ID: 928396710

View in Genome Browser
Species Human (GRCh38)
Location 2:30948302-30948324
Sequence GCCCTTGCCCAGCTCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 10, 3: 46, 4: 425}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928396707_928396710 -8 Left 928396707 2:30948287-30948309 CCAAAGATATGTTTGGCCCTTGC 0: 1
1: 0
2: 2
3: 15
4: 115
Right 928396710 2:30948302-30948324 GCCCTTGCCCAGCTCCTGGGAGG 0: 1
1: 0
2: 10
3: 46
4: 425
928396702_928396710 30 Left 928396702 2:30948249-30948271 CCTTCTGTGACTCTTATGCAATA 0: 1
1: 1
2: 0
3: 12
4: 179
Right 928396710 2:30948302-30948324 GCCCTTGCCCAGCTCCTGGGAGG 0: 1
1: 0
2: 10
3: 46
4: 425
928396706_928396710 -7 Left 928396706 2:30948286-30948308 CCCAAAGATATGTTTGGCCCTTG 0: 1
1: 0
2: 1
3: 15
4: 153
Right 928396710 2:30948302-30948324 GCCCTTGCCCAGCTCCTGGGAGG 0: 1
1: 0
2: 10
3: 46
4: 425
928396705_928396710 -2 Left 928396705 2:30948281-30948303 CCATGCCCAAAGATATGTTTGGC 0: 1
1: 1
2: 4
3: 22
4: 172
Right 928396710 2:30948302-30948324 GCCCTTGCCCAGCTCCTGGGAGG 0: 1
1: 0
2: 10
3: 46
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928396710 Original CRISPR GCCCTTGCCCAGCTCCTGGG AGG Intronic
900156537 1:1205513-1205535 GCCTCAGCCCAGCTGCTGGGGGG - Intronic
900178084 1:1299461-1299483 ACCCGTCCCCAACTCCTGGGGGG + Intronic
900594947 1:3476426-3476448 GGCCCTGCCCAGCCCCTGAGGGG - Intronic
901236489 1:7670088-7670110 GACCTTCCTCAGCTCCAGGGGGG - Intronic
901362933 1:8719289-8719311 GACATTGCCCAGCTGCTGTGTGG - Intronic
901440266 1:9273424-9273446 GACCTTGCCCTGCTTCTGCGTGG - Intergenic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901517151 1:9755666-9755688 GCGCTGCCCCAGCTCCTGGGAGG + Intronic
902058062 1:13618696-13618718 TGCCCTGGCCAGCTCCTGGGTGG + Intergenic
902468154 1:16630713-16630735 GCCCTCGACCACCTCCTTGGGGG + Intergenic
902668339 1:17954656-17954678 GCCCTAAGCCAGCTCCTGGCTGG + Intergenic
902710582 1:18236868-18236890 GCCCTTGCCCAGGTCCCCAGTGG - Intronic
902822017 1:18949241-18949263 GACCTTGGCCAGGTCCTGGCTGG + Intronic
904200619 1:28816906-28816928 CGCCTGGCCCAGATCCTGGGTGG + Intronic
904317155 1:29673035-29673057 GCCCTTGCCCATCTGCTGTGAGG - Intergenic
904441495 1:30534760-30534782 GCCTTTGCCCATCTGCTGTGAGG + Intergenic
904608938 1:31714773-31714795 CTCCTTGACCCGCTCCTGGGTGG + Intergenic
905308299 1:37033751-37033773 GCCCTTGGCGCGCTCCTGGGAGG - Intronic
905413421 1:37788171-37788193 TACCATGCCCAGCTCCTGGAAGG + Intergenic
906670037 1:47647682-47647704 GCCCTTTCCCTGCCCCTGGGTGG - Intergenic
906730098 1:48073650-48073672 CCCTTAGCTCAGCTCCTGGGAGG - Intergenic
907308856 1:53528115-53528137 ACCCTGGCCCAGGTCCTGAGAGG - Intronic
907452021 1:54551571-54551593 ACCCTTGCCCACCTCCTACGAGG - Intronic
908391566 1:63688126-63688148 ACCCTTCCCCAGACCCTGGGTGG - Intergenic
908611009 1:65861119-65861141 GCCCTTGCCTAGGTCCTGAACGG + Intronic
910156455 1:84225050-84225072 GCCCTAGCACACCACCTGGGAGG - Intronic
910758854 1:90716803-90716825 GGCCGAGCCCAGCTGCTGGGGGG + Exonic
912467010 1:109881316-109881338 GCCCAGGACCAGGTCCTGGGTGG - Intergenic
912488574 1:110048457-110048479 CCCTGAGCCCAGCTCCTGGGTGG + Intronic
913093773 1:115497372-115497394 GCCTCTGTCCAGTTCCTGGGAGG - Intergenic
913611528 1:120514075-120514097 GCCCTTGCCCAGCTGCCCTGCGG + Intergenic
914579664 1:149008164-149008186 GCCCTTGCCCAGCTGCCCTGCGG - Intronic
914887415 1:151596768-151596790 GCCCTGGCCCAGTGCCTGGCAGG + Intergenic
914980518 1:152410734-152410756 TCCTTCGCCCAGCTCCTGCGAGG + Exonic
915936397 1:160092512-160092534 GTCCCTGCCCAGCTGGTGGGTGG - Exonic
917295217 1:173511723-173511745 GCCCATGCCTATGTCCTGGGTGG + Intronic
918088582 1:181266926-181266948 GCCCTTGCCTATGTCCTGAGTGG + Intergenic
919336740 1:196244971-196244993 TCCCTTCCCCAGCTCCAGGCAGG + Intronic
920276965 1:204813685-204813707 ATCCTTGCCCAGATGCTGGGAGG + Intergenic
921041342 1:211435890-211435912 GCCCCTGCCAAGGCCCTGGGAGG + Intergenic
921163717 1:212491063-212491085 GCCTCTGCCCGGCTCCTGGCTGG + Intergenic
921666964 1:217884144-217884166 GGCCTTGCCAGGCTCCCGGGAGG - Intergenic
922731399 1:227950340-227950362 GCCCTGGCCCAGCTCCAGCCAGG + Intergenic
922984799 1:229857941-229857963 GCCCATCCCTGGCTCCTGGGTGG + Intergenic
923104520 1:230843843-230843865 GCCGTTGCTCGGCTCCTGGATGG + Exonic
924243329 1:242060067-242060089 GCGCTTGAACAGCTCCTGGATGG - Intergenic
924379252 1:243446671-243446693 CCACTGGCCCAGCTTCTGGGTGG - Intronic
924825220 1:247531690-247531712 GAACTTGCCCTGCTCATGGGAGG + Exonic
1063127391 10:3147668-3147690 TCCATTGGCGAGCTCCTGGGCGG + Exonic
1063371416 10:5525171-5525193 GACCGTGCCCAGCTCGCGGGTGG - Exonic
1064219825 10:13431154-13431176 GCCCTTCCCCAGCTCCTTCTTGG - Intergenic
1066314433 10:34230083-34230105 TTCCTTGCCCAGCTCTGGGGAGG + Intronic
1066476206 10:35749616-35749638 GGCCTTGCCCAGCAGCTGAGGGG - Intergenic
1067067903 10:43113823-43113845 GCCCTGGCCCCTCTCCTGGGTGG - Intronic
1067096920 10:43307549-43307571 GCGCCTGACCTGCTCCTGGGAGG + Intergenic
1067177290 10:43959012-43959034 CCCCCTGCCCAGCTCTTGGGAGG + Intergenic
1068746203 10:60533350-60533372 CCCTCTGTCCAGCTCCTGGGAGG - Intronic
1069719982 10:70543814-70543836 CCCCTTTCCCAGCTCCCAGGAGG + Intronic
1070309451 10:75262753-75262775 GCCCCTGCCCAGGGCCTGCGAGG - Intergenic
1070668446 10:78361656-78361678 GCTCTTGCCCAGTTGCTGAGAGG + Intergenic
1070689718 10:78515590-78515612 GCCCTTTACCAGCTCCTGCAGGG - Intergenic
1072736737 10:97884194-97884216 GCCTTTGCCCACCTCCAGTGGGG + Exonic
1073218367 10:101849541-101849563 GCCCTTGCACAGCTCCAGCTGGG - Intronic
1073261401 10:102193290-102193312 GCCCTCCCCCAGCTCCTCGTTGG + Intergenic
1073453960 10:103625499-103625521 GCCCTTGCCCCCACCCTGGGAGG - Intronic
1073816991 10:107218440-107218462 GTTGTTGCCCAGCTGCTGGGAGG + Intergenic
1074111586 10:110426611-110426633 GCCCTGACCCATCTCCAGGGTGG - Intergenic
1074224111 10:111466923-111466945 GACATTGCCCAGATCCTAGGAGG + Intergenic
1074585842 10:114767750-114767772 GCCCTTCCACAGCTCCCGGCAGG + Intergenic
1074885090 10:117686926-117686948 GTCATTGCCCAGGTCCTGGTTGG - Intergenic
1075163067 10:120041709-120041731 GCCCTCGCCTAGCTCCTGGGAGG + Intergenic
1075859345 10:125661470-125661492 GCCCTGGCCCAAGGCCTGGGGGG + Intronic
1076443250 10:130494995-130495017 GTCCTGGCCCAGCACCTAGGAGG - Intergenic
1076453863 10:130575886-130575908 GCCCATTTCCAGGTCCTGGGAGG + Intergenic
1076568558 10:131415750-131415772 GCCCTTCCCCAGAACCCGGGGGG + Intergenic
1076570828 10:131431941-131431963 GCCCTTCTCTAGCTCCCGGGAGG - Intergenic
1076597752 10:131636300-131636322 CCCCTTGCCCAGCTCATGGAAGG - Intergenic
1076658001 10:132037009-132037031 GCCCTGGCCCAGCACCTGCGCGG - Intergenic
1076733281 10:132448632-132448654 ACCCTTGCCCAGCCCCTGCTTGG + Exonic
1076733485 10:132449095-132449117 ACCCTTGCCCAGCCCCTGCTTGG + Exonic
1076781599 10:132727711-132727733 GCTCATGCCCAGCACCTGGAGGG - Intronic
1076806313 10:132860864-132860886 GCACAGGCCCAGCACCTGGGCGG - Exonic
1076998781 11:311781-311803 ACCCTAACCCAGCTCCTCGGTGG + Intronic
1076999962 11:317978-318000 ACCCTAACCCAGCTCCTCGGTGG - Intergenic
1077480320 11:2811569-2811591 GCCCTTGCCGAGCGTCAGGGTGG + Intronic
1077609226 11:3634189-3634211 ACTCTTGGCCAGGTCCTGGGGGG + Intergenic
1080503865 11:32893453-32893475 GCCCTCGGCCAGCTCGGGGGAGG + Intronic
1081812538 11:45922084-45922106 GCCCCTCGCCAGCTCCCGGGCGG + Intronic
1082799869 11:57406578-57406600 GGGCTTGCCCAGCTGCTGAGGGG + Intronic
1083487807 11:62994577-62994599 GCCGCTGCCCTGCTCCTGGCAGG - Exonic
1083808277 11:65087920-65087942 GACCCAGCCCGGCTCCTGGGGGG - Exonic
1083853496 11:65380801-65380823 GTCCCAGCCCAGCTTCTGGGTGG - Intronic
1084008453 11:66335148-66335170 GCCCTGGTCCAGCTCTTGAGGGG + Exonic
1084063890 11:66692551-66692573 GTCCTGGCCCAGCTCGTGGGAGG + Exonic
1084669261 11:70595686-70595708 GCCCTTCCCCAGCTGCTGGGAGG + Intronic
1084700910 11:70785598-70785620 GGCCCTGCCCAGCCCCTGGGGGG - Intronic
1084731296 11:71075411-71075433 GCGCTTGCCCAGATGGTGGGTGG - Intronic
1084876749 11:72139001-72139023 GTCCTTGTGCAGCTCCTGGCTGG - Exonic
1084881770 11:72176807-72176829 GTCCTTGTGCAGCTCCTGGCTGG - Intergenic
1084887524 11:72220910-72220932 GTCCTTGTGCAGCTCCTGGCTGG - Exonic
1085449842 11:76625186-76625208 ACCCTTGACCAGCTCCTGCCTGG + Intergenic
1088849805 11:113695460-113695482 GCCCCTGCCCAGCTTCTTGTTGG - Intronic
1089587719 11:119520754-119520776 GCCACACCCCAGCTCCTGGGGGG + Intergenic
1089637081 11:119821779-119821801 GCCTCAGCCCAGCTACTGGGTGG - Intergenic
1089701134 11:120244720-120244742 GGCAATGCCCAGCTCCAGGGGGG + Intronic
1091670946 12:2451844-2451866 GCAGTTGCCCAGCTCGTGGTTGG + Intronic
1091705554 12:2690958-2690980 GGCGTCGGCCAGCTCCTGGGTGG - Exonic
1091843666 12:3638272-3638294 CCCCTGCCCCAGCTCCTGGATGG - Exonic
1093433349 12:19108034-19108056 GCGCTGGGCCAGCTCCGGGGAGG + Intergenic
1093942358 12:25068522-25068544 CACCCTGCCAAGCTCCTGGGAGG - Intronic
1094133178 12:27097014-27097036 GGCCTTTCCCAGTTTCTGGGAGG + Intergenic
1094147324 12:27244224-27244246 GCCCTCGCCCCGCCCCCGGGAGG - Exonic
1094183000 12:27612225-27612247 GGCCTTTCCCAGTTTCTGGGAGG + Intronic
1094486427 12:30929037-30929059 TCCCTTCCAGAGCTCCTGGGAGG - Intronic
1095118551 12:38385373-38385395 GCCCTCCCCCAGCTTCTGGCCGG + Intergenic
1095155169 12:38843839-38843861 GCTATTGCCCAGCTCCTTGCAGG - Intronic
1095968174 12:47883255-47883277 CCCCATTCCCAGCTCCTGTGCGG - Intronic
1096429237 12:51529736-51529758 GCCCTTGACTGGCTCCTGGGAGG + Intergenic
1096538569 12:52290473-52290495 GCCCTTGCTCCACTCCTGAGTGG - Intronic
1096540210 12:52302891-52302913 GCCCTTGCTCCACTCCTGAGTGG + Intronic
1096602793 12:52742287-52742309 GCCCAGGTCCTGCTCCTGGGAGG - Intergenic
1096611138 12:52802607-52802629 GCCCCTGCCGTGCTCTTGGGTGG + Intergenic
1097188420 12:57208206-57208228 GCCCTTGCCCACCCCCTCAGTGG - Exonic
1099598673 12:84702476-84702498 GCCTTTCCCCATCTCCTGGGAGG - Intergenic
1101255694 12:102974429-102974451 GCAAATGCCCAGCTCATGGGTGG - Intergenic
1102683159 12:114704168-114704190 GGCCAGACCCAGCTCCTGGGGGG - Intergenic
1103316705 12:120062092-120062114 GCCCTTTCCCACCTCCTGTTTGG - Intronic
1103704900 12:122866129-122866151 GGCCTTGCCCAGCCCCTAGCAGG + Exonic
1103708559 12:122894822-122894844 AGCCTTGCCCAGCCCCTGGAAGG - Intronic
1104196465 12:126543795-126543817 GCCCTGCCCCAGCTGCTGGGAGG + Intergenic
1104527777 12:129540291-129540313 GCACTGGCACAGCTCCTGGCTGG - Intronic
1105443092 13:20431395-20431417 GCACTTGCCCAGCTTCTGCAGGG - Intronic
1105541705 13:21321592-21321614 GCCCGAGCCCAGCCCCTAGGAGG + Intergenic
1105704986 13:22963045-22963067 TCCTGTGCCCAGCTCCTGGTTGG - Intergenic
1106594137 13:31122672-31122694 CCCCTTGCCCTGCTCCAGGAGGG - Intergenic
1112254925 13:97820987-97821009 GCCCTGTGCCAGCTGCTGGGAGG - Intergenic
1113652262 13:112042332-112042354 CTCCTTTCCCTGCTCCTGGGAGG - Intergenic
1113760138 13:112840977-112840999 CTCCATGCCCAGCTCCTGGCGGG - Intronic
1114668228 14:24393981-24394003 GCCCCTGCCAAGGCCCTGGGAGG - Intergenic
1115763656 14:36600755-36600777 CCCTTTGCCCATGTCCTGGGTGG - Intergenic
1117390687 14:55259634-55259656 ACCCTTGCGCTTCTCCTGGGTGG - Intergenic
1119124966 14:72117126-72117148 GCCAGTGCCCAGGTCCTGGAGGG + Intronic
1119206087 14:72794565-72794587 GCCCTTGACCCACTTCTGGGAGG - Intronic
1120810732 14:88800925-88800947 GCCCTTGCCTATCTCCTGAATGG + Intergenic
1121274830 14:92660355-92660377 GGCCTTGCCCACATGCTGGGTGG + Intronic
1121413207 14:93762064-93762086 GCCCTGGGCCAGGGCCTGGGCGG + Intronic
1122531651 14:102431997-102432019 GCCCTTGCCCAGCTCAGGGGTGG - Exonic
1122602688 14:102929449-102929471 GCCCTGCTCCAGCCCCTGGGCGG + Exonic
1122634352 14:103123239-103123261 GCCCCTGCCCGGCTGCTGGGAGG + Intergenic
1122662903 14:103309826-103309848 GCCCTTACCCAGCTCCAGCCAGG + Intergenic
1122693929 14:103543824-103543846 GCACGTGCCCAGTGCCTGGGAGG - Intergenic
1122759551 14:104012301-104012323 GCCCTGGCCCAGCTCCTGAAAGG - Intronic
1122919598 14:104874585-104874607 ACCCCTGCCCACTTCCTGGGGGG + Intronic
1123004125 14:105313386-105313408 GACCTTGGCCAGCTGCTCGGCGG - Exonic
1123027461 14:105433495-105433517 ACCCTTGACCTGCTCCTAGGAGG - Intronic
1123989548 15:25673246-25673268 GCCCCTGCCCAGCGCATAGGGGG - Intergenic
1124572434 15:30877206-30877228 TCCCTTGCCTGGCTCCTGGAAGG + Intergenic
1124650319 15:31469312-31469334 GCCCCCGTCCAGCACCTGGGAGG + Intergenic
1124971898 15:34496318-34496340 ACACGTGCCCAGCTCCTGGGGGG - Intergenic
1125730806 15:41891956-41891978 ACCCTTCCCCAGTTCCTGGAGGG + Intronic
1126634124 15:50765420-50765442 GGCCCCGCCCAGCCCCTGGGAGG + Intronic
1126849766 15:52789796-52789818 GCCCCTGCCGACCTGCTGGGCGG - Exonic
1129460998 15:75700030-75700052 GCCCTAGCAGGGCTCCTGGGAGG + Intronic
1130275217 15:82472784-82472806 GGCAGGGCCCAGCTCCTGGGCGG + Intergenic
1130467578 15:84200179-84200201 GGCAGGGCCCAGCTCCTGGGCGG + Intergenic
1130496687 15:84473363-84473385 GGCAGGGCCCAGCTCCTGGGCGG - Intergenic
1130589870 15:85204777-85204799 GGCAGGGCCCAGCTCCTGGGCGG + Intergenic
1130955807 15:88626521-88626543 GCCCTTGCCCAGCAAGTGTGTGG + Exonic
1131012497 15:89030576-89030598 GTCCTTGCCCAACTACAGGGTGG - Intergenic
1131843917 15:96468848-96468870 GCCCATGACCATCACCTGGGTGG + Intergenic
1132765436 16:1532100-1532122 GCCTGTGCCCTGCTCCTCGGAGG - Intronic
1134079119 16:11312878-11312900 TCCAGTGCCCAGATCCTGGGTGG - Intronic
1134090893 16:11391167-11391189 GGCCCTGCCCAGCGCCAGGGTGG - Intronic
1134190780 16:12119681-12119703 GGCCCAGCCCGGCTCCTGGGAGG - Intronic
1136228996 16:28876200-28876222 GCCCTTCTGCAGCTCCTGGCGGG + Intergenic
1136612061 16:31372275-31372297 GCCTCTGCCCAGCTCCCGCGCGG - Intronic
1137581038 16:49633719-49633741 GCCCATGCTCAGCCCCTGGAGGG + Intronic
1137825327 16:51489748-51489770 GCCCAGGCCTTGCTCCTGGGAGG + Intergenic
1137869497 16:51936007-51936029 GCCCTAGCCGAGCTCCTTGCTGG + Intergenic
1138573456 16:57891025-57891047 GCCTCTGCACAGCTCTTGGGAGG + Intronic
1138591433 16:58001382-58001404 GCCCAGGCCCCGCCCCTGGGAGG + Exonic
1138657093 16:58497825-58497847 ACCCCTGCCCAGGTCCTGGCAGG - Intronic
1138657279 16:58498715-58498737 ACCCTTGCCCAGGCCCTGGCAGG + Intronic
1139666706 16:68462401-68462423 GCCCTTGCTCAGGTCCTAGCAGG + Intergenic
1139741447 16:69038617-69038639 ACCCTTGCCTGGCTCCTGGTAGG - Intronic
1139910437 16:70394330-70394352 CTCCTTGCCCAGCTGCTGAGGGG + Intronic
1141247113 16:82318262-82318284 GTCCTTGCCCAGTTCCTGGGAGG + Intergenic
1141850004 16:86638714-86638736 GCCCTGGCTCTGCTCCTGTGTGG + Intergenic
1142206046 16:88783874-88783896 GCCCTTGCCTCGCTCCAGGTGGG - Intronic
1142243890 16:88959658-88959680 CGCCTTTCCCAGCTGCTGGGAGG - Intronic
1142414811 16:89935569-89935591 GCGCTTGAACAGCTCCTGGATGG - Exonic
1142711893 17:1728009-1728031 GTCCTTGCTCTCCTCCTGGGAGG - Exonic
1142848115 17:2691884-2691906 GTCCTCGCCCAGCTGCGGGGAGG + Exonic
1143573879 17:7778363-7778385 GGCCTTGCCCAGGTCCTTGACGG - Exonic
1144250421 17:13410983-13411005 GCTCTTCCCCAGCTGCTGGTAGG + Intergenic
1144578320 17:16443711-16443733 GCCCTCACCCAGCTCCAGGATGG + Exonic
1145977579 17:28993181-28993203 GCCCTGGCCACACTCCTGGGAGG - Intronic
1147000393 17:37358658-37358680 CCTCTTGCCCAGCTCCAGCGTGG - Intronic
1147218754 17:38915833-38915855 ACCCTTACCAAGCTCCTGGCAGG + Intronic
1147376171 17:40023561-40023583 GCCCCTGCTCTGCTCCTGGCAGG + Intronic
1148153260 17:45408935-45408957 GCATTGGCCCAGCTGCTGGGGGG - Intronic
1148534942 17:48430863-48430885 TCCCTTCCGCAGCTCCTGGAGGG - Intergenic
1148753428 17:49959332-49959354 GCCCTCTCCCACCTCCAGGGAGG - Intergenic
1148804812 17:50258827-50258849 GCCCCTGAGCAGCTCCTGGGTGG + Intergenic
1149006413 17:51810780-51810802 GTCCCAGCCCAGCTCCTGGAGGG - Intronic
1151441330 17:74131123-74131145 CCCCTCACCCAGCTCCTGAGAGG + Intergenic
1151574792 17:74947348-74947370 GCCCTGGCCCAGCTCCAGCAAGG - Exonic
1152391696 17:80007500-80007522 GTCCGTCCCCAGCTGCTGGGAGG - Intronic
1152528548 17:80903396-80903418 GGCACTGCCCGGCTCCTGGGAGG + Intronic
1152548987 17:81019921-81019943 GCCTTTTCCCAGGTCCGGGGTGG + Intergenic
1152730461 17:81967353-81967375 GCTCTCGCCCAGGTCCTTGGAGG + Intergenic
1153390415 18:4551762-4551784 TTCCATGCCCAGTTCCTGGGAGG + Intergenic
1153636671 18:7118168-7118190 CCTCTCGCCCAGCTCCTGGCAGG - Intergenic
1154204559 18:12325907-12325929 GCGCTTGAACAGCTCCTGGATGG - Exonic
1156361261 18:36386648-36386670 GCCCATGCCAGGCTCCTGGAGGG + Intronic
1157595990 18:48863881-48863903 GCCTTCACCCGGCTCCTGGGAGG - Intergenic
1157623116 18:49027297-49027319 GCCCCAGCCCAGCTCCTGAAGGG - Intergenic
1158508655 18:58069905-58069927 GCCCCTGACCACCTCCTTGGTGG + Intronic
1159956753 18:74524148-74524170 GCCATCACTCAGCTCCTGGGAGG + Intergenic
1160236695 18:77091494-77091516 GCCCTAGCTCTGCACCTGGGTGG - Intronic
1160501513 18:79403410-79403432 GCCCGGGGCCTGCTCCTGGGTGG - Intronic
1160501896 18:79405657-79405679 TCCCTCGCCCAGGTCCTTGGAGG - Intronic
1160707225 19:535314-535336 GCCCTGGCCCAGGCCGTGGGAGG - Intronic
1160817464 19:1042781-1042803 GCCCTTGCACAGCTTGTTGGAGG + Exonic
1160838633 19:1136492-1136514 GCACCTGCCCAGGCCCTGGGCGG + Intronic
1160992346 19:1864858-1864880 GCCCCTTCCCAGCTCCGGCGGGG + Intergenic
1161271614 19:3392750-3392772 GCCCTCGCCCAGCTGGAGGGAGG - Intronic
1161372500 19:3921021-3921043 GTCCTTGCACAACTCCAGGGGGG + Intronic
1161431083 19:4232951-4232973 GCCCATGCCCTGCCCCCGGGGGG + Intronic
1161717094 19:5882284-5882306 GCCCCAGGCCAGCTCCTTGGTGG - Intronic
1161769272 19:6222523-6222545 GCCCTCGCCCAGCTTCCGCGAGG + Exonic
1161815159 19:6495359-6495381 GCGCTTGAACAGCTCCTGGATGG + Exonic
1162028693 19:7908302-7908324 GCCCTTCCCCTGCTCCTGCCTGG + Intronic
1162332408 19:10038447-10038469 GCCCTGGGACAGATCCTGGGAGG - Intergenic
1162731458 19:12721331-12721353 GCCCTCGCCCAGCCGCTGCGAGG - Intronic
1162795259 19:13083775-13083797 GCCCACGCCCGGCTTCTGGGAGG + Intronic
1162936326 19:13983451-13983473 GCCCTCCCCCACCCCCTGGGAGG + Intronic
1163074491 19:14877234-14877256 AGCATTGCCCTGCTCCTGGGAGG + Intergenic
1163388602 19:17015739-17015761 ATCCTTGCCCTGCTCTTGGGTGG - Intronic
1163643710 19:18476398-18476420 GCCCTGGCACAGTTCCTTGGGGG - Intronic
1163765802 19:19162653-19162675 TCCCTGGGCCTGCTCCTGGGAGG + Intronic
1163822931 19:19506447-19506469 ACCCTGGCCTTGCTCCTGGGAGG + Exonic
1165360192 19:35331722-35331744 GCCTTTACCCAGCTACTTGGGGG + Intronic
1165389318 19:35529350-35529372 GCCCTTGCCCAAGGGCTGGGAGG - Intergenic
1165407896 19:35642071-35642093 CCCCTTGCCCAGGCCCTTGGGGG + Exonic
1165591423 19:36972998-36973020 GTGTTTGCCCAGTTCCTGGGAGG + Intronic
1165941571 19:39417082-39417104 GGCCTTGCCCAACTCGTGGGGGG - Intronic
1165952282 19:39481092-39481114 GCCCTTCCCAACCTCCTGGGTGG + Intronic
1165958319 19:39515588-39515610 GCCCCAGCCCAGCTCCTGGCAGG + Exonic
1167071904 19:47226689-47226711 GCCCGTGCCCAGCGCCCCGGGGG - Exonic
1167242904 19:48355729-48355751 GCCCTGGACCAGCTTCTGGGAGG + Intronic
1167423812 19:49419217-49419239 CCCCTTCCCCAGCTCCCAGGGGG + Intergenic
1167567255 19:50264478-50264500 GCCCTTGATGGGCTCCTGGGAGG - Intronic
1167622670 19:50568096-50568118 CCCCCTCCCCGGCTCCTGGGTGG + Intergenic
1167632702 19:50635519-50635541 GCCCTTGATCAGCTCCCGGGAGG + Intronic
925656269 2:6152863-6152885 GCCCTCTCCCACTTCCTGGGTGG - Intergenic
925905274 2:8536367-8536389 GGGCTTGCCCAGGTCCTGGCTGG - Intergenic
927423663 2:22957686-22957708 CCCCTTGCCCAGCTCCAAGCAGG - Intergenic
928201886 2:29252596-29252618 GCCCTGGCCCAGAGGCTGGGAGG + Intronic
928396710 2:30948302-30948324 GCCCTTGCCCAGCTCCTGGGAGG + Intronic
928898915 2:36296994-36297016 GCCCGTGCCCTCATCCTGGGGGG + Intergenic
929111186 2:38406481-38406503 GCCCTTTCCGAGGCCCTGGGAGG + Intergenic
930621263 2:53646269-53646291 GCACTTACTCAGTTCCTGGGTGG - Intronic
930720196 2:54630986-54631008 GTCATTGCCCAGGTCCTGGGTGG - Exonic
933731363 2:85458692-85458714 GAGCCTACCCAGCTCCTGGGTGG - Intergenic
934566763 2:95345879-95345901 GCCCTTGCCCTGCCCGTGCGTGG + Intronic
934674384 2:96239400-96239422 GCTCTGCCCCAGCTGCTGGGAGG + Intergenic
936008472 2:108910001-108910023 GCCCTAGCCCAGCACTTGGTGGG + Intronic
936096383 2:109533250-109533272 GCACTTGCCCTGCTGCTGGATGG + Intergenic
937233411 2:120415942-120415964 GCCTCTGCCCACCTCCTGGGAGG + Intergenic
938117759 2:128613382-128613404 GCCCTTTCCTGGCTCCTGAGGGG + Intergenic
938154532 2:128921874-128921896 GCACTTGACTGGCTCCTGGGAGG + Intergenic
938368959 2:130756693-130756715 GTCCTGGCCCACCTCCTTGGAGG - Intronic
939188060 2:138883577-138883599 GCCTTTTCCCTGCTCCTAGGAGG + Intergenic
941621340 2:167782662-167782684 CACCCTTCCCAGCTCCTGGGGGG + Intergenic
941709944 2:168701374-168701396 GCCCTTGCACACCTCCTGAAAGG - Intronic
941815051 2:169787982-169788004 GCCCTTTCCAAGGACCTGGGAGG - Intergenic
941905944 2:170716275-170716297 GTGCTTGCCCAGGTCCGGGGAGG - Exonic
942655674 2:178211772-178211794 GCCCTTTCCCTTCTCCTTGGAGG + Intronic
945185004 2:207131389-207131411 CCCCTTGCCTTTCTCCTGGGAGG + Intronic
946225228 2:218260959-218260981 GCCCTGGCCCCGCCTCTGGGAGG - Intronic
946307537 2:218864875-218864897 GCCCCTGCTGAGCTCCAGGGTGG + Intronic
946397747 2:219451754-219451776 GGCCTGGCCCAGCTCGTTGGTGG - Exonic
948053132 2:234993032-234993054 GGCCTTGCCCACAGCCTGGGAGG + Intronic
948515843 2:238503481-238503503 GCCCTCACTCAGCCCCTGGGCGG - Intergenic
948553057 2:238787661-238787683 GCCCAGTCCCAGCTCCTAGGCGG + Intergenic
1169130660 20:3164946-3164968 GCCTTCGCCCAGCTCCAGGCTGG + Exonic
1169216518 20:3797382-3797404 CACCTTGCCCTGCTCCTGAGAGG + Intronic
1171135252 20:22689514-22689536 GCCCTGGCACAGCTCCTGGAAGG - Intergenic
1171184142 20:23112764-23112786 GGCCTTGCCCAGGTCCTTGGAGG + Intergenic
1171334440 20:24370825-24370847 GCCCTGGGCCAGCTGCTGGGTGG - Intergenic
1171856622 20:30350272-30350294 GCCCTTGCAGAGCCCCTGGAAGG - Intergenic
1172090694 20:32430011-32430033 GACCCTGCCCCGCTCCTGAGAGG + Exonic
1172628271 20:36361028-36361050 CCCCATGCCCAGCTCCCAGGTGG - Intronic
1172903984 20:38355432-38355454 GCCCTCGCCAAGCTCGGGGGAGG - Intronic
1173810636 20:45953092-45953114 GCCCTTGGCCAGCACCTGGGCGG - Intronic
1173883977 20:46440523-46440545 GCCCTCGCCCTGCACCTGGATGG - Intergenic
1174713144 20:52728309-52728331 AGCCTTGGCCAGCTCCAGGGAGG + Intergenic
1175366818 20:58461451-58461473 GCCCTGCCCCTGCACCTGGGCGG - Exonic
1175676663 20:60951986-60952008 TCCTATGCCCAGCTCCTAGGAGG + Intergenic
1175900096 20:62356643-62356665 GCTCTTGCCCACCCCCTGTGAGG - Intronic
1175914191 20:62418198-62418220 GGGCTTGCCCCGCCCCTGGGAGG + Intronic
1176024511 20:62978853-62978875 GCCCGTGCCCAGCTCCGGAGGGG - Intergenic
1176085119 20:63292439-63292461 GCCCTTGCCCAATGACTGGGTGG - Intergenic
1177011115 21:15730564-15730586 GCCCCTGCCCATCGCCTCGGGGG + Intronic
1178489081 21:33036480-33036502 CCCCATGCCCAGCTCCCAGGAGG - Intergenic
1178492180 21:33059712-33059734 GCCCCTGCCCAACTCCTGTTGGG + Intergenic
1179655320 21:42841359-42841381 GCCATTCCCAAGGTCCTGGGGGG + Intergenic
1179972829 21:44845832-44845854 GCCCTCACCCAGGGCCTGGGTGG - Intergenic
1180073787 21:45451516-45451538 GCTCTTCCCCAGCTCCTCGCTGG + Intronic
1181515644 22:23410237-23410259 GGCCTTGCCTGGCTCCAGGGAGG - Intergenic
1181749048 22:24976363-24976385 GTCCCTGCTCAGCTCCTGGCTGG - Intronic
1182353218 22:29710482-29710504 GTCCTTCCCCACCTGCTGGGTGG + Intergenic
1182500230 22:30741316-30741338 GGCCTTGGCCAGCTCCAGGGCGG - Exonic
1183073182 22:35410538-35410560 GCCCATGCTCAGCTGCTTGGAGG - Intronic
1183923947 22:41192157-41192179 ACCCTTGTCCAGCTCCTGAGTGG - Intergenic
1184341687 22:43889664-43889686 GCCCTCCCCCTGCTCCTGGGGGG - Intronic
1184408581 22:44313738-44313760 GCCCTTGGCTGGCTTCTGGGTGG + Intergenic
1184617230 22:45646257-45646279 TGCCTTGCCCCGCACCTGGGAGG - Intergenic
1184718775 22:46297023-46297045 GCCCAGGCCCGGCTCCTGGCGGG - Intronic
1184748294 22:46469342-46469364 GCCTTTGCGCATCTCCTGGCTGG + Intronic
1184807169 22:46802761-46802783 GTCCTTGGGCAGCTCATGGGAGG + Intronic
1184867488 22:47209650-47209672 GCCCCTGCCCAGGCCCTGGATGG - Intergenic
1184973276 22:48043085-48043107 TGCCTTGCCCAGCTGCTGGCAGG + Intergenic
1185002360 22:48253685-48253707 CCCCTTTCCCAACTCCAGGGAGG + Intergenic
1185130370 22:49035429-49035451 GGCCTTTCCCTGCTCCTGAGTGG + Intergenic
1185399775 22:50609798-50609820 CCCCTTGCCCAGCTCCGAGGTGG - Intronic
950580451 3:13858523-13858545 GCCCTTCCCCACCTCAGGGGTGG - Intronic
950826690 3:15830689-15830711 GCCCTTGCTCAGCTCCTAGGAGG + Intronic
950950420 3:16992710-16992732 GTCCTTGCCCAGCCCTTGGCTGG - Intronic
950950674 3:16995111-16995133 GTCCTTGCCCAGCCCTTGGCTGG - Intronic
951436867 3:22675778-22675800 CCCCTTACCCAGCTCCAGGCAGG - Intergenic
951608907 3:24469373-24469395 GTGTTTTCCCAGCTCCTGGGTGG - Intronic
953078486 3:39593570-39593592 GACCTTGCCCGGACCCTGGGAGG + Intergenic
954304757 3:49719716-49719738 GCCCGGGCCCCGCCCCTGGGGGG - Intronic
954415495 3:50391348-50391370 GCCCTGGCCCAGCTCCTCCCTGG + Intronic
954456987 3:50604991-50605013 CCCCATGCCCAGCACCTGGCAGG + Intergenic
954671115 3:52291869-52291891 GCCCTGTCCCAGCTCAAGGGTGG + Exonic
954693178 3:52406639-52406661 GCCTGTGGCCTGCTCCTGGGTGG - Intronic
954876075 3:53803957-53803979 GACCTGGCCCAGCTCCAGGCTGG - Intronic
955224379 3:57049079-57049101 CACCGTGCCCGGCTCCTGGGAGG - Intronic
961370171 3:126423927-126423949 GCTGCTGCCAAGCTCCTGGGAGG + Intronic
961609201 3:128123402-128123424 CCCCTCACCCAGCTCCAGGGCGG + Intronic
962400854 3:135057568-135057590 TCCCTTGCCCCGCTCCTCAGAGG + Intronic
963939622 3:151086065-151086087 CCCCTTCCCCAGCCCCTGGAGGG + Intronic
964570756 3:158105725-158105747 GCCCATGTCCAGCTCCCGGACGG + Exonic
968522430 4:1040014-1040036 GCCCAAGCCCAGGTCCAGGGAGG + Intergenic
968954189 4:3709907-3709929 GCCCTGGCCCAGGTCCTCGGTGG - Intergenic
968966003 4:3769417-3769439 ACCCCTGCCCAGCTCCTGCCAGG - Intergenic
969251854 4:5973484-5973506 GCCCATGCCCATGCCCTGGGTGG - Intronic
970545853 4:17129358-17129380 GCCCTTGACCAGCTCCGGAGGGG - Intergenic
972043868 4:34639382-34639404 GTCCTTGCCCCACTCCAGGGTGG - Intergenic
974043168 4:56875517-56875539 GCCCCTGCCAAGCTCATGGCTGG + Intergenic
980838082 4:138222209-138222231 TCCCTTTCCCAGCTCCAGAGTGG + Intronic
981288436 4:143046635-143046657 GCCGTTGCCCAGTTCCTCAGAGG + Intergenic
982158162 4:152540993-152541015 GCCCTGGTCCTGCACCTGGGAGG + Intergenic
984854435 4:184181929-184181951 GCCCATGCCTATGTCCTGGGTGG - Intronic
985544934 5:504753-504775 GTTCGTGCCCAGCTCCTGGCCGG + Intronic
985660196 5:1153207-1153229 GGGCTTGCCCAGTCCCTGGGCGG + Intergenic
985672509 5:1213744-1213766 GGCCTGGGGCAGCTCCTGGGAGG + Intronic
985945356 5:3177965-3177987 GCCCCTGCCCTTCTCCTGCGAGG + Intergenic
986307431 5:6525946-6525968 GCCCCTGGCCAGCTGCTGTGGGG - Intergenic
988812411 5:34798660-34798682 GCCCTAACCCAGTTCCTGAGAGG + Intronic
989605086 5:43236572-43236594 GCCCTTGCTCAGCTCCAGCCAGG - Intronic
990610669 5:57453891-57453913 GGCCTTGCCCAGACCCTGGCTGG + Intergenic
990760791 5:59127340-59127362 GCCTCTGTCCAGCACCTGGGTGG + Intronic
992619014 5:78574288-78574310 GCCTTTGCCCTGCTGCTGGAGGG - Intronic
993570114 5:89526398-89526420 TCCCTTGCTCTGCTCCTGGTGGG - Intergenic
994641788 5:102419976-102419998 GCACTTGGCCAGCTTCTGGGAGG - Exonic
994802670 5:104398836-104398858 GCCCATGCCCATGTCCTGAGTGG - Intergenic
995305328 5:110640021-110640043 GCCCTTGCCCAACCCGAGGGGGG - Intronic
997516533 5:134493814-134493836 GCCCTTACCCAGCCACTGGGAGG + Intergenic
999238735 5:150115290-150115312 TCTCTTCCCTAGCTCCTGGGTGG + Exonic
999265018 5:150261184-150261206 CCCCTTGCCCAGCTGCTCAGAGG - Intronic
999508614 5:152224239-152224261 GCTCTTGCCCAGCCCCATGGAGG - Intergenic
1001889584 5:175327909-175327931 GCCCTTTCCTATCTCCAGGGTGG + Intergenic
1002103918 5:176870579-176870601 GGCCTTGCCCAGCCCTGGGGAGG + Intronic
1002183322 5:177442527-177442549 GCCCAAGCCCAGCCCCTAGGAGG + Exonic
1002194857 5:177496318-177496340 GCCCCTGACCAGCTCCTGTTAGG + Intronic
1002860656 6:1076690-1076712 GCCCTCCCACAGCTCATGGGAGG + Intergenic
1003097440 6:3154061-3154083 GCGCTTGAACAGCTCCTGGATGG + Exonic
1003106980 6:3224949-3224971 GCGCTTGAACAGCTCCTGGATGG + Exonic
1004128677 6:12898638-12898660 CACCTTGGCCAGCTCCTGGCAGG + Intronic
1004306396 6:14505493-14505515 CCCTTTGCCCTGGTCCTGGGAGG + Intergenic
1006591762 6:35163191-35163213 CAACTTGCCCAGCTCCAGGGGGG + Intergenic
1006919195 6:37616327-37616349 GCCCCTGCCCATCTCCAGGCAGG + Intergenic
1007619595 6:43203916-43203938 GGTCTTGCCCAGTGCCTGGGCGG - Exonic
1007747758 6:44053548-44053570 GCTCTGGCCCAGCTCCCTGGTGG - Intergenic
1007781117 6:44255354-44255376 GGCCTTGGCCAGCACCTGGGTGG + Exonic
1008536843 6:52512659-52512681 GGCCTTGCTTAGCTCATGGGTGG - Intronic
1009027449 6:58016875-58016897 GCCCTTGACAGACTCCTGGGTGG - Intergenic
1009202984 6:60768358-60768380 GCCCTTGACAGACTCCTGGGTGG - Intergenic
1011295936 6:85826763-85826785 GCCCTGGGACAGTTCCTGGGAGG - Intergenic
1013742178 6:113300299-113300321 GCCCTTACCTAGCTCCTGGGAGG + Intergenic
1016305097 6:142675742-142675764 GCCCTTGATCTGCTGCTGGGTGG - Intergenic
1016428096 6:143955658-143955680 CCCATTGCCCAGCTCCCTGGTGG - Intronic
1016974579 6:149794721-149794743 GCCTTTGCCCTGATCCTGTGTGG + Intronic
1017457569 6:154615799-154615821 AACCGTGCTCAGCTCCTGGGAGG + Intergenic
1018901584 6:168054378-168054400 GTCCTTGGCCTGCTCCTTGGGGG + Intergenic
1019294441 7:266499-266521 GCCCTTCCCCACCTCCTGGGGGG + Intergenic
1019398354 7:835843-835865 GCCCATGCTCAGATCCAGGGGGG + Intronic
1020086286 7:5312593-5312615 CCGCTTGGCCAGCTCCTTGGTGG + Exonic
1024534409 7:50418301-50418323 GGCCTAGCCCAGCTCCTCGTGGG + Intergenic
1024628064 7:51225391-51225413 GACCTTGCCCGGCTCCTGCTGGG + Intronic
1025206520 7:56996277-56996299 AGCCGTGCCCAGCCCCTGGGAGG - Intergenic
1025208021 7:57004479-57004501 CCGCTTGGCCAGCTCCTTGGTGG - Intergenic
1025231345 7:57205001-57205023 GCCCTCGCCCTGCTCCTGGACGG + Intergenic
1025663932 7:63572396-63572418 CCGCTTGGCCAGCTCCTTGGTGG + Intergenic
1025665418 7:63580650-63580672 AGCCGTGCCCAGCCCCTGGGAGG + Intergenic
1026638730 7:72106221-72106243 GGCCATGCCCAGCTCCTGCTTGG + Exonic
1026896000 7:74010404-74010426 GCGTTTGCCCAGCCCCTGGGGGG - Intergenic
1026929353 7:74215328-74215350 CCCCATTCCCAGGTCCTGGGGGG + Intronic
1029283954 7:99453493-99453515 GCCCTGGCCCTCCTCCTGGTGGG + Intronic
1033099141 7:138455786-138455808 ACCCTTGACTCGCTCCTGGGGGG - Intergenic
1033949379 7:146764333-146764355 ACCTCTGCCTAGCTCCTGGGTGG + Intronic
1034383757 7:150720833-150720855 GGCCTGGCCCTGCTGCTGGGGGG + Exonic
1035553530 8:546324-546346 GCCCGTGCCCAAGGCCTGGGGGG + Intergenic
1035920917 8:3675267-3675289 GCCATTCCCCTGCTCCTGGAGGG + Intronic
1036776044 8:11613714-11613736 GCCCTGGCCCGGACCCTGGGCGG - Intergenic
1037662620 8:20940637-20940659 GCCCTTGCTGGGCTCCTGGCAGG + Intergenic
1038362728 8:26898567-26898589 GCCCATGCCCAGCTCCCTGCAGG + Intergenic
1039080701 8:33731552-33731574 TCCCTTGCCCTGCTCCTTGCAGG - Intergenic
1039583634 8:38687071-38687093 GCCCTGGGCCAGCTTCTGAGGGG - Intergenic
1039820413 8:41129598-41129620 GCCTCTGCACTGCTCCTGGGTGG - Intergenic
1041547454 8:59061827-59061849 GCCCATGCCCAGCCCCTGCCAGG + Intronic
1042039506 8:64577455-64577477 ATCCTTGCCCAGCTTCTTGGCGG + Intergenic
1042813008 8:72846330-72846352 GCCCATGCCTATGTCCTGGGTGG - Intronic
1044999713 8:97869054-97869076 GCCCTTGCCCAGCGCCTCCCAGG + Intronic
1045961928 8:107978599-107978621 GCCCTTGCCTATGTCCTGAGTGG - Intronic
1047392559 8:124465264-124465286 GCCTTTGCCCAGCTCATGATGGG - Intergenic
1048307626 8:133295273-133295295 CCCCTGGCCCAGCGCCTGGCAGG - Intronic
1048465088 8:134658986-134659008 GCCCTCGCCCAGCAGCTGGACGG + Intronic
1049142872 8:140973210-140973232 CCCTTTGCCCAGATCCTGGGAGG + Intronic
1049170863 8:141159850-141159872 GCCTTTGGCCATCTCCTGGTGGG + Intronic
1049198979 8:141330736-141330758 GCCTTAGCTCAGCTCCAGGGAGG + Intergenic
1049206648 8:141366711-141366733 GCCCTGCCCCAGCTGCGGGGTGG + Intronic
1049349703 8:142157924-142157946 TCCCCTGCCCAGGCCCTGGGAGG - Intergenic
1049509167 8:143019010-143019032 GACCTTGCAGAGCTCCTGGCCGG + Exonic
1049696596 8:143986914-143986936 GCCCATGCTCAGCACCTGGCAGG - Intronic
1056179913 9:84072727-84072749 GCCTTTGACCAGCTTCTGGGAGG + Intergenic
1056267902 9:84917865-84917887 GCCTCTGCCCACCTCCTGGGAGG + Intronic
1057820665 9:98328114-98328136 GCCTTGGACCAGGTCCTGGGAGG - Intronic
1059386048 9:113965418-113965440 AGCCTTGCCCAGGTCCTGAGGGG + Intronic
1059539807 9:115118756-115118778 AGCCTTGCCCAGCTGCTGGGAGG + Intergenic
1060231239 9:121827027-121827049 GGCCTTGCCCAGCACCTGCAGGG - Intronic
1060529836 9:124341682-124341704 TCCACAGCCCAGCTCCTGGGTGG + Intronic
1060587430 9:124795248-124795270 TCCCTCCCCCAGCTCCTGGCTGG - Intronic
1060597003 9:124854398-124854420 ACCCGTGCCCAGCTCATCGGAGG - Intronic
1060822809 9:126671373-126671395 GCCCGGGCCCAGCTGCTGGGAGG - Intronic
1060838698 9:126777693-126777715 GCCCTCCCCCAGCTCCCAGGAGG - Intergenic
1061824441 9:133248963-133248985 GCCCTTCCGCAGCTCCTGGGGGG + Intergenic
1062017686 9:134299453-134299475 GCCCTGGCTCAGCCCCTGGAAGG + Intergenic
1062044976 9:134420788-134420810 GCCCCTCCTCAGCTCCTGGCAGG - Intronic
1062047016 9:134429033-134429055 CCCCTTCCCCAGCCCCTGGTGGG - Intronic
1062052493 9:134454825-134454847 GCTCTGGCCTAGCTCCTGGGAGG + Intergenic
1062099115 9:134718858-134718880 GACCTTGCCTTCCTCCTGGGGGG + Intronic
1062193140 9:135257818-135257840 GGCCTGGCCCATCCCCTGGGAGG - Intergenic
1062314063 9:135956922-135956944 GCCCCGGCCCAGCTCCAGGCTGG - Intronic
1062472901 9:136714003-136714025 GCCCCAGCCCAGGTCCTGGATGG + Intronic
1062511247 9:136907355-136907377 GCCTCTGCCCAGCTCCTGGGTGG + Intronic
1062584560 9:137243336-137243358 GCGCTTGAACAGCTCCTGGATGG - Exonic
1185511042 X:665449-665471 GACCTTCTCCAGATCCTGGGTGG + Intergenic
1186518329 X:10183952-10183974 TCCCTTGTCCAGCTCCAGGGTGG + Intronic
1188190623 X:27167824-27167846 GCCCTTGATCTGCTCCTGGCAGG + Intergenic
1189259723 X:39669789-39669811 CCTCTTCCCCTGCTCCTGGGTGG - Intergenic
1192406967 X:70895941-70895963 GCCCATGCCCATGTCCTGAGTGG - Intronic
1192812315 X:74558333-74558355 GCACTGGGTCAGCTCCTGGGTGG - Intergenic
1196647015 X:118128811-118128833 GCGCTTGAACAGCTCCTGGATGG - Intergenic
1196836840 X:119821237-119821259 GACATTGCTCAGCTTCTGGGAGG - Intergenic
1196883757 X:120223822-120223844 GCCCGTGTCCTGCACCTGGGAGG + Intergenic
1197279685 X:124520625-124520647 GCCCTTCCACAGCTACTGTGAGG + Exonic
1197396733 X:125936817-125936839 GCCCATGCCTACGTCCTGGGTGG + Intergenic
1198024979 X:132696068-132696090 GCACTTGCCCAGCTTCCTGGAGG - Intronic
1198450743 X:136765145-136765167 GCCCTTGCAACACTCCTGGGAGG - Intronic
1198654562 X:138899415-138899437 GACCTTACCCAGCACCTGGAAGG - Intronic
1200121688 X:153794126-153794148 GCCCTTTCCCCGCCCCTGGTGGG + Exonic
1201245300 Y:11997420-11997442 TGCCTCTCCCAGCTCCTGGGGGG - Intergenic
1201746639 Y:17381861-17381883 GCACATGCTCAGCTTCTGGGCGG + Intergenic
1201895949 Y:18993017-18993039 GCGGCTCCCCAGCTCCTGGGAGG - Intergenic
1202248829 Y:22848307-22848329 GCCCTTGCCTAGGTCCTGAATGG + Intergenic
1202401818 Y:24482055-24482077 GCCCTTGCCTAGGTCCTGAATGG + Intergenic
1202468964 Y:25188028-25188050 GCCCTTGCCTAGGTCCTGAATGG - Intergenic