ID: 928401622

View in Genome Browser
Species Human (GRCh38)
Location 2:30983096-30983118
Sequence CAGTAACACCAAGGGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 197}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928401622_928401625 -6 Left 928401622 2:30983096-30983118 CCACACTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 3
3: 17
4: 197
Right 928401625 2:30983113-30983135 TTACTGAAACCCTGAGTTCACGG 0: 1
1: 0
2: 1
3: 24
4: 259
928401622_928401631 14 Left 928401622 2:30983096-30983118 CCACACTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 3
3: 17
4: 197
Right 928401631 2:30983133-30983155 CGGGCCAGGGCTTATTTTCAAGG 0: 1
1: 0
2: 3
3: 21
4: 120
928401622_928401626 -5 Left 928401622 2:30983096-30983118 CCACACTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 3
3: 17
4: 197
Right 928401626 2:30983114-30983136 TACTGAAACCCTGAGTTCACGGG 0: 1
1: 0
2: 0
3: 8
4: 151
928401622_928401628 1 Left 928401622 2:30983096-30983118 CCACACTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 3
3: 17
4: 197
Right 928401628 2:30983120-30983142 AACCCTGAGTTCACGGGCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 105
928401622_928401633 25 Left 928401622 2:30983096-30983118 CCACACTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 3
3: 17
4: 197
Right 928401633 2:30983144-30983166 TTATTTTCAAGGCTAGCTTAAGG 0: 1
1: 1
2: 2
3: 31
4: 249
928401622_928401634 26 Left 928401622 2:30983096-30983118 CCACACTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 3
3: 17
4: 197
Right 928401634 2:30983145-30983167 TATTTTCAAGGCTAGCTTAAGGG 0: 1
1: 0
2: 5
3: 18
4: 207
928401622_928401627 0 Left 928401622 2:30983096-30983118 CCACACTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 3
3: 17
4: 197
Right 928401627 2:30983119-30983141 AAACCCTGAGTTCACGGGCCAGG 0: 1
1: 0
2: 1
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928401622 Original CRISPR CAGTAACACCAAGGGCAGTG TGG (reversed) Intronic
900205207 1:1428458-1428480 AAGGAACACCAAAGTCAGTGAGG - Intergenic
900677180 1:3894919-3894941 CAGTTACACCAAGGGGACTGAGG + Intronic
904670036 1:32157548-32157570 AAGCAACACCAAGGTCAGTAGGG - Intronic
905282488 1:36858092-36858114 AGGCAACACCAAGGGCAGTGGGG - Intronic
905329403 1:37181704-37181726 CAGGACAGCCAAGGGCAGTGGGG + Intergenic
907390725 1:54156479-54156501 CAGAGACACCCAGGCCAGTGAGG - Intronic
909804171 1:79854228-79854250 CAGTAACCCCAAGGGCAGCTTGG + Intergenic
910621750 1:89262941-89262963 CAGTTCCACCAAGTGCAGGGTGG - Intronic
912552129 1:110491274-110491296 CAGTGACAACAAGGGAAGTCAGG - Intergenic
913123643 1:115765403-115765425 AAGAAACTCCAAGGGCACTGTGG - Intronic
915615256 1:157032886-157032908 CAGAAGCAACCAGGGCAGTGAGG - Intronic
916562543 1:165945627-165945649 CAATAAAACCAAGTGGAGTGTGG - Intergenic
916723497 1:167503018-167503040 CAGTAAGAACATGGGAAGTGAGG + Intronic
918357846 1:183723031-183723053 CAATAGCACAAAGGGCATTGGGG + Intronic
919431547 1:197498633-197498655 CAGAAATACCAAGGACAGAGTGG + Intergenic
919587466 1:199456605-199456627 CAGTAAGTACAAGGGCACTGGGG + Intergenic
920397842 1:205659663-205659685 CAGGAACACCTAAGGCAGAGGGG + Exonic
920975433 1:210781326-210781348 CAGAAACACCAAGTACAGTAAGG + Intronic
921067675 1:211634099-211634121 CAGCAAGACCACAGGCAGTGTGG + Intergenic
922821894 1:228490337-228490359 GAGCAGCCCCAAGGGCAGTGTGG - Intronic
923561986 1:235048506-235048528 CATTAAAACCAAGGGCAGCCGGG + Intergenic
1063826961 10:9908884-9908906 CAGTACAACCCAGGGCTGTGGGG - Intergenic
1064154971 10:12896504-12896526 GAGTAACACCTGGGGCACTGAGG - Intergenic
1064545077 10:16442145-16442167 CAGTAACACCAAGGATTTTGTGG - Intronic
1065608401 10:27445307-27445329 CAGTGGCTCCTAGGGCAGTGTGG - Intergenic
1069745174 10:70710393-70710415 CCCTAACATCAAGGCCAGTGAGG - Intronic
1071107284 10:82112970-82112992 CAGGAAGACCAGGAGCAGTGTGG - Intronic
1071796351 10:89010575-89010597 CAGCAACACCAAGTGCAAAGAGG + Exonic
1075702441 10:124478166-124478188 GAGCAGCACCAAGGGCTGTGTGG + Intronic
1077974903 11:7237969-7237991 TGGTTACACCAAGGGCAGAGGGG - Intergenic
1080338820 11:31232703-31232725 AATTAACACCAATGGCAGTAAGG - Intronic
1082783405 11:57303419-57303441 CAGTACCACCAGGGACGGTGTGG - Intronic
1085415982 11:76319190-76319212 CATGGACTCCAAGGGCAGTGAGG - Intergenic
1086608160 11:88722379-88722401 CAGTCACAGCAAGGGCCCTGAGG - Intronic
1087183064 11:95158442-95158464 CAGTAGCAGAAAGGCCAGTGTGG + Intergenic
1089130138 11:116205780-116205802 TAGTCACACCTAGGGCAGTGGGG - Intergenic
1090984715 11:131756115-131756137 CACTAACACCAATGAGAGTGTGG - Intronic
1093774039 12:23051775-23051797 CCTTTACACAAAGGGCAGTGAGG - Intergenic
1093987786 12:25556439-25556461 CAGAAACAGCAAGTACAGTGAGG - Intronic
1094495464 12:30986497-30986519 CAGGGCCACCAAGGGCAGTGAGG - Intronic
1095749994 12:45699212-45699234 CAGTTTCCCCAAGGGCAGAGGGG - Intergenic
1096129266 12:49144591-49144613 CAGTAACAAGAAGGTCAATGAGG + Intergenic
1097053519 12:56237361-56237383 CAGAGAAATCAAGGGCAGTGGGG + Intronic
1100796660 12:98189257-98189279 CAGAAACACCAAGAGCAATTGGG + Intergenic
1101319585 12:103661807-103661829 GAGGAACAGCAAGGCCAGTGTGG + Intronic
1102159451 12:110756787-110756809 CAGGCACAGCAAGGCCAGTGTGG - Intergenic
1104827471 12:131723602-131723624 AAGGAACCCCAGGGGCAGTGGGG - Intronic
1112303779 13:98254800-98254822 TAGTATAACCAATGGCAGTGGGG + Intronic
1112731161 13:102364414-102364436 CAGTAACTCCAACAGTAGTGGGG + Intronic
1113035554 13:106044133-106044155 CAGTAACACTAAGATTAGTGCGG - Intergenic
1113601019 13:111568267-111568289 AAGATACACCAAGGACAGTGTGG - Intergenic
1115808519 14:37079515-37079537 CGGTAACTCCAAGGGTTGTGTGG - Intronic
1117451474 14:55854216-55854238 GAGTAACAGAAAGGCCAGTGTGG - Intergenic
1118523972 14:66620047-66620069 CATTAACAGGTAGGGCAGTGGGG - Intronic
1119425319 14:74531261-74531283 GAGTAACACCAGGGACAGAGAGG + Intronic
1122018461 14:98817094-98817116 CAGGAAAGCCAAGGGCACTGTGG - Intergenic
1127975139 15:63991439-63991461 CAGTAGCAACAAGGTCAGGGAGG - Intronic
1128138099 15:65278890-65278912 CAGTGACACCCAGAACAGTGGGG + Intronic
1129690819 15:77712341-77712363 CAAGCTCACCAAGGGCAGTGAGG - Intronic
1129697893 15:77750994-77751016 CAGGAAGAACAAGGGCAGCGTGG + Intronic
1130601021 15:85273317-85273339 AAGTCACCCCAATGGCAGTGAGG + Intergenic
1131282174 15:91030887-91030909 AAGTCACCCCAACGGCAGTGAGG - Intergenic
1132752446 16:1465016-1465038 CAGTGACAGCATGGGCAGCGAGG - Intronic
1134073759 16:11276446-11276468 CAGTAACACCAAGGGCAGGTGGG - Exonic
1137468638 16:48734392-48734414 CAGGAAAAATAAGGGCAGTGAGG + Intergenic
1139255335 16:65535675-65535697 CAGTAACATTGAGGGCACTGTGG - Intergenic
1139574411 16:67832112-67832134 CAGAAACACCAAGGAGAGGGTGG + Intronic
1141250168 16:82348699-82348721 CAGTGACACTAAGCTCAGTGGGG - Intergenic
1141370599 16:83482805-83482827 CACTAAGACCATGGGCAGGGTGG + Intronic
1141669706 16:85485368-85485390 CTGTCACACCAGGGGCGGTGGGG + Intergenic
1143629597 17:8130460-8130482 CAGGAAAACCAGGGGGAGTGGGG + Intergenic
1144473569 17:15564981-15565003 CAGTAACATCAAGTGCATTGAGG - Intergenic
1144506600 17:15836831-15836853 GAGCAACACAGAGGGCAGTGCGG - Intergenic
1144591498 17:16527958-16527980 CAGGTGCAGCAAGGGCAGTGAGG + Intergenic
1144636119 17:16910310-16910332 TGGTAACATCAAGGGCAGGGGGG - Intergenic
1144645950 17:16973516-16973538 TGGTAACATCAAGGGCAGGGGGG + Intergenic
1144922953 17:18779830-18779852 CAGTAACATCAAGTGCATTGAGG + Intergenic
1145170776 17:20654767-20654789 GAGCAACACAGAGGGCAGTGCGG - Intergenic
1146963717 17:37006922-37006944 CTTAAAGACCAAGGGCAGTGAGG + Intronic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1150487225 17:65552119-65552141 CCCCAACACCAAGGGCAGAGAGG + Intronic
1151284532 17:73100448-73100470 CGTTTACATCAAGGGCAGTGTGG - Intergenic
1151472477 17:74326693-74326715 CAGAAACGCCAGGGGCAGGGAGG + Intronic
1153032453 18:727718-727740 CAGTAACACAAAGGGTAGAGGGG - Intronic
1153374711 18:4362964-4362986 CAGTAATGCCAAGGGGATTGGGG - Intronic
1155511311 18:26580268-26580290 CAGTGACAACAAGGACAGTAGGG + Intronic
1160630643 18:80244975-80244997 CAGTAAGGCCCAGGTCAGTGTGG + Intronic
1161178821 19:2865879-2865901 CTGTAACCCCAAGGGAAGGGCGG + Intergenic
1161859183 19:6784917-6784939 CTTTTTCACCAAGGGCAGTGGGG - Intronic
1162743241 19:12785056-12785078 CAGTCACACCCAGTGCAGAGAGG + Intronic
1162993542 19:14319072-14319094 CCGTAACACCACGGCCACTGGGG - Intergenic
1164873934 19:31669940-31669962 CACAAACAACAAAGGCAGTGGGG - Intergenic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165806696 19:38584737-38584759 CAGGAACAGCACGGGCAGGGGGG - Intronic
1166710617 19:44934863-44934885 CAGTAACTGCAAGGGCCCTGAGG - Intergenic
925198285 2:1945422-1945444 CAGGAGGACCAAGGGCCGTGAGG + Intronic
926055850 2:9773500-9773522 GAGGAACGTCAAGGGCAGTGTGG - Intergenic
927439061 2:23097390-23097412 CAGTAACTCCAGGGGGAGTCTGG - Intergenic
927787120 2:25981890-25981912 CAGTAAGACCAAGGCCAGCGAGG - Exonic
928401622 2:30983096-30983118 CAGTAACACCAAGGGCAGTGTGG - Intronic
929960677 2:46494035-46494057 CAGTCAGACAAAGAGCAGTGGGG + Intronic
934491347 2:94763601-94763623 CAGTAAGAACATGGTCAGTGAGG - Intergenic
935017619 2:99198997-99199019 CAGTTTCACCAAGGACAGTTTGG + Intronic
935402848 2:102678698-102678720 CAGTAAGGCCAAGGACAGTCCGG + Intronic
937154215 2:119707277-119707299 CAGTAACCCCAAGAGCACTGGGG + Intergenic
937226291 2:120371858-120371880 CAGCCACACCAGGGGAAGTGAGG - Intergenic
938081822 2:128374252-128374274 CAGGAGCACCAAGGGCAGTGAGG + Intergenic
938288200 2:130135985-130136007 CAGTGGCACCGGGGGCAGTGGGG - Intergenic
938304192 2:130239876-130239898 CAGCCAAACCAAGGGCAGTCGGG + Intergenic
938452492 2:131434415-131434437 CAGCCAAACCAAGGGCAGTCGGG - Intergenic
939414890 2:141882963-141882985 CAGTCTCACCAAAGGCATTGCGG + Intronic
939599838 2:144174918-144174940 CAGTAAAACCAAAAACAGTGAGG + Intronic
940031743 2:149271070-149271092 AAGAAACACCAAGTGTAGTGTGG - Intergenic
940875130 2:158890814-158890836 CAGGAACTCCAGGGGCTGTGAGG + Intergenic
942387031 2:175453165-175453187 AGGTGACACCAAGGGCAGAGAGG - Intergenic
944097919 2:195990541-195990563 CAGCTACTCCAAGGGCACTGAGG + Intronic
948562939 2:238866077-238866099 CAGTAACACCAGATGCAGTGTGG - Intronic
949023153 2:241752682-241752704 CCGCACCACCAAGGGCAGTTGGG - Intronic
1169980193 20:11376093-11376115 GAGAAACCCCAAGGGCAGAGTGG + Intergenic
1179979299 21:44888093-44888115 CAGTGCCACCAAGGTCACTGTGG + Intronic
1179979313 21:44888156-44888178 CAGTGCCACCAAGGTCACTGTGG + Intronic
1180194543 21:46184771-46184793 CAGGACCACCAAGGGCACTCAGG + Intergenic
1180751984 22:18130920-18130942 CAGCAACACCACGGCCATTGCGG + Exonic
1181729600 22:24835083-24835105 CATCACCACCAAGGGCAGTATGG - Intronic
1183648123 22:39138504-39138526 CTGTACCACCCAGGGCACTGTGG - Intronic
1185071880 22:48661156-48661178 CAGTGACCCCAACTGCAGTGTGG - Intronic
1185340313 22:50288029-50288051 CCGGAACACCTAGGGCAGCGGGG + Exonic
950025302 3:9816032-9816054 CAGAAACACAGAGGCCAGTGTGG - Intronic
950379062 3:12595644-12595666 CAGTAACATCAAGTGCAAAGTGG - Intronic
952544917 3:34408646-34408668 CAGTTACACCATGGGCAATTGGG + Intergenic
953085645 3:39664106-39664128 CAGTATCTCCAAGGGCAAAGAGG - Intergenic
954622400 3:52003610-52003632 CAGGAACACCAATGGTAGGGAGG - Intergenic
954686036 3:52370780-52370802 CAGTGGCACCAACGACAGTGAGG + Exonic
954882284 3:53844391-53844413 CAGAGAGACCAAGGGCACTGAGG - Intronic
955940290 3:64140672-64140694 AAGAGACACCAAGGGCAGAGTGG - Intronic
957576390 3:82014086-82014108 CAGTAAAATCCAGGCCAGTGAGG + Intergenic
959698262 3:109272968-109272990 CAGTAACACAAAAGGCAAAGTGG + Intergenic
963000616 3:140678410-140678432 CAGCAACACCAATGGCAGTTGGG - Exonic
964461528 3:156936272-156936294 CAGCAACACAGAGGCCAGTGTGG - Intronic
965443070 3:168740081-168740103 CAGTCACATCATGGTCAGTGGGG + Intergenic
967530124 3:190539472-190539494 CAGCAATACCAGGGGAAGTGGGG - Intronic
968487736 4:872037-872059 CAGGAACACCCAGAGCAGAGTGG + Intronic
968717262 4:2169723-2169745 AAGTAAGAACAAGGGCAGTGGGG - Intronic
969116926 4:4876241-4876263 AAGGAACACCAAGGCCAGAGAGG + Intergenic
969445279 4:7241319-7241341 CAGGGACACAGAGGGCAGTGAGG - Intronic
971940765 4:33212446-33212468 CAGTACCACCCAGGCCAGTATGG + Intergenic
974667014 4:64975771-64975793 CAGGAAAACCAAGGGCACTTTGG - Intergenic
974714612 4:65651105-65651127 CAGCAACATCAAAGGCAGTCAGG - Intronic
975081476 4:70285612-70285634 TAGTAGCTCCAAGGACAGTGGGG - Intergenic
975589771 4:75988317-75988339 CAGGAACATAAAGGCCAGTGTGG - Intronic
980115071 4:128671691-128671713 CAATAACACCAAAGGAAATGCGG + Intergenic
980615586 4:135219233-135219255 CATTAAAACCAAGGGCCCTGGGG - Intergenic
982009817 4:151095929-151095951 CAGCAACAACGATGGCAGTGTGG + Intergenic
985335483 4:188888520-188888542 CAGTCACTCCAAGGGCAATATGG - Intergenic
985710379 5:1424461-1424483 CAGTGACACCATGGGCAGTGAGG - Intronic
987315059 5:16716377-16716399 CAGGGACACCAAGAGCAGGGAGG + Intronic
993882834 5:93382861-93382883 CTTCAACATCAAGGGCAGTGTGG + Intergenic
996403328 5:123085836-123085858 CAGGAGCACCCAGGGCAGAGCGG + Intergenic
997899112 5:137747683-137747705 GAGTAACATAAATGGCAGTGGGG - Intergenic
998908326 5:146930614-146930636 CATTCACAAAAAGGGCAGTGGGG + Intronic
999619603 5:153459264-153459286 AAGGAACAGAAAGGGCAGTGTGG - Intergenic
1000204067 5:159040523-159040545 TGGCAACACCAAGGGCACTGAGG - Intronic
1016203454 6:141442199-141442221 CAATAATACCAATAGCAGTGTGG - Intergenic
1017161944 6:151373308-151373330 CTGTAACAAGAAGGGTAGTGGGG + Intronic
1017470202 6:154731907-154731929 AAGTAACAGAAAGGCCAGTGTGG + Intergenic
1017649357 6:156566784-156566806 CTGAAACACGAAGGGAAGTGTGG - Intergenic
1018815917 6:167330807-167330829 CAGGACCAAAAAGGGCAGTGAGG + Intronic
1018865327 6:167742835-167742857 CAGCAAGAGAAAGGGCAGTGGGG + Intergenic
1019142843 6:169959273-169959295 CAGTAGCAACAAGGGCACTTTGG + Intergenic
1019224711 6:170500398-170500420 CAGAAACAGCAGGGGCAGGGGGG - Intergenic
1020684953 7:11283363-11283385 CAGTAAAACCTTGGGCACTGTGG - Intergenic
1022971359 7:35520280-35520302 CACTAACACTTAGGCCAGTGAGG + Intergenic
1024101034 7:46033198-46033220 CAGAAACACCAAAGGCCCTGAGG + Intergenic
1024961234 7:54978996-54979018 CAGGACCGCCAAGGGCTGTGGGG + Intergenic
1028279152 7:88898734-88898756 CACCAACATAAAGGGCAGTGAGG - Intronic
1028938031 7:96487527-96487549 CTGTAATACAAAGGGCAGTTTGG + Intronic
1030069782 7:105688708-105688730 CAGTAACAGCAAGGTCAAGGTGG + Intronic
1031233076 7:119135037-119135059 ATGTAACACAAAGTGCAGTGAGG + Intergenic
1032454063 7:132058511-132058533 CAGAAACTGCTAGGGCAGTGTGG + Intergenic
1034646784 7:152654679-152654701 GAGTAACAGCAAGGACAGAGTGG + Intronic
1035285647 7:157804960-157804982 CAGGGGCAGCAAGGGCAGTGAGG - Intronic
1036766184 8:11550534-11550556 CAGGAACACCGAGGCCAGTGGGG + Intronic
1040975413 8:53188618-53188640 CAGTGACACCAAGGCCAAAGAGG - Intergenic
1044275046 8:90289488-90289510 CAGTAACCTCCAGGCCAGTGAGG + Intergenic
1044466420 8:92512202-92512224 CAGTGATACGAAGGGCAGGGTGG - Intergenic
1045222210 8:100210518-100210540 CAGAAACACCAAGAGTAGTTTGG - Intronic
1046239959 8:111477291-111477313 CAGTAAAACCTAGGGGTGTGGGG + Intergenic
1046780118 8:118205680-118205702 CAATAACACCAAGGGGTGAGAGG - Intronic
1049001434 8:139827741-139827763 AAGGAACACCTAGGGCAGGGTGG + Intronic
1050491101 9:6188622-6188644 CAGTAACATCAAGGGGACTATGG + Intergenic
1052190773 9:25658838-25658860 CAGTGCCTCCCAGGGCAGTGGGG - Intergenic
1052359751 9:27541181-27541203 CAGTAACAGCAAGGTGAGTCAGG + Intergenic
1052552689 9:29970449-29970471 CCGTGACACCAACTGCAGTGTGG - Intergenic
1056519803 9:87389693-87389715 GAGTAACCCAAAAGGCAGTGGGG + Intergenic
1057798748 9:98176484-98176506 CAGGAACAGGTAGGGCAGTGGGG - Intronic
1058606225 9:106726399-106726421 CTGGAAAACCAAGGGAAGTGTGG - Intergenic
1060658340 9:125388093-125388115 CAGGAAGACCAAGCGCAGGGTGG + Intergenic
1060826972 9:126693191-126693213 CAGTCAGAGCAAGGGCAGCGGGG + Exonic
1062143119 9:134971244-134971266 CGGTAATACCAATGGCACTGAGG + Intergenic
1062175846 9:135162409-135162431 TGGTAACACCAAGGACAGAGGGG + Intergenic
1062175860 9:135162476-135162498 TGGTAACACCAAGGACAGTGGGG + Intergenic
1062175875 9:135162543-135162565 TGGTAACACCAAGGACAGAGGGG + Intergenic
1062175889 9:135162610-135162632 TGGTAACACCAAGGAGAGTGGGG + Intergenic
1062175904 9:135162677-135162699 TGGTAACACCAAGGACAGAGGGG + Intergenic
1062175918 9:135162744-135162766 TGGTAACACCAAGGACAGAGGGG + Intergenic
1062175933 9:135162811-135162833 CGGTAACACCAAGGACAGAGGGG + Intergenic
1062175947 9:135162878-135162900 TGGTAACACCAAGGACAGAGGGG + Intergenic
1062446717 9:136598322-136598344 CAGGAGCACCTGGGGCAGTGTGG + Intergenic
1062446834 9:136598739-136598761 CAGGAGCACCTGGGGCAGTGTGG + Intergenic
1187397873 X:18933830-18933852 CAGAAACCCAAAGGTCAGTGTGG + Intronic
1187577594 X:20574947-20574969 CAGGAACAGCAAGATCAGTGTGG + Intergenic
1187927000 X:24259868-24259890 CAGAAACTCCGAGTGCAGTGAGG - Intergenic
1194422551 X:93695006-93695028 CAGTAGCACCAAGAGTAGTGAGG - Intronic
1197137985 X:123085049-123085071 CGGCAAGACCAAGGCCAGTGAGG + Intergenic
1199769389 X:150964693-150964715 CAGCAACAGCAAGGCCACTGTGG + Intergenic
1202130091 Y:21601544-21601566 CAGGAAAACCTAGGCCAGTGGGG + Intergenic
1202183032 Y:22155858-22155880 CAGGAACCCCTAGGTCAGTGAGG + Intergenic
1202208327 Y:22430543-22430565 CAGGAACCCCTAGGTCAGTGAGG - Intergenic