGTTGGCAGTTGGCTGG - Intronic
1063479551 10:6362394-6362416 TTTGGAAATAAGCATTTGGATGG + Intergenic
1063775047 10:9253605-9253627 TTTAAAAATTTTATGTTGGAAGG - Intergenic
1063778781 10:9296328-9296350 TCTGAAAATTTGGAGCTGGAAGG + Intergenic
1064043885 10:11993611-11993633 TTTCAAAATTTCCAGGTAGAGGG - Intronic
1064716417 10:18181273-18181295 TCTTAAAATTTGCAGTGTGAGGG - Intronic
1065150212 10:22815160-22815182 AATGAAAATTTTCAGTTAGAAGG + Intergenic
1065161223 10:22924546-22924568 TTTTAACATATACAGTTGGATGG - Intergenic
1066394778 10:35008930-35008952 TTTAAAAATTTTGTGTTGGATGG + Exonic
1066526500 10:36284679-36284701 TTTGAAAGTTTCCTGTTGGAGGG + Intergenic
1067230407 10:44403555-44403577 TGCGAAAATTTACAGTTGCATGG + Intergenic
1067671094 10:48322263-48322285 TTTGAAATTTTGAAGTTAGCAGG + Intronic
1068023552 10:51615953-51615975 TTTTAAAATTTGCTTTTGTAGGG + Intronic
1068321384 10:55422241-55422263 TTTGAATAATTTCAGTTAGAAGG - Intronic
1068578428 10:58710653-58710675 TTTGAAAAAATGAATTTGGAAGG + Intronic
1069283581 10:66685936-66685958 TATGAAAATTTAGAGTTGGGAGG - Intronic
1070519646 10:77241173-77241195 TGTGAAAATTTCCAGAAGGATGG + Intronic
1071440415 10:85687422-85687444 TTTTAAAATTTGAATTTGTATGG + Intronic
1071534328 10:86415151-86415173 TTTAAAAATATGGAGTTGGCCGG - Intergenic
1072295175 10:94002063-94002085 TTTTAAAATTTACAGTGGTAGGG + Intronic
1072653757 10:97316392-97316414 TTTGAAAATTTTAAGTAGGCCGG + Intergenic
1075726870 10:124615154-124615176 TTGGAAAATATGCAGATGGCTGG + Intronic
1076819043 10:132929531-132929553 TTTGCACAGTTGCAGTTAGATGG - Intronic
1078948516 11:16100276-16100298 TTTTAAAATTTGTACATGGAAGG + Intronic
1079739150 11:24035987-24036009 TTGGATAATTTGCAGCTTGATGG + Intergenic
1081008265 11:37774842-37774864 TTGGAAAATTTGCAGCGTGAAGG - Intergenic
1081291687 11:41334212-41334234 TTACAAAACTTGCAGTTGGCTGG + Intronic
1081440356 11:43074025-43074047 TTTGAAACCTGGGAGTTGGAGGG - Intergenic
1084884660 11:72195814-72195836 TGTGACAATTTGGAGTTGTAGGG + Intronic
1085215577 11:74827509-74827531 TTGGAAAATTTCCAGTCTGACGG - Intronic
1085629525 11:78102654-78102676 TTTAAAAAATTACAGTTGGCCGG + Intronic
1086829400 11:91541197-91541219 TTTGAAATTATGCAGTTTAAGGG + Intergenic
1087287452 11:96280546-96280568 CATGAAAATTTGTAGTTGAAAGG + Intronic
1087690882 11:101319497-101319519 TTTGAAAATATACAGTTAGAGGG - Intergenic
1087812871 11:102627101-102627123 TTTCAAAATTTGCATTTATATGG + Intergenic
1089636151 11:119813317-119813339 TTTGTAAATGTGCAGCTGAATGG + Intergenic
1090316646 11:125796938-125796960 TTTGAAAATTCACAGTCAGAGGG - Intergenic
1090996394 11:131869579-131869601 TTTTAGAAATAGCAGTTGGAAGG - Intronic
1091966076 12:4742960-4742982 CATAAAAATTTGGAGTTGGAAGG + Intronic
1092164579 12:6335197-6335219 TTTGTAAATTTTGAGGTGGAGGG - Intronic
1092308118 12:7322623-7322645 TATAAAAATTTACAGTGGGATGG - Intronic
1093505617 12:19862420-19862442 TTTGACACTTCGCAGTTGAAAGG - Intergenic
1093587502 12:20858160-20858182 TTTGAAAATTTGGAGTTTACTGG - Intronic
1093633864 12:21441481-21441503 TTTGAAAATATACAGTCAGAAGG - Intronic
1093823031 12:23645233-23645255 CTTGAAAATGTGCAGATGGAGGG + Intronic
1095762765 12:45858457-45858479 TTTTAGAATTTGCAGGTGAATGG + Intronic
1096128000 12:49134152-49134174 TATAAGAATTTGCAGTTGGTGGG + Intergenic
1096907062 12:54945655-54945677 TTTTAAAGTTTGCTGTGGGATGG + Intergenic
1097100066 12:56581417-56581439 TTTGCAAATTTGCTGATGGCGGG + Exonic
1097551401 12:61076206-61076228 TTTGATAATTTGCAGTTTAATGG - Intergenic
1097589712 12:61559534-61559556 TTTGAAAATTGGTAATTAGAGGG - Intergenic
1097879408 12:64673438-64673460 TTTGAAAACTTACTGTTGAAAGG + Intronic
1099373755 12:81870918-81870940 TTTAAAAATATGAAGTTGGATGG + Intergenic
1099636634 12:85222028-85222050 TGGTAAAATATGCAGTTGGAAGG + Intronic
1099760031 12:86908740-86908762 TTAGAAAGTTTGCAGTTACAAGG + Intergenic
1100420097 12:94424306-94424328 TTTGCAAATTTGCTGATGGCGGG - Intronic
1100733949 12:97505847-97505869 TTTGTACATTTTCAGATGGATGG + Intergenic
1100970074 12:100060063-100060085 TTTAAAAATTTTTAATTGGATGG + Intronic
1102620080 12:114187385-114187407 TTTAAAAATTTCCAGTTGTTAGG + Intergenic
1105885754 13:24639675-24639697 TTTGCAAGTTTGCAGTGGGGAGG - Intergenic
1106132421 13:26951425-26951447 TTTGAACATTTGCAGTTGGCTGG - Intergenic
1106935413 13:34713183-34713205 TTTTAAAATTTTAAGTTAGATGG + Intergenic
1107759438 13:43661214-43661236 TTTGATAATGTGCAGTTTTAAGG + Intronic
1107944461 13:45405586-45405608 TTAGCAAATTTTAAGTTGGATGG + Intronic
1108368668 13:49745333-49745355 CTTGAAACTTTTCAGTTGTAGGG - Intronic
1108521796 13:51252621-51252643 TTTTAAAATTTCCAGATAGATGG - Intronic
1108773811 13:53738105-53738127 TTTTAAAATTTGTATTTGAAAGG - Intergenic
1109195536 13:59374274-59374296 TTTAAAAAATTGCAATTGGTAGG + Intergenic
1109715543 13:66217343-66217365 TTTGAAGATATGCAGATGGTGGG + Intergenic
1112137197 13:96593490-96593512 TTTGAAAATACACAGTTGGCTGG - Intronic
1112198754 13:97254181-97254203 TTTAAAAATTTGCATTGGGCTGG - Intronic
1112598003 13:100827258-100827280 TTTAAAAATTTGCTGTTTGGTGG + Intergenic
1112862741 13:103853191-103853213 TTTAAATATTTGCAGTTGACTGG - Intergenic
1114273741 14:21122563-21122585 ACTCAAAATTTGCAGTTGGTTGG - Intergenic
1114310791 14:21465074-21465096 TTTGAAAATTTTCATTTGGGAGG + Intronic
1114329852 14:21626028-21626050 TTTGATAATATGAATTTGGATGG + Intergenic
1115010538 14:28539999-28540021 TTGGAAAATTTGCAGCCTGATGG + Intergenic
1115907027 14:38211421-38211443 TTTGAAAACGCGCAGTAGGAGGG - Exonic
1115995668 14:39193349-39193371 TTTGAATGTTTTCAGTGGGATGG + Intergenic
1116683540 14:48009088-48009110 TTTGAAAATTCGCACAAGGATGG - Intergenic
1117057087 14:51923389-51923411 TTTGAAACTGTGAAATTGGATGG + Intronic
1118193537 14:63603087-63603109 GTTGAAAATTAAAAGTTGGAGGG - Intronic
1118998402 14:70858645-70858667 TGTAAAAATTTGCATTTGAATGG - Intergenic
1119094451 14:71816105-71816127 TTTTAAAATCTGCAGATGAAAGG + Intergenic
1119659248 14:76438756-76438778 TTTGCAAATTTCTAGTTTGAGGG - Intronic
1121948556 14:98147645-98147667 TTTTAAAAAATGCAATTGGATGG - Intergenic
1202829168 14_GL000009v2_random:7519-7541 GTTGAGAATTTGAAATTGGAAGG + Intergenic
1202900884 14_GL000194v1_random:37371-37393 GTTGAGAATTTGAAATTGGAAGG + Intergenic
1202938613 14_KI270725v1_random:119120-119142 TTTGGAAAGTTGCAGCTGGGAGG - Intergenic
1123689632 15:22827249-22827271 TCTGAATATTTGCATTTGAAAGG + Exonic
1123836604 15:24201207-24201229 TTTGAAAGTTTGCACTGGGGTGG - Intergenic
1124851418 15:33342227-33342249 TATGGAAATTTGCAGATGGCAGG - Intronic
1126581838 15:50249209-50249231 TTTGGAAATTTTCAGATGTATGG - Intronic
1126829028 15:52580296-52580318 TTAGAAACTTTGAAGTTGAATGG - Intergenic
1126912277 15:53429557-53429579 TTTTAAAGCTTGCTGTTGGATGG + Intergenic
1127894357 15:63281963-63281985 TTTGGAAATTTGCAAATGGTAGG + Intronic
1128841776 15:70856184-70856206 TTTGAAAACTGACAGTTGGTGGG + Intronic
1133068673 16:3230323-3230345 TTTTAAATTTTCCAGGTGGAAGG + Intronic
1134256528 16:12616523-12616545 TTTGAAAAGTAGCAATGGGAGGG - Intergenic
1135535169 16:23288314-23288336 TTTGAAAATTTGTAATTAAAAGG - Intronic
1135773169 16:25233190-25233212 TTTTGAAATTTGACGTTGGACGG - Intergenic
1136866036 16:33755284-33755306 TTTGGAAATTTGCATTTTAAAGG + Intergenic
1137588817 16:49680985-49681007 TTAGAAAATTTGCCCTTGGCTGG - Intronic
1137849605 16:51726753-51726775 CTAGAAAAATTACAGTTGGAAGG + Intergenic
1137987326 16:53120258-53120280 TTTAAAAAATTGCACTAGGATGG + Intronic
1140281026 16:73555532-73555554 TTTGAAAGGATGCAGTTGGCCGG + Intergenic
1141042791 16:80686367-80686389 ATTGAAATTTAGCATTTGGAGGG - Intronic
1141725458 16:85785271-85785293 TCTAAAAATTTGTAGTTGGCCGG + Intronic
1203106118 16_KI270728v1_random:1360819-1360841 TTTGGAAATTTGCATTTTAAAGG - Intergenic
1203127396 16_KI270728v1_random:1601549-1601571 TTTGGAAATTTGCATTTTAAAGG + Intergenic
1143848896 17:9794574-9794596 TTTGAAAGTCTGGAGTTGGATGG + Intronic
1144587115 17:16493516-16493538 TATGAGATTTTGCAGTTGCAGGG + Intergenic
1146487428 17:33254715-33254737 TTTTAAAATATGAAGTTTGAAGG - Intronic
1147011927 17:37456729-37456751 TTTGAAATTATGCATTTTGATGG + Intronic
1149119776 17:53148566-53148588 TTTGAAAGTTTCAAGTCGGAAGG + Intergenic
1151545916 17:74792935-74792957 TTTTAAAGCTTGCATTTGGAAGG - Intronic
1153196208 18:2599777-2599799 TTTGAAAATTGGCATTTTTAGGG - Intronic
1155216373 18:23646853-23646875 TTTTAAAATGAGCGGTTGGATGG + Intronic
1155809903 18:30219143-30219165 TTTGAAAATTTGTTGTTTAAAGG + Intergenic
1156731111 18:40194232-40194254 TTTGAAAATTATCAGGGGGATGG + Intergenic
1156928649 18:42614582-42614604 TTTGAAAAATTGCAGTGCCAGGG + Intergenic
1157023440 18:43814549-43814571 TTTGTAAATATGCATATGGATGG + Intergenic
1157052878 18:44189220-44189242 GTGGAAATTTTGCAGTTGTAGGG + Intergenic
1157999392 18:52598680-52598702 AATGAAAATTTGCATTTGGATGG + Intronic
1158055774 18:53278567-53278589 TTTGAAAATTAACAGCAGGAAGG - Intronic
1158149712 18:54354570-54354592 TTTTAAAACTTGCAGATAGATGG - Exonic
1159086336 18:63795903-63795925 TTGAAAAATTTGCAGCAGGAAGG + Intronic
1159752914 18:72325100-72325122 GATGAAAATTAGCAGTTGGAAGG + Intergenic
1159908657 18:74122369-74122391 TCTGAAAATTGGCAGTTAAAAGG + Intronic
1160406791 18:78651859-78651881 ATTGAAAACAGGCAGTTGGAAGG + Intergenic
1161411352 19:4119858-4119880 ATTGGAAATTTCCAGATGGAAGG - Intronic
1164812759 19:31171062-31171084 TTAGAAAATTTACACTTGGTGGG + Intergenic
1165295002 19:34919504-34919526 TATGGAAATATGCAGTTAGATGG + Intergenic
1165527886 19:36371519-36371541 TCTAAAAATATACAGTTGGATGG + Intronic
1165666996 19:37639894-37639916 TTTGAACATTCTCAGTTAGAAGG + Intronic
1202643528 1_KI270706v1_random:120270-120292 GTTGAGAATTTGAAATTGGAAGG - Intergenic
925816655 2:7758349-7758371 TTTGAAAATTGGCAAGTGGAAGG - Intergenic
925819074 2:7781484-7781506 TTTGAAAATATTGAGTTGTAAGG + Intergenic
926504574 2:13697486-13697508 TTAAAAAATTTACAGTTGAATGG - Intergenic
926529640 2:14027969-14027991 GTTGAAAATTGGCAGGTGGGTGG - Intergenic
926549605 2:14285926-14285948 TTTGAAAATATGTAATTGAATGG + Intergenic
926782830 2:16491003-16491025 GTTCAAAATTTGAAGTTGGTGGG - Intergenic
928395682 2:30941815-30941837 TTTGAAAATTTGCAGTTGGAAGG - Intronic
929848899 2:45563045-45563067 TTTGATTATCTGGAGTTGGAAGG + Intronic
930578265 2:53179049-53179071 TTTTTAAAATTTCAGTTGGAGGG + Intergenic
930755781 2:54970686-54970708 TTTGAAAGTTTCCAGTTGTGTGG + Exonic
930836207 2:55795958-55795980 TTAGATAATTTTCAGTTGAAGGG + Intergenic
932112917 2:69017759-69017781 TTTGAAAAGTTAGATTTGGAAGG + Intronic
932511004 2:72290175-72290197 TTCCAAAATATGCAGTTGGCAGG - Intronic
932786220 2:74606201-74606223 TTTGAATTTGTGCAGTTTGATGG - Intronic
932915503 2:75854008-75854030 TTTAAAAGTTTGCATTTGCATGG + Intergenic
933138065 2:78760889-78760911 TTTTAAAATGTGCTGTGGGAGGG - Intergenic
934505904 2:94893837-94893859 GTTGAGAATTTGAAATTGGAAGG - Intergenic
934634549 2:95972156-95972178 TTTGGAAATTTGCATTTTAAAGG + Intronic
934834353 2:97570391-97570413 TTTGGAAATTTGCATTTTAAAGG + Intronic
935427271 2:102933264-102933286 TTTTAAAATTTGTAGTGTGAAGG + Intergenic
935619045 2:105112855-105112877 TGTGAAAATTAGTAGTGGGAGGG + Intergenic
936729418 2:115361916-115361938 TATGAAAATTTGGAGTTGGGGGG - Intronic
938759875 2:134414430-134414452 TTTGAAACTTTGGAGTTTGGCGG + Intronic
938838209 2:135130014-135130036 TTTTAAAATTTGCCGTCGAAAGG + Exonic
938975694 2:136475340-136475362 GTTGAAAGTCTTCAGTTGGAGGG - Intergenic
939091454 2:137784667-137784689 TTTGAAATTTTGATCTTGGAAGG - Intergenic
939343270 2:140928468-140928490 CTTGAATGTTTGCAGTTGGCAGG + Intronic
939702356 2:145409105-145409127 ATTGAAAATTTCCAGAGGGAAGG - Intergenic
940744687 2:157554488-157554510 TTTAAAACTTTGCAGTTTGGGGG + Intronic
941612683 2:167680984-167681006 TTTTAAAATTTGTAATTGCAAGG + Intergenic
941991206 2:171559373-171559395 TCTAAAAATTTGGAGTTGGCCGG + Intergenic
942160958 2:173186342-173186364 ATTGAATTTTTGCAGTTTGAGGG + Intronic
943207606 2:184920285-184920307 TTTTAAAACTTGCAGTTAAAGGG + Intronic
944864445 2:203846961-203846983 TGTGAAAATGTTCAGGTGGAGGG + Intergenic
944928291 2:204488517-204488539 TTTGATAATTTGGAGTTTGTTGG + Intergenic
944993397 2:205264423-205264445 TCTGAAAATTAGCAGCTGCATGG + Intronic
945641123 2:212431288-212431310 TTTTAATATGAGCAGTTGGAAGG - Intronic
945794194 2:214341456-214341478 CTTGAAAATTTGTAGTTCAAGGG - Intronic
945881539 2:215329734-215329756 TTTGAAAATTTGATATTTGAAGG + Intronic
946255361 2:218438029-218438051 TTTTAAATTCTGCAGTTAGATGG + Intronic
946577786 2:221094956-221094978 TCTTGAAATTTGAAGTTGGAGGG + Intergenic
948413383 2:237782382-237782404 TTTGAAAATTTGCAACTGGCTGG - Intronic
948773599 2:240267741-240267763 TTTTAAAATTTCCATTTGCATGG + Intergenic
948926812 2:241104220-241104242 TTTAAAAATATGCAGTGGGTTGG + Intergenic
949080643 2:242096155-242096177 TTTTAAAATTTAAAGTTGGTTGG + Intergenic
1169755453 20:9038478-9038500 TTTGAAAATTGTCAATAGGATGG + Intergenic
1170141705 20:13131525-13131547 TTGGAAAATTTGCAGAAGTAAGG - Intronic
1170371262 20:15651067-15651089 TTTGAAAATTTGAAAATGGTTGG + Intronic
1171401627 20:24876314-24876336 TTTAAAAATGTGCTGTTGGTGGG - Intergenic
1171508133 20:25656120-25656142 TTTAAAATTTTCCAGTTGCATGG + Intergenic
1171893492 20:30739209-30739231 GTTGAGAATTTGAAATTGGAAGG - Intergenic
1174875202 20:54220519-54220541 TTTAAAAATTTGCCTTTGGCCGG - Intronic
1176584702 21:8570013-8570035 TTTGGAAAGTTGCAGCTGGGAGG + Intergenic
1176608352 21:8852358-8852380 GTTGAGAATTTGAAATTGGAAGG + Intergenic
1176620258 21:9052149-9052171 GTTGAGAATTTGAAATTGGAAGG + Intergenic
1176897761 21:14402814-14402836 TTTCAAAATATGAAATTGGAGGG + Intergenic
1177526533 21:22299359-22299381 TTTGAAAATGTGTAGTTTTAAGG - Intergenic
1178060987 21:28852995-28853017 ATTTAAATTTTGCAGTTGAATGG + Intergenic
1178893265 21:36538125-36538147 TTTGAAAATTTTCAGTCAGTTGG + Intronic
1179680083 21:43013572-43013594 TTTTAAAATTTACAGTTCAATGG + Intronic
1180267513 22:10546915-10546937 TTTGGAAAGTTGCAGCTGGGAGG + Intergenic
1180358438 22:11862163-11862185 GTTGAGAATTTGAAATTGGAAGG + Intergenic
1180379824 22:12130167-12130189 GTTGAGAATTTGAAATTGGAAGG - Intergenic
1181163385 22:20970755-20970777 TTTAAAAATTGCCAGTTGGCCGG - Intronic
1184219800 22:43092540-43092562 TTTGCAAATGTACAGTTGGTTGG - Intergenic
949755646 3:7407549-7407571 TTTTAAAATTTTCAGTATGAAGG - Intronic
950367085 3:12494734-12494756 TTTTAAAAATTCCAGTAGGAAGG + Intronic
951118545 3:18895117-18895139 TGTTGAAATTTGCACTTGGAAGG + Intergenic
951218638 3:20046857-20046879 TTTCAATCTTTGCAGTTGGGAGG + Intronic
951445061 3:22769416-22769438 TATGAAAATTTGCTGTTGTTAGG + Intergenic
952055913 3:29445672-29445694 TCTGAAAATTGGCAGTAGTATGG + Intronic
952137907 3:30444388-30444410 TTTTAAAATTTGGAGTTTGAAGG - Intergenic
953299807 3:41762140-41762162 TTAAAAAATTTGCAGGTAGAAGG - Intronic
954564032 3:51583178-51583200 TTTGAAAATTTGAAGATGTCTGG + Intronic
954587853 3:51752313-51752335 TTTTAAATTTTGCAGCTGCAAGG + Intergenic
954891324 3:53932261-53932283 TTTGAAAAGTTGCATTTTTAAGG + Intergenic
954986026 3:54792854-54792876 TCTCAGATTTTGCAGTTGGAAGG - Intronic
955029612 3:55203607-55203629 ATTCAAGTTTTGCAGTTGGAGGG - Intergenic
956068898 3:65426774-65426796 TTTGTACATCTGCAGTTGGCAGG - Intronic
956875816 3:73462170-73462192 TGGGAAAGTTTGCAGTTGAAAGG + Intronic
957756124 3:84490659-84490681 TTGGAAAATATACAGTTGGGGGG - Intergenic
958698919 3:97563259-97563281 TTGGAGAATTTGATGTTGGAGGG + Intronic
958987971 3:100805073-100805095 TTTGAAATTTTGCAGTTTCTCGG - Intronic
959137183 3:102437940-102437962 TTTGAAAAGTTGCAGTAGTCTGG + Intronic
959532024 3:107444178-107444200 ATTTAAAAATTGCAGTTGGCTGG + Intergenic
959653118 3:108771235-108771257 GTTAAAAATTTGCATTTAGAAGG + Intergenic
959806417 3:110559923-110559945 TTTTAAAATTTCCATTTGCATGG + Intergenic
961131603 3:124472727-124472749 TTTTAAAATTTGCACTTTAATGG + Intronic
963436698 3:145277844-145277866 TTTGCAAATTTGCACATGTAAGG - Intergenic
964688211 3:159420986-159421008 TTTCGAAACTTTCAGTTGGATGG - Intronic
964978355 3:162647289-162647311 TTGGAAAATTTGCAGCCTGATGG + Intergenic
965976474 3:174629906-174629928 TTTGGAATTTTGAAGTTGAAAGG + Intronic
966963688 3:184967968-184967990 TTAAAAAATTTGGAGGTGGATGG - Intronic
967539196 3:190645431-190645453 TTTGTTAATTTACAGTTGAATGG + Intronic
969208415 4:5666282-5666304 TTTTAAAATTTGTAGTTGCTGGG - Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
971785854 4:31101714-31101736 TTTGAAACATTTCAGTTGAAAGG - Intronic
971894302 4:32571790-32571812 TTTGAACATTTCCATTTGAATGG - Intergenic
972502642 4:39692884-39692906 TTTAAAAATTTGTTTTTGGATGG + Intergenic
972611484 4:40659613-40659635 TTTTAAAATTTACATTTGGGAGG + Intergenic
973580827 4:52342439-52342461 TTGGAAAATTTGCAGCCTGACGG - Intergenic
974593111 4:63982043-63982065 TTTGAAAACATACAGTTAGAGGG - Intergenic
974883607 4:67788866-67788888 TTTGAAAGGCTGAAGTTGGAGGG - Intergenic
975469166 4:74745199-74745221 TTTGAAAATTATCAGTTGTTTGG + Exonic
975939232 4:79621579-79621601 TTTAAAAATTTGCAGTATGTTGG - Intergenic
976171076 4:82304948-82304970 CTTAAAAATTGTCAGTTGGAAGG + Intergenic
978029361 4:103920346-103920368 TTTTAAAATTTCCATTTGGTTGG + Intergenic
978907322 4:114022255-114022277 TTTCAACATATGAAGTTGGAGGG - Intergenic
979141959 4:117187845-117187867 TTTAAAATTTTGGAGATGGAAGG - Intergenic
979375899 4:119946362-119946384 TATGAAATTTGGCATTTGGATGG - Intergenic
980381039 4:132017552-132017574 TTTGACAATGTGCAGTTCGAGGG - Intergenic
982319658 4:154064814-154064836 TTTAAAGGTTTGCAGGTGGAAGG + Intergenic
983503370 4:168525989-168526011 TTTTAAGATTTGCAGGTGAAAGG - Intronic
984046318 4:174803917-174803939 TTTGCAAACTTGTAGTTGTAGGG + Intronic
984370026 4:178851579-178851601 TTTGGAATTTTAGAGTTGGAAGG - Intergenic
984630249 4:182053218-182053240 TATAGGAATTTGCAGTTGGAGGG + Intergenic
1202770896 4_GL000008v2_random:206184-206206 GTTGAGAATTTGAAATTGGAAGG - Intergenic
986519190 5:8595532-8595554 TTCGAAACTTTGCACCTGGAAGG - Intergenic
986607821 5:9539907-9539929 TTTGTAAACTGGCAGGTGGAGGG - Intronic
986761188 5:10881514-10881536 TCTGAAAATTTGAAGATAGAAGG - Intergenic
988175625 5:27720494-27720516 TGTGAAAATTTGCAAGTGCAAGG + Intergenic
991216740 5:64165292-64165314 CTTGACAAATTGCAGTTGGGAGG - Intergenic
991220287 5:64206644-64206666 CTTTAAAATATGCACTTGGAGGG - Intronic
992341458 5:75828011-75828033 TTTTAAAATATGAAGATGGAGGG - Intergenic
993717164 5:91286944-91286966 TCTCAAGCTTTGCAGTTGGACGG - Intergenic
994873184 5:105379652-105379674 TTTGAAAGTATGCATTTGGGGGG + Intergenic
995166556 5:109050803-109050825 TGTTAAAATTTGCACTTTGAAGG - Intronic
995175101 5:109167037-109167059 ATTGAAAATTTCAAGTTTGAAGG - Intronic
995307624 5:110672546-110672568 TTTGGAAATTTGAAGTTGTTTGG - Intronic
996555479 5:124774389-124774411 TTTAAAAATTAGCAATTGCATGG + Intergenic
998549085 5:143059316-143059338 TTTCAAGCTGTGCAGTTGGAAGG + Intronic
998636052 5:143955913-143955935 TTGGTAAATTTGCTGATGGATGG - Intergenic
998727966 5:145040579-145040601 TTTTACTATTTGCTGTTGGAGGG + Intergenic
999407576 5:151320776-151320798 TTTAAAAATCTGCATTTGTATGG + Intronic
999589695 5:153131438-153131460 TCAGAAAATTTGCAGCTTGATGG - Intergenic
1000968772 5:167691267-167691289 TTACAAATTTTGCAATTGGAAGG - Intronic
1003671271 6:8162627-8162649 TTAGAAAATTTGCTTTTGGGGGG + Intergenic
1004371442 6:15056037-15056059 ATTGAAAACTTGCTGTTGGCTGG + Intergenic
1005004336 6:21272713-21272735 TTTGGGGATTTGCAGTGGGAGGG + Intergenic
1005176323 6:23048908-23048930 ACTGAAAATATGCATTTGGATGG + Intergenic
1005177913 6:23069162-23069184 TTTTGAAATTTGCAGTTAAAAGG - Intergenic
1005207680 6:23422974-23422996 TTGGAATATTTTCAGTAGGATGG - Intergenic
1005416292 6:25603894-25603916 TTTAAAAATCTGCAGGTGGGAGG - Intronic
1005458791 6:26047713-26047735 TTTTAAAATTTGCAGTATTAAGG - Intergenic
1008848250 6:55994071-55994093 TTGGAAAATTTGCAGGCTGATGG - Intergenic
1010055064 6:71555842-71555864 TTGGAAAATTTGCACCTTGATGG + Intergenic
1011092234 6:83616705-83616727 TTTGAACATTTGCCTTTAGAAGG - Intronic
1011099397 6:83706039-83706061 TTTGAAAATTTGAAGGTAGGAGG - Intronic
1011426194 6:87234145-87234167 TTTGCAATTTTGCATTTTGAGGG + Intronic
1012036820 6:94152352-94152374 TTTTAAAATTTTCAATTGGTGGG + Intergenic
1012096345 6:94967554-94967576 TTTGAAAATGTTCAGGAGGAGGG + Intergenic
1012269616 6:97192666-97192688 TTTGCCAATTAGCAGTTGGATGG + Intronic
1013558832 6:111284058-111284080 TTGGAAAATTTGCAGACTGATGG - Intergenic
1014339482 6:120186600-120186622 TTTAAAAATATGCAGTTAGTAGG - Intergenic
1014438677 6:121448483-121448505 TGTTAAAATTTGCACTTTGAAGG + Exonic
1015372421 6:132469414-132469436 TTTAAAAAGCTGCAGTAGGAGGG + Intronic
1015424808 6:133053280-133053302 TTTGAACAATTGCACATGGAAGG + Intergenic
1016578780 6:145603318-145603340 TTTGACAATTTGCAGGTTGAAGG - Intronic
1017860733 6:158394914-158394936 CTTGAAATCATGCAGTTGGAAGG + Intronic
1018086369 6:160304342-160304364 TTGAAAAATTTGCAGTCTGACGG - Intergenic
1018126298 6:160685748-160685770 TTTGAAATGTTCCAGTTGGGAGG - Intergenic
1019035716 6:169056552-169056574 TTTGAAAATATGCAGTCAGAAGG - Intergenic
1019224379 6:170498266-170498288 GTTGAAACTTTCCAGTTGGCTGG + Intergenic
1020164893 7:5800022-5800044 TTTAAAAATGTGGAGTTGGCGGG - Intergenic
1021155536 7:17205240-17205262 TTTGGAATTTTGCAATTGCATGG - Intergenic
1021856230 7:24859293-24859315 TTTAAAATTTTTCAGTGGGAGGG - Intronic
1022615521 7:31926482-31926504 TTAGAAAACTACCAGTTGGATGG + Intronic
1022951199 7:35339849-35339871 TTTGCCAAAATGCAGTTGGATGG - Intergenic
1023232402 7:38049358-38049380 TTTAAAAATTTGCTTTTGTAGGG + Intergenic
1023681477 7:42691801-42691823 TTTGGCAATTTGCAGTATGAAGG - Intergenic
1029043987 7:97607972-97607994 TTTGTAAATTTGCATTTGTGTGG - Intergenic
1030061843 7:105628152-105628174 TTTTAAAAGATGCATTTGGAAGG + Intronic
1030602485 7:111608638-111608660 TTTGAAATTTTGCATTGGGCTGG + Intergenic
1030933306 7:115552262-115552284 TTTAAAAAATTGCCTTTGGAGGG - Intergenic
1031163043 7:118191214-118191236 ATTGAATATTTCCAGTTAGAGGG + Intronic
1032430402 7:131856388-131856410 TTGGAAAATTTGCAGCCTGATGG + Intergenic
1032880038 7:136079135-136079157 TTTAAAAATTTGCAGTTTATGGG + Intergenic
1032961027 7:137034370-137034392 TTTGAAAATTTGCAATAAAATGG + Intergenic
1033462289 7:141557886-141557908 TTTGTAAATCTGCAGTTCGATGG + Intronic
1033850310 7:145487280-145487302 TGGGACAATTTGAAGTTGGAAGG + Intergenic
1033913480 7:146293907-146293929 TTTAAAAAAGTGGAGTTGGAGGG + Intronic
1034000285 7:147404233-147404255 TTTGATTATTTGTAGTTTGATGG - Intronic
1034909395 7:154981777-154981799 TTTTAAAATTTTTATTTGGAAGG - Intronic
1035646716 8:1228417-1228439 TTTCAAAATCAGAAGTTGGAGGG + Intergenic
1036087496 8:5628170-5628192 TCTGAATATTTGCAAGTGGAAGG - Intergenic
1038933891 8:32226271-32226293 TTTGAAAATGTGCTGATTGAAGG - Intronic
1039108149 8:34012102-34012124 TTTGAACATTTGCATTTAAAGGG + Intergenic
1040367667 8:46735086-46735108 TTTTAAAATTTCCAGATAGAAGG + Intergenic
1041148790 8:54910218-54910240 TTTTAAAATTTGAATTTGTATGG + Intergenic
1041230294 8:55743667-55743689 TTTGAAAGTTTACAGTTACATGG - Intronic
1041740184 8:61149751-61149773 TTTGAAAATATCCAGTTAGAGGG - Intronic
1043280781 8:78463563-78463585 TTTTAAATTTTGGATTTGGAAGG - Intergenic
1043361488 8:79477738-79477760 TTTGGAAATTTGAAGGTGGGTGG + Intergenic
1043735526 8:83737918-83737940 TTTGACATTTTGCTGTTAGAAGG - Intergenic
1044262978 8:90149110-90149132 TTTGAAAATTTGCATTTTTGTGG + Intergenic
1045165476 8:99599985-99600007 TTTAAAAATGTACAGTTGAATGG - Intronic
1046446831 8:114332331-114332353 TTTGAATATTTGTAGTTATAAGG + Intergenic
1048493882 8:134919623-134919645 CTTAAAACTTTGCAGCTGGAAGG + Intergenic
1048655520 8:136531238-136531260 TTTGACAATATGCAGTTCTAGGG + Intergenic
1048926378 8:139276176-139276198 TTTGCAAATTTGAAGGTGGTGGG - Intergenic
1050186305 9:2978356-2978378 TTTTAAAATTTGCAGATATAAGG - Intergenic
1050318152 9:4424318-4424340 TGTGAAATTATGCAGTTAGAAGG + Intergenic
1050628650 9:7535798-7535820 TTTCAACATTTGAATTTGGAAGG - Intergenic
1053581424 9:39408781-39408803 TTTGAAAGTGTGCTGTTGGCCGG + Intergenic
1053845903 9:42236814-42236836 TTTGAAAGTGTGCTGTTGGCCGG + Intergenic
1054103005 9:60967533-60967555 TTTGAAAGTGTGCTGTTGGCCGG + Intergenic
1054355145 9:64053503-64053525 GTTGAGAATTTGAAATTGGAAGG + Intergenic
1054583350 9:66939280-66939302 TTTGAAAGTGTGCTGTTGGCCGG - Intergenic
1055123825 9:72695406-72695428 TTTGGAAATTTGCAGATAGCAGG + Intronic
1056322130 9:85445307-85445329 CTTGAAAATTTGCACCTAGATGG + Intergenic
1057406180 9:94772873-94772895 TTTGAAACTTTGTAGTTGACTGG - Intronic
1058098954 9:100896969-100896991 TTTGAATATTTGAAATTGCAGGG - Intergenic
1058356748 9:104092857-104092879 TTTCAAAATGTGCATTTTGAGGG - Intergenic
1058610416 9:106769932-106769954 TTTGAACATTAGGATTTGGATGG - Intergenic
1059032271 9:110711497-110711519 TTTGAAAATTTGAAGGAGAAAGG + Intronic
1059258914 9:112957083-112957105 TTTAAAAATCTGCTGTTGGTGGG + Intergenic
1059902415 9:118942976-118942998 TATGAAAATTTACACTTAGAAGG + Intergenic
1203703753 Un_KI270742v1:17571-17593 GTTGAGAATTTGAAATTGGAAGG + Intergenic
1203566641 Un_KI270744v1:96910-96932 GTTGAGAATTTGAAATTGGAAGG - Intergenic
1186190339 X:7061782-7061804 TTATAAAATTTGAAGTTGGTGGG - Intronic
1187365613 X:18663640-18663662 TTTGAAAATAAGAAGTTGGCTGG - Intronic
1187678687 X:21744078-21744100 TTTTACAATTTCCTGTTGGATGG + Intronic
1188830631 X:34892584-34892606 TTTTAAAATTGGTAGTTTGAAGG - Intergenic
1188999274 X:36925006-36925028 TTTGAAAGTTTGCAAATGTACGG - Intergenic
1189892662 X:45621611-45621633 TATGAAGATTTGGAGTTGGTGGG + Intergenic
1189897062 X:45666449-45666471 TTTAAAAATTTGAAGTTGAGTGG - Intergenic
1190499141 X:51057960-51057982 GGTGAAAATTTACAGCTGGATGG - Intergenic
1194225916 X:91257084-91257106 TTTGAAATTTAGCTGTGGGAGGG - Intergenic
1195482495 X:105362250-105362272 CTTGAAAATGTGAAGGTGGATGG + Intronic
1195994338 X:110716683-110716705 TTTGATAAGTAGTAGTTGGAAGG - Intronic
1196659483 X:118254739-118254761 TTTTAAGATGTGCAGGTGGAGGG - Intergenic
1197114464 X:122816817-122816839 TTTGGAAATTTGCATTCAGAAGG - Intergenic
1198486882 X:137095954-137095976 GTTGATAATCTGCAGTAGGAAGG + Intergenic
1198739786 X:139829509-139829531 TTTTAAAATTCCCATTTGGATGG + Intronic
1199614455 X:149645848-149645870 TCAGAGAATTTGCAGTTGAATGG + Intergenic
1199888897 X:152054782-152054804 TTTGAAAATTGTCAATGGGAAGG + Intergenic
1200299833 X:154962226-154962248 TTTGTAAATTTGGAGTGGAAAGG - Intronic
1200336049 X:155352612-155352634 CTTGAAAATTTGCATTTCTAAGG - Intergenic
1200350421 X:155488615-155488637 CTTGAAAATTTGCATTTCTAAGG + Intergenic
1201307388 Y:12562673-12562695 TTTTAAAATATGCTGTGGGATGG + Intergenic
1201460141 Y:14213555-14213577 ATTTAAAAATTGCAGATGGATGG + Intergenic
1202585949 Y:26427308-26427330 TTTGGAAATTTGCATTTTAAAGG - Intergenic