ID: 928398813

View in Genome Browser
Species Human (GRCh38)
Location 2:30963537-30963559
Sequence TAAACACTGTTAGGGAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928398813 Original CRISPR TAAACACTGTTAGGGAGGCC TGG Intronic
900532556 1:3161871-3161893 TAAACATCTTTAGGGAAGCCTGG - Intronic
902965086 1:19995334-19995356 CAGACAGTGTTAAGGAGGCCTGG - Intergenic
903446700 1:23426937-23426959 CCAACACTGTCAGGCAGGCCAGG - Intergenic
905098083 1:35492861-35492883 TCAACACTGTATTGGAGGCCTGG + Intronic
907810933 1:57869019-57869041 TAACAAGTCTTAGGGAGGCCAGG - Intronic
908392296 1:63694645-63694667 CAAACACTGTTATAGATGCCAGG + Intergenic
909049639 1:70752772-70752794 TAATCACAGTGAGGGAGGCAAGG + Intergenic
909526333 1:76626815-76626837 TAATCACTGTTATGGAGGCTGGG - Intronic
915743011 1:158133825-158133847 CAAAAACTGGTCGGGAGGCCGGG - Intergenic
915858964 1:159422131-159422153 CAAACACTGTTAGGCTGGGCTGG + Intergenic
917713873 1:177713887-177713909 TAAACATTTTTGGGGAGTCCAGG - Intergenic
919389691 1:196966919-196966941 TAAACACTTTCTTGGAGGCCAGG + Intergenic
920824621 1:209413787-209413809 TAAAAAGCGTTAGGAAGGCCGGG - Intergenic
1064249813 10:13698262-13698284 TAAACATCATTTGGGAGGCCTGG + Intronic
1064738547 10:18409006-18409028 TAAAAAATGTTAGCGAGGCATGG - Intronic
1071802405 10:89078200-89078222 TAAACACTGTGATGGGTGCCAGG + Intergenic
1071846883 10:89529841-89529863 TTAAGACTGTAAAGGAGGCCGGG - Intronic
1071914249 10:90273227-90273249 GAGACACTGTTAGAAAGGCCAGG + Intergenic
1072117744 10:92380116-92380138 TAAACTGTGTTAGGGATGCAGGG - Intergenic
1072213484 10:93268350-93268372 TCAACACTTTCAGTGAGGCCAGG - Intergenic
1074834928 10:117281750-117281772 TAAACTCTTTTATGGAGTCCTGG + Exonic
1075014746 10:118902546-118902568 TAAATAATGTCAGGGAGGCCAGG + Intergenic
1075492038 10:122879814-122879836 TAAGCACTGGAAGAGAGGCCTGG + Intergenic
1077561014 11:3261104-3261126 TAAAGTCTGTGAGAGAGGCCGGG + Intergenic
1077566911 11:3306934-3306956 TAAAGTCTGTGAGAGAGGCCGGG + Intergenic
1078138485 11:8672518-8672540 GAAACAGTGTTAGAGAGGCTGGG + Intergenic
1078967736 11:16366246-16366268 TAAACACTGTATGGGAGAACTGG - Intronic
1080042344 11:27772084-27772106 TAAGCAAAGTTAGGGAGGCCAGG + Intergenic
1081983342 11:47284000-47284022 TAAAGACTGATATGGGGGCCGGG - Intronic
1089585985 11:119509930-119509952 TCAATAGTGTTAGGGAGGGCTGG + Intergenic
1089761068 11:120723702-120723724 TATCCACTGTGAGGAAGGCCAGG - Intronic
1090251291 11:125253741-125253763 TAAATGCTATTAGGGAAGCCAGG + Intronic
1091645542 12:2269834-2269856 AAAATACTGTTTGGGGGGCCTGG + Intronic
1093913913 12:24778807-24778829 AAGACACTGTTAGGCAGGCAGGG - Intergenic
1098059517 12:66546192-66546214 TAAAGACTGTGTGGTAGGCCAGG + Intronic
1100763882 12:97841544-97841566 TAAACACATTTGGGTAGGCCTGG - Intergenic
1101201118 12:102437215-102437237 GAGAGACTGCTAGGGAGGCCAGG - Intronic
1101793128 12:107948900-107948922 TCAACACTCTCCGGGAGGCCTGG + Intergenic
1102342197 12:112130641-112130663 TAAAAACTGTTAGTGAAGACTGG + Intronic
1103451411 12:121031893-121031915 TCAATACTCATAGGGAGGCCGGG + Intronic
1106925490 13:34608545-34608567 TCAACACTGTGAGGGGGGCCTGG - Intergenic
1115982758 14:39071936-39071958 TCAAGAATGTGAGGGAGGCCGGG + Intronic
1118150113 14:63180050-63180072 AAAACTCTGCTAGGAAGGCCTGG - Intergenic
1119153364 14:72386240-72386262 TAAATACTATTTGGGGGGCCGGG + Intronic
1119712512 14:76832601-76832623 TAAAAACTGTTGGCCAGGCCAGG - Intronic
1119832698 14:77717463-77717485 TAAGCACTGTAAGGGAGGAAAGG - Intronic
1120280394 14:82431357-82431379 CACACACTGTGAGGGGGGCCAGG - Intergenic
1121491340 14:94363517-94363539 TGAACACAGTTCAGGAGGCCCGG + Intergenic
1122680218 14:103454543-103454565 AAAACACTGTTAAAGAGGCCAGG - Intronic
1123539746 15:21276315-21276337 TAAAAACTGTTAGGAAGGAAAGG - Intergenic
1123926841 15:25122011-25122033 TAAACACTGATAGTGAGACTAGG - Intergenic
1123981386 15:25607822-25607844 TAATCACTGATAGGGACACCAGG - Intergenic
1126810110 15:52393686-52393708 TAAACACTGTAAATGAGGCCAGG - Intronic
1127626067 15:60781444-60781466 GAAACACTGGTAAGCAGGCCAGG - Intronic
1128036882 15:64534735-64534757 TAAAAACTGTTATTTAGGCCCGG + Intronic
1130319909 15:82832888-82832910 TGAAGAGTGTTACGGAGGCCTGG - Intronic
1202948055 15_KI270727v1_random:3481-3503 TAAAAACTGTTAGGAAGGAAAGG - Intergenic
1132695515 16:1200107-1200129 TAATCATGGTTAGGGAGGCACGG - Intronic
1133531576 16:6659933-6659955 TAAAGAGTATTAGGGAGGCTGGG + Intronic
1134903561 16:17960128-17960150 TAAAAACTGCTAAGTAGGCCGGG + Intergenic
1135555899 16:23436436-23436458 TAAAAACTGTTAGCTAGGCCGGG + Intronic
1135882084 16:26267762-26267784 TGAACACTGTGAGTGAGCCCTGG - Intergenic
1135915991 16:26606001-26606023 TAAACACTCACAGGAAGGCCAGG + Intergenic
1136997627 16:35201594-35201616 GAAATAGTCTTAGGGAGGCCTGG + Intergenic
1137024049 16:35455778-35455800 GAAACAGTCTCAGGGAGGCCTGG + Intergenic
1140295127 16:73702379-73702401 GAAACACTGCTGGGGAGGTCAGG - Intergenic
1140717594 16:77740459-77740481 GAAACCCTGAGAGGGAGGCCTGG - Intronic
1143407288 17:6685927-6685949 TTATCTCTGTGAGGGAGGCCAGG - Exonic
1143570069 17:7752092-7752114 AAAACACTGTTGGCCAGGCCCGG - Intronic
1144013326 17:11170829-11170851 TAACCACAGGTTGGGAGGCCTGG + Intergenic
1146624345 17:34424445-34424467 GAAACACTGTTATGGGGGCAGGG - Intergenic
1147519037 17:41150643-41150665 TACACAGTGTTAGGGAGCCTGGG - Intergenic
1147757360 17:42777893-42777915 TAAACTCTGCTAGGGCAGCCAGG - Intronic
1148625029 17:49062732-49062754 TAAACATTGGGAGGCAGGCCAGG + Intergenic
1149060626 17:52417267-52417289 TAAAGACTGTTAGGCACGCTGGG + Intergenic
1149525739 17:57354383-57354405 TAAATAGTGGTAGAGAGGCCAGG + Intronic
1149766207 17:59280738-59280760 AAAAAACAGTGAGGGAGGCCGGG + Intergenic
1150376914 17:64689076-64689098 TACACCCTGCTAGGGAGGCTTGG - Intergenic
1155374054 18:25136945-25136967 AAAACACAGGCAGGGAGGCCTGG + Intronic
1156417774 18:36915680-36915702 TAAATACTGTCAGGGATGCAGGG + Intronic
1157433947 18:47653045-47653067 GAGACACTATTAGGGAGGCAGGG + Intergenic
1162606690 19:11714401-11714423 TAAAAAAAGTCAGGGAGGCCGGG - Intergenic
1164694721 19:30234695-30234717 TAAAAAATGTAAAGGAGGCCAGG - Intronic
1165213139 19:34251376-34251398 TTAAAACTGGGAGGGAGGCCGGG + Intergenic
1165740467 19:38202290-38202312 TGAACACTGCTAAGCAGGCCGGG + Intronic
1168605849 19:57759442-57759464 TAAAGTCTGTTAGGGAAGCAAGG - Intergenic
926909355 2:17836042-17836064 TTAACACAGTGAGGAAGGCCTGG - Intergenic
926909363 2:17836098-17836120 TTAACACAGTGAGGAAGGCCTGG + Intergenic
927024403 2:19050553-19050575 TAAACACAGCTAGTGAGGTCAGG - Intergenic
927680778 2:25137595-25137617 TTAACACTGTTTTGGAGCCCAGG + Intronic
928398813 2:30963537-30963559 TAAACACTGTTAGGGAGGCCTGG + Intronic
933115845 2:78470221-78470243 TAATGACTGTTAGGGAGACAGGG - Intergenic
935216814 2:100981412-100981434 GAAACACTGTTTGGGAGGGATGG - Intronic
938089435 2:128421636-128421658 TAGACACTGTTAGGGGTGCAAGG + Intergenic
941396947 2:164984832-164984854 TAAAAACTGTTAGGAAGGAAAGG - Intergenic
942751832 2:179297032-179297054 TAAACATTTTTAATGAGGCCAGG + Intergenic
943416446 2:187611899-187611921 TAAACACTGAAAAGGAGGTCAGG - Intergenic
944652512 2:201845454-201845476 TAAACAGTGTTTGTCAGGCCAGG + Intronic
946233920 2:218310515-218310537 AAAACATTGTTATGTAGGCCGGG - Intronic
947142274 2:227030562-227030584 TCAACACTCCCAGGGAGGCCTGG + Exonic
947596290 2:231413779-231413801 TAAGCGCTGATGGGGAGGCCAGG + Intergenic
1170943202 20:20866310-20866332 AAAACACTTGGAGGGAGGCCTGG - Intergenic
1171145756 20:22780731-22780753 TCAACCCTGCTAGGGAGGTCAGG - Intergenic
1171943087 20:31349722-31349744 TAAAAACTGTTTAGGAGGTCAGG + Intergenic
1174585362 20:51604072-51604094 TAAAAAATGTTATGGAGGCCGGG - Intronic
1175906868 20:62384808-62384830 TAAAAAATGTTTGGTAGGCCAGG + Intergenic
1176186650 20:63783914-63783936 GAAACATTGTTCAGGAGGCCAGG + Intronic
1177498098 21:21914995-21915017 TAAAAACTATAAGAGAGGCCGGG + Intergenic
1178452615 21:32717509-32717531 TAAGCTTTGTTAGGGAGGGCTGG + Intronic
1178834433 21:36084568-36084590 TCAAGACTTTTTGGGAGGCCTGG - Intergenic
1178985565 21:37299824-37299846 AAAACAATGCCAGGGAGGCCGGG + Intergenic
1179829331 21:43986282-43986304 GGAACACTTTTAGGGAGCCCAGG + Exonic
1181560352 22:23696425-23696447 GAAACAGTCTCAGGGAGGCCCGG + Intronic
1181668705 22:24415575-24415597 TAAACAACTTTAGGGAGCCCAGG + Exonic
1182371086 22:29811532-29811554 TAACCACTTTCAGAGAGGCCTGG + Intronic
1183754055 22:39742520-39742542 AAACCACTGTTAGAGAGACCTGG - Intergenic
949351766 3:3130739-3130761 TAAAAATTGTTAATGAGGCCGGG + Intronic
949529746 3:4943780-4943802 TACACACTGTTGGTGAGGCTGGG - Intergenic
951801501 3:26601703-26601725 TAACCACTTCTAGGGAAGCCAGG + Intergenic
952415008 3:33082186-33082208 TTATCACTCTTAGGGAGGCCAGG + Intronic
952754219 3:36851962-36851984 TAAACATGGTCAGGCAGGCCAGG + Intronic
955283767 3:57619052-57619074 TAAAAACTCTCAGGCAGGCCGGG + Intergenic
961070274 3:123917696-123917718 TACCCACTGTTAGAGAAGCCTGG + Intronic
962881539 3:139581897-139581919 TAAAAACTGTAAGGCAGGCTGGG + Intronic
963267034 3:143250021-143250043 AAAATACTATTAGGGTGGCCAGG - Intergenic
966408405 3:179623375-179623397 TAAAAACTGTTTGGTAGGCCGGG + Intronic
971638838 4:29101688-29101710 TAAGAACTGTTAAGCAGGCCAGG - Intergenic
974480093 4:62431771-62431793 TAAACACTTGTAGGGCGGGCTGG + Intergenic
975857400 4:78639212-78639234 TAAAAACTGTCAGATAGGCCAGG + Intergenic
979213929 4:118140002-118140024 TAATCAAGGTTAGGAAGGCCAGG - Intronic
979489691 4:121311280-121311302 TAAAGACAGTCATGGAGGCCGGG + Intergenic
981804625 4:148700052-148700074 TAAACACTGATAGGAAGGCAAGG - Intergenic
984461593 4:180043861-180043883 TAAAACATGTTAGGAAGGCCTGG - Intergenic
984671759 4:182497344-182497366 TAAAAGCTGTAAGTGAGGCCGGG - Intronic
984784544 4:183555347-183555369 TAAACTCTCTTAGGGTGGCTGGG + Intergenic
985262966 4:188131940-188131962 TAAACTGAGTTGGGGAGGCCAGG - Intergenic
987819274 5:22941079-22941101 TAAAACATGTTGGGGAGGCCAGG - Intergenic
990966698 5:61455842-61455864 TTAACACTGTTAAGGAAGCTAGG + Intronic
992014570 5:72562772-72562794 TAAACACTGTTTGCGAAGCATGG - Intergenic
992325300 5:75654469-75654491 TATAAACTGTTAGGGCAGCCTGG + Intronic
995478549 5:112572354-112572376 TGAACACTGTTTGGGAGGAGGGG - Intergenic
995688729 5:114799899-114799921 TAACCACTTACAGGGAGGCCTGG - Intergenic
996310822 5:122102488-122102510 TAAAAACTGTGATTGAGGCCAGG + Intergenic
996677192 5:126189970-126189992 TAAAGACTGTGTGGGAGGCGTGG + Intergenic
996942158 5:129021114-129021136 TGAACAATGTGAGGTAGGCCGGG - Intronic
1004736329 6:18409864-18409886 TAAAAAATGTTATGTAGGCCGGG - Intronic
1006791611 6:36704822-36704844 TAAAGAGTCTTAGGGTGGCCAGG + Intronic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1010598394 6:77793005-77793027 TAAATAGTGTTGGGAAGGCCAGG - Intronic
1013039529 6:106419677-106419699 TAAAAACTTGTAAGGAGGCCAGG - Intergenic
1013235288 6:108193238-108193260 CACACACTGTTAGGCAGGCTCGG + Intergenic
1013780785 6:113726415-113726437 TTAAAACTGTTAAGTAGGCCAGG - Intergenic
1014558006 6:122856505-122856527 GAAACACTGGAGGGGAGGCCTGG - Intergenic
1015806960 6:137119406-137119428 TAAACACTATCTGGGAAGCCAGG + Intergenic
1017487753 6:154918760-154918782 TAAAAAACATTAGGGAGGCCAGG - Intronic
1018330570 6:162723389-162723411 TACACACTGAAAGGGAGGGCAGG + Intronic
1019119641 6:169792767-169792789 GAAACACAGCTGGGGAGGCCCGG + Intergenic
1021301270 7:18975900-18975922 CATCCACTGTTAGGGAGGCCAGG - Exonic
1022084711 7:27055909-27055931 CCAACACTTTTTGGGAGGCCCGG - Intergenic
1022203168 7:28137517-28137539 TAAATGCTGTTAAGGAGACCTGG - Intronic
1025708894 7:63890325-63890347 AAAACAGTGTCAGGGAGGCCCGG + Intergenic
1025724481 7:64044502-64044524 AAAACAGTCTCAGGGAGGCCTGG - Intronic
1025753493 7:64313025-64313047 GAAACAGTCTCAGGGAGGCCTGG - Intronic
1026502160 7:70952172-70952194 GAACCACGGTTATGGAGGCCTGG + Intergenic
1027334367 7:77132874-77132896 TAAAAAGTGTTTGGTAGGCCGGG + Intronic
1028071879 7:86460709-86460731 TAAATATTGTGAGGGTGGCCGGG + Intergenic
1028995668 7:97097471-97097493 TAAACACTCTTAGTCCGGCCTGG + Intergenic
1032071891 7:128812931-128812953 TAACCACTGTCAGGGAGGCAGGG + Intronic
1032178251 7:129651124-129651146 TAAAAATGGTTAGAGAGGCCGGG + Intronic
1034539882 7:151750718-151750740 TTAACACTGTTAAGGTGGCCAGG + Intronic
1035054458 7:156024941-156024963 TAAACACAGTTCCAGAGGCCTGG - Intergenic
1035477809 7:159156032-159156054 TAAAGCCTGGTAGGGAGTCCTGG + Intergenic
1036497728 8:9284516-9284538 TAAAGTCTGCTAGGGAGGTCTGG - Intergenic
1037516483 8:19636895-19636917 TAAAGAGTCTTAAGGAGGCCAGG + Intronic
1038364935 8:26921620-26921642 TAATCTCTGTCAGGGAGGCTGGG + Intergenic
1038437308 8:27545144-27545166 CAAACTCTGCTAGGGAAGCCGGG - Exonic
1039538001 8:38336844-38336866 TAAAAACTGATACAGAGGCCGGG + Intronic
1039958581 8:42226466-42226488 ATAAAACTGTTAGGAAGGCCAGG - Intergenic
1040802457 8:51358454-51358476 TACACACTATTATGGGGGCCAGG - Intronic
1042829946 8:73015958-73015980 TAAAAAATGTTAGTAAGGCCAGG + Intronic
1042863431 8:73335791-73335813 TAAAAATTGACAGGGAGGCCAGG - Intergenic
1046938295 8:119906572-119906594 TAAGCCCTGTGAGAGAGGCCAGG + Intronic
1047449555 8:124952666-124952688 TAAAAACTGGTATGCAGGCCGGG + Intergenic
1051050075 9:12922112-12922134 TAAACACACTTAAGGAAGCCAGG - Intergenic
1051717995 9:20005312-20005334 TAAACACTTTTAGGATTGCCAGG - Intergenic
1057142380 9:92735276-92735298 CAGACACCATTAGGGAGGCCAGG + Intronic
1057224834 9:93287480-93287502 CAAACACGGTGAGAGAGGCCAGG + Intronic
1059431873 9:114255291-114255313 TGACCACTGGGAGGGAGGCCGGG - Intronic
1059705101 9:116815508-116815530 TAAAAAATGTTAATGAGGCCGGG + Intronic
1060002925 9:119974816-119974838 TAAAGTCTCTCAGGGAGGCCAGG - Intergenic
1186042176 X:5492617-5492639 TAAAAACTGTTAGGCCGGCCAGG - Intergenic
1188675564 X:32935271-32935293 TAAAAACTGTCAGGGAGGCCGGG - Intronic
1188947722 X:36327939-36327961 TAAACACTGTGAGGGTGGGAGGG + Intronic
1189222918 X:39388294-39388316 CAAACACTGATGGGGAGGACTGG - Intergenic
1191853987 X:65607988-65608010 TCAACACTGAAAGGGAGGCAGGG + Intronic
1196241354 X:113346376-113346398 AAAACACTGGTAGGGATGGCTGG + Intergenic
1198793092 X:140367149-140367171 TCAACATTGTTAGTCAGGCCAGG + Intergenic
1201852920 Y:18507335-18507357 AAAAAAATGTTAGGGAGGCATGG - Intergenic
1201880401 Y:18813049-18813071 AAAAAAATGTTAGGGAGGCATGG + Intronic