ID: 928398301

View in Genome Browser
Species Human (GRCh38)
Location 2:30959984-30960006
Sequence GAGCACTACCCCTTCTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 1, 2: 2, 3: 3, 4: 85}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928398297_928398301 -2 Left 928398297 2:30959963-30959985 CCCTTCTGAGCCCTGACTGGAGA 0: 1
1: 0
2: 2
3: 28
4: 228
Right 928398301 2:30959984-30960006 GAGCACTACCCCTTCTATGCAGG 0: 1
1: 1
2: 2
3: 3
4: 85
928398298_928398301 -3 Left 928398298 2:30959964-30959986 CCTTCTGAGCCCTGACTGGAGAG 0: 1
1: 0
2: 1
3: 13
4: 270
Right 928398301 2:30959984-30960006 GAGCACTACCCCTTCTATGCAGG 0: 1
1: 1
2: 2
3: 3
4: 85
928398293_928398301 11 Left 928398293 2:30959950-30959972 CCTCCCAGGAGGACCCTTCTGAG 0: 1
1: 0
2: 3
3: 20
4: 219
Right 928398301 2:30959984-30960006 GAGCACTACCCCTTCTATGCAGG 0: 1
1: 1
2: 2
3: 3
4: 85
928398295_928398301 7 Left 928398295 2:30959954-30959976 CCAGGAGGACCCTTCTGAGCCCT 0: 1
1: 0
2: 3
3: 22
4: 217
Right 928398301 2:30959984-30960006 GAGCACTACCCCTTCTATGCAGG 0: 1
1: 1
2: 2
3: 3
4: 85
928398291_928398301 15 Left 928398291 2:30959946-30959968 CCCTCCTCCCAGGAGGACCCTTC 0: 1
1: 0
2: 2
3: 38
4: 348
Right 928398301 2:30959984-30960006 GAGCACTACCCCTTCTATGCAGG 0: 1
1: 1
2: 2
3: 3
4: 85
928398294_928398301 8 Left 928398294 2:30959953-30959975 CCCAGGAGGACCCTTCTGAGCCC 0: 1
1: 0
2: 2
3: 20
4: 193
Right 928398301 2:30959984-30960006 GAGCACTACCCCTTCTATGCAGG 0: 1
1: 1
2: 2
3: 3
4: 85
928398292_928398301 14 Left 928398292 2:30959947-30959969 CCTCCTCCCAGGAGGACCCTTCT 0: 1
1: 0
2: 2
3: 53
4: 405
Right 928398301 2:30959984-30960006 GAGCACTACCCCTTCTATGCAGG 0: 1
1: 1
2: 2
3: 3
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928398301 Original CRISPR GAGCACTACCCCTTCTATGC AGG Intronic
902848012 1:19127536-19127558 GAGGACTACCACCTCTGTGCTGG + Intronic
916425788 1:164678344-164678366 GAGGATTATGCCTTCTATGCTGG - Intronic
917050836 1:170920683-170920705 GAAAACTATCCCTTTTATGCAGG + Intergenic
918239213 1:182606990-182607012 CAGCACTACCCTTTCCATGGAGG + Intergenic
921023517 1:211258385-211258407 GAGCACAACTCCTTCCAGGCTGG + Intronic
922819223 1:228472398-228472420 GAGGACTACCCATTCTCTGGGGG + Intergenic
924492528 1:244553150-244553172 GATCATTACACTTTCTATGCAGG - Intronic
1062771653 10:105539-105561 GAGCCCTACCCCTTCCAAGTTGG - Intergenic
1072335701 10:94395963-94395985 GAGCCCCACCCCTTCTGAGCTGG - Intergenic
1074914325 10:117940873-117940895 GAGCACTAACCCTGCCATGGGGG - Intergenic
1076024674 10:127101555-127101577 GGGCACAACCCCTTCTCTGAGGG + Intronic
1076651746 10:131994334-131994356 AAGCACTACCCCTTCTATGCTGG - Intergenic
1076890369 10:133280452-133280474 GGGCACCACCCCTTCCAGGCTGG + Intronic
1080647392 11:34196979-34197001 GAGCACTAACCTTTCTAGGTGGG + Intronic
1086281975 11:85200551-85200573 GAGAACTACCCCATCTATGCAGG + Intronic
1089064600 11:115652892-115652914 GATCACTAGCCCTTCCATGCAGG - Intergenic
1093752829 12:22820087-22820109 AAGCACTGCCCCTTTCATGCTGG - Intergenic
1095628439 12:44345123-44345145 GAGCCCTACTCCTTCTCTTCTGG - Intronic
1096172097 12:49479616-49479638 GAGCCCTACCCCTTCTGAGTTGG - Intronic
1097730323 12:63121919-63121941 AAGCACTCCCCCATCTATCCAGG + Intergenic
1097996747 12:65896255-65896277 GAGCACAAGCCCTTCTTTGTTGG - Intronic
1098213989 12:68196276-68196298 GAGCACTCCCCAGTCTAGGCTGG + Intergenic
1098598000 12:72295260-72295282 GAGCCCTGCCCCTTCTGAGCTGG - Intronic
1100204553 12:92334159-92334181 GAGCACTTCCACTTCTACACTGG + Intergenic
1106257985 13:28039007-28039029 GAGCTCTACCTCCTCTATGAAGG - Intronic
1106545267 13:30725618-30725640 AAGCACTGCCCCTTCCATGATGG - Intronic
1106921809 13:34572124-34572146 GAGCACTGCCCTCTCTATACAGG - Intergenic
1108322955 13:49304601-49304623 GAGCACATCCCCTTCTACTCAGG + Intergenic
1110008048 13:70297097-70297119 GAGCACTACCCCTTCTGAGTTGG + Intergenic
1125040807 15:35185285-35185307 GATGACTACCCCTTCAATCCTGG - Intergenic
1129928371 15:79385800-79385822 GAGCTCTGCCCCTTCTAAGTTGG - Intronic
1132128387 15:99251240-99251262 GAGCGCTACTTCCTCTATGCTGG - Intergenic
1132413553 15:101604242-101604264 CCCCTCTACCCCTTCTATGCCGG + Intergenic
1135208131 16:20499715-20499737 GAGCCCCACCCCTTCTAAGTTGG + Intergenic
1135210768 16:20523985-20524007 GAGCCCCACCCCTTCTAAGTTGG - Intergenic
1136240151 16:28938562-28938584 GAGCATTACCCATGCTGTGCTGG - Intronic
1136910408 16:34140720-34140742 GAGTACTGCCCTTTCTACGCAGG - Intergenic
1139699558 16:68699402-68699424 GACGACTTCCTCTTCTATGCTGG + Exonic
1141164806 16:81653298-81653320 GAGCCCTCCCCTTTCTCTGCAGG + Intronic
1141813994 16:86396965-86396987 GAGCACTGGCCTTTCTAAGCTGG - Intergenic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1149180924 17:53935078-53935100 CAGTACTACCACTTCTATCCTGG - Intergenic
1151354432 17:73550111-73550133 GAGCACTAGACCTGCCATGCAGG - Intronic
1157716526 18:49891657-49891679 GAGCACAACCCCCTCTTGGCTGG + Intronic
1158108387 18:53911401-53911423 GAGCTCTGGCCCTGCTATGCAGG - Intergenic
1164912235 19:32022329-32022351 GAGCTCTGCCCCTCCTCTGCTGG - Intergenic
1168470227 19:56634016-56634038 GAGCACTACTACTTCTATATAGG - Intergenic
928398301 2:30959984-30960006 GAGCACTACCCCTTCTATGCAGG + Intronic
929671913 2:43882726-43882748 GAGCACAGCCCATTCTCTGCTGG + Intergenic
936535405 2:113307208-113307230 GAGCACAGCCCCTTCTTTGGGGG + Intergenic
941255977 2:163231441-163231463 GATCACTACACATTCTAGGCAGG - Intergenic
942997435 2:182280251-182280273 CAGCACTTCCTCTTTTATGCTGG + Intronic
948476221 2:238221458-238221480 GAGCCCTGCCCCTTCTGAGCTGG - Intergenic
1169481356 20:5984772-5984794 GTGCACTCCCCATTCTATGAAGG - Exonic
1172346880 20:34209230-34209252 GAGCCCTACCCCTTCCAAGTTGG + Intronic
1173145212 20:40518977-40518999 GAACACTCTCCCTTCAATGCTGG + Intergenic
1174138847 20:48398798-48398820 GAGCCCTGCCCCTTCCAAGCTGG - Intergenic
1176897667 21:14401546-14401568 GATCACAATCCCTTCTTTGCAGG + Intergenic
1183091740 22:35526963-35526985 GAGCTCTACCCACTCTTTGCTGG + Intergenic
1183859931 22:40662429-40662451 AAACCCTACCCCTTCTATGATGG - Intergenic
955395203 3:58552368-58552390 GAGCACTACCCATCCTAAACAGG + Intergenic
956462481 3:69485574-69485596 GAGCCCTACCCCTTCCAAGTTGG - Intronic
956872187 3:73428905-73428927 GAGCAAGACCCCTTCTCTGGGGG - Intronic
957208016 3:77222997-77223019 GACCTCTTCCCCTTCTATCCTGG + Intronic
967421477 3:189278077-189278099 GAGGACTTCCACTCCTATGCAGG + Intronic
970947610 4:21713523-21713545 GATCATTACACTTTCTATGCAGG - Intronic
981412159 4:144444480-144444502 GATCATTACACATTCTATGCAGG + Intergenic
990639055 5:57761875-57761897 GAGCCCTGCCCCTTCTAAGTTGG + Intergenic
990729262 5:58790551-58790573 GACCACTAGCCCTGATATGCAGG + Intronic
991341840 5:65620232-65620254 GAGCAATACAGCTTCTATGGAGG + Intronic
993495855 5:88608136-88608158 GAGCACAACCCCATTTATGAAGG - Intergenic
996470266 5:123852379-123852401 AAGAACTACCCTCTCTATGCAGG - Intergenic
1008937200 6:57004613-57004635 GAGCTCTACCCCTCCTACGTGGG + Intronic
1020761111 7:12269320-12269342 GAGCCCTGCCCCTTCCAAGCTGG + Intergenic
1027546351 7:79531871-79531893 AAGCACTACCCCTCCCATGATGG + Intergenic
1028233234 7:88330277-88330299 GAGCACTGCCCCTTCCAAGTTGG + Intergenic
1029973934 7:104815176-104815198 GAGCCCCACCCCTTCTAAGTTGG - Intronic
1030514219 7:110520077-110520099 GAGCCCTGCCCCTTCCCTGCTGG - Intergenic
1031312596 7:120217192-120217214 TAGCTCTACCCCTTCTTGGCTGG + Intergenic
1036032039 8:4984704-4984726 AAGCACAACCACTTCTATGTGGG + Intronic
1039860402 8:41452721-41452743 GAGCATTACATCTGCTATGCTGG - Intergenic
1047957999 8:129990092-129990114 GAGCACTTCCCCATCTATGAAGG + Intronic
1053531617 9:38887637-38887659 GACCACTACACAATCTATGCAGG + Intergenic
1054203841 9:62112065-62112087 GACCACTACACAATCTATGCAGG + Intergenic
1054634521 9:67476300-67476322 GACCACTACACAATCTATGCAGG - Intergenic
1055940960 9:81649260-81649282 GAGAACTACAATTTCTATGCTGG + Intronic
1062711706 9:137978353-137978375 GAGCACCACCCCTCCCATGAAGG + Intronic
1062711742 9:137978463-137978485 GAGCACTACCCCTTCCATGAAGG + Intronic
1186275225 X:7930926-7930948 GAGCACTGCCCTTTCCATGGGGG + Intergenic
1187720303 X:22143355-22143377 GATCATTACACATTCTATGCAGG + Intronic
1187999723 X:24969250-24969272 GAAGAATACCTCTTCTATGCAGG - Intronic
1197501267 X:127244563-127244585 GAGCACCACCCCTTCCAAGTTGG - Intergenic