ID: 928402390

View in Genome Browser
Species Human (GRCh38)
Location 2:30988418-30988440
Sequence AGGTGATGCCAATTGCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928402386_928402390 1 Left 928402386 2:30988394-30988416 CCCACAGTAGGAGCTTCTCGGTA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 928402390 2:30988418-30988440 AGGTGATGCCAATTGCTAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 91
928402381_928402390 27 Left 928402381 2:30988368-30988390 CCAATGGCGATGGGGCCAGGAGT 0: 1
1: 0
2: 2
3: 14
4: 140
Right 928402390 2:30988418-30988440 AGGTGATGCCAATTGCTAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 91
928402385_928402390 2 Left 928402385 2:30988393-30988415 CCCCACAGTAGGAGCTTCTCGGT 0: 1
1: 0
2: 0
3: 11
4: 309
Right 928402390 2:30988418-30988440 AGGTGATGCCAATTGCTAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 91
928402383_928402390 12 Left 928402383 2:30988383-30988405 CCAGGAGTGACCCCACAGTAGGA 0: 1
1: 0
2: 1
3: 20
4: 113
Right 928402390 2:30988418-30988440 AGGTGATGCCAATTGCTAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 91
928402387_928402390 0 Left 928402387 2:30988395-30988417 CCACAGTAGGAGCTTCTCGGTAG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 928402390 2:30988418-30988440 AGGTGATGCCAATTGCTAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928402390 Original CRISPR AGGTGATGCCAATTGCTAGG AGG Intronic
906386665 1:45375523-45375545 ATGTGATGTTAAGTGCTAGGTGG - Intronic
909899445 1:81114103-81114125 AGGTGTTTCCCATTGCTGGGAGG + Intergenic
909989734 1:82209027-82209049 TGGTTATGCCACTTGCAAGGTGG - Intergenic
912087133 1:106022120-106022142 TGGTGATGAAAATTGGTAGGGGG + Intergenic
912213982 1:107586225-107586247 TGGAGATGCCACTTGCTAGTAGG - Intronic
912281099 1:108315241-108315263 AGGTGGTGACAATGGCTATGGGG + Intergenic
915174157 1:154000938-154000960 AGGTGATGCCATTTGCTGGAAGG + Exonic
922016770 1:221656237-221656259 ATGTGATTCCCAGTGCTAGGTGG + Intergenic
1063688459 10:8260779-8260801 AGATGCTGCCAATTGCGCGGAGG - Intergenic
1065898929 10:30187873-30187895 AGGTGATGCCTATAGCTAACGGG - Intergenic
1069366308 10:67697837-67697859 ACGTGATTTGAATTGCTAGGAGG - Intergenic
1070712926 10:78696665-78696687 AGGTGATGCCAATGGGGCGGGGG + Intergenic
1071403463 10:85302273-85302295 AGATGATGCCAAGTGTTAGCAGG - Intergenic
1071713400 10:88071876-88071898 AGGTGAAGCCAAAGGCTGGGGGG - Intergenic
1084959672 11:72709949-72709971 AGGTGATGCCAATGCCCAGGTGG + Exonic
1089518716 11:119049621-119049643 TGGTGTTGCCAAGTTCTAGGGGG + Exonic
1091952442 12:4605821-4605843 ATGTGATTCCAATTGCTTGGTGG + Intronic
1095852801 12:46829308-46829330 AGATGATTTCAATTGATAGGTGG + Intronic
1099320419 12:81140536-81140558 TGGTAATGGGAATTGCTAGGTGG - Intronic
1101738799 12:107483654-107483676 AGGAGATGACATTAGCTAGGTGG + Intronic
1101846676 12:108368408-108368430 AGGTGATGCCCCTTCCCAGGTGG + Intergenic
1116245681 14:42408511-42408533 AGCTAAAGCAAATTGCTAGGGGG - Intergenic
1116316433 14:43401142-43401164 AGATAATGCCAAATGTTAGGAGG - Intergenic
1117675423 14:58151180-58151202 ATTGGATGCCAAGTGCTAGGCGG + Intronic
1120747848 14:88168079-88168101 GGGTGATGCCAGTTGCTAAAGGG + Intergenic
1122003516 14:98683855-98683877 AGAGGATGCCAATTGTTAAGGGG - Intergenic
1130128452 15:81115025-81115047 GGGTGATGCCAAGTCCAAGGTGG + Intronic
1130971680 15:88738772-88738794 AGGTAATGCCAATGCCCAGGAGG - Intergenic
1132155609 15:99493471-99493493 AGGTGATTGCAATTGCTCTGGGG - Intergenic
1135044480 16:19143608-19143630 AGGTCATGCCAATTCTTAGCAGG + Intronic
1135845852 16:25917829-25917851 AGGTGATGCTTATTGCTTGAAGG - Intronic
1142759689 17:2035332-2035354 AGGTGGTGCCATGTGCTATGGGG + Intronic
1151810775 17:76440104-76440126 AGGTAATGCCAGGTGCTATGAGG + Intronic
1151902664 17:77027190-77027212 AGGTGATGACCATGGCTTGGGGG - Intergenic
1153982507 18:10322127-10322149 AGGTGAGGCCAATGGCGATGGGG - Intergenic
1155196563 18:23480449-23480471 AGATGATTCCAATTGCTAGCTGG + Intronic
1155615001 18:27712061-27712083 AGGTGATTCCAATTGTTTGGAGG - Intergenic
1157431454 18:47630591-47630613 AGGTGATCGCAAATGCTATGCGG + Intergenic
1163236783 19:16034495-16034517 AGGGGATGCCCAATGCTGGGAGG + Intergenic
926309197 2:11662247-11662269 AGGTAATGCCAAGGGCTATGGGG + Intronic
928402390 2:30988418-30988440 AGGTGATGCCAATTGCTAGGAGG + Intronic
932274955 2:70444716-70444738 AGGTGATCCCACTTGAGAGGAGG + Intergenic
934531304 2:95090964-95090986 AGGACAGGCCAATAGCTAGGAGG - Intronic
936789411 2:116133401-116133423 AGGAGATGCCAATTTCTCTGTGG + Intergenic
939118779 2:138091284-138091306 ACATCATGGCAATTGCTAGGTGG + Intergenic
941287532 2:163632461-163632483 AGGTGAAGCCAAGTGCCAGCTGG - Intronic
941368811 2:164638724-164638746 AGATGATGAAAATAGCTAGGAGG + Intergenic
943443039 2:187949309-187949331 AAGTGATCCCAATTAGTAGGTGG + Intergenic
943490180 2:188543404-188543426 AGGTGATGCCAACTTATAGTTGG - Intronic
944074959 2:195719591-195719613 AGTTAATGCCAAGTGCTGGGAGG - Intronic
945338300 2:208618553-208618575 GGGTGAGGCCTATTGCTAGCAGG - Intronic
945433317 2:209791383-209791405 AGGTGGTGCCAAGTGGTGGGAGG - Intronic
948438776 2:237971993-237972015 AGGTGATGCCCCTTGCTATCTGG - Intronic
1172365824 20:34348347-34348369 ACGTGATGCCAATTGTGTGGTGG - Intergenic
1174553457 20:51377877-51377899 AGTTGATGGCAATTTGTAGGCGG + Intergenic
1175664510 20:60846681-60846703 AGGTGATACCAATTGCTGTTTGG + Intergenic
1178182729 21:30182196-30182218 AATTCATGCCAATTGCAAGGTGG - Intergenic
1179055606 21:37929371-37929393 ATGTGATATAAATTGCTAGGGGG + Intergenic
1182089092 22:27581843-27581865 AAGTGCTGCCAAGTGCTGGGCGG - Intergenic
1184271605 22:43387611-43387633 AGGAGATGGCAATTTGTAGGGGG + Intergenic
1184413855 22:44340799-44340821 AGATGGTGCCAATTGGCAGGTGG + Intergenic
1184788956 22:46687475-46687497 AGGGGTTGCCAATGGCCAGGTGG + Intronic
950683012 3:14598176-14598198 AGGTCATGCCAAATGCTGGAAGG - Intergenic
953365233 3:42338704-42338726 AGGTTATGCCAAGTTCTAGGTGG + Intergenic
956895893 3:73659438-73659460 AAGGGATGGCAAATGCTAGGAGG - Intergenic
961693228 3:128685614-128685636 AGGTGATGGCAACTCCTTGGAGG - Intergenic
962424639 3:135259015-135259037 AGGTGATGCCTATTCTCAGGAGG - Exonic
970193756 4:13537442-13537464 AAGAGATGCCAAATGCTTGGTGG - Intergenic
972343502 4:38173264-38173286 AGGTGGTGCTAAGTGCTGGGAGG + Intergenic
975975971 4:80097206-80097228 AGGTGATGGCATTTGAAAGGTGG - Intronic
980944208 4:139302549-139302571 AGGTGGGGCCCATTGCGAGGGGG + Intronic
986355069 5:6915880-6915902 AGGAGATACCCATGGCTAGGTGG + Intergenic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
992974210 5:82096492-82096514 AGGTGAAGCCAAGGGCTAGAGGG - Intronic
993872987 5:93273712-93273734 AGTTGGTGCCAGTTGCTAGCTGG + Intergenic
999427441 5:151500076-151500098 AGGCCATGCTAATTTCTAGGTGG - Intergenic
999952846 5:156668912-156668934 AGAGGAGGCCAATTGCAAGGTGG + Intronic
1000025643 5:157356740-157356762 AGGATATGCAAAATGCTAGGAGG - Intronic
1009191987 6:60640158-60640180 AGGGCATGCCAATTGCTATGTGG + Intergenic
1011618113 6:89216541-89216563 AGGTGAGGCCGAGTGCTAAGGGG + Intronic
1013491902 6:110655687-110655709 AGGTGATCCAAATTGAGAGGAGG - Intronic
1014062019 6:117082652-117082674 AGGGGATGCCAACTGATAGTGGG - Intergenic
1014356002 6:120411014-120411036 AGGTAATGCAAAATGCTAGCAGG - Intergenic
1018001795 6:159586019-159586041 TGATGATGCCAAATGCTGGGGGG + Intergenic
1018276007 6:162132430-162132452 AGGTCATGCTAATTATTAGGAGG - Intronic
1031541208 7:122996652-122996674 AGGTTATTCTAATTGCTAGTTGG + Intergenic
1033544796 7:142390180-142390202 GGGTGATGCCAGTTGCTACAAGG - Intergenic
1034640958 7:152601968-152601990 AGGTGGTGACAGGTGCTAGGAGG - Intergenic
1036477175 8:9103915-9103937 AGGTGCTCACAATTGCTAGAAGG - Intronic
1037676227 8:21053002-21053024 AGGTGGTGCCTAGTGGTAGGTGG - Intergenic
1040981699 8:53251527-53251549 AGGTGATGCCAAGAGCTGAGCGG - Exonic
1044386211 8:91591629-91591651 AAGGGATGCCCATTGGTAGGAGG + Intergenic
1046096820 8:109572529-109572551 AGATGATGCCAATTTGGAGGTGG - Intergenic
1048261578 8:132949826-132949848 AGGTGATGCCACTGGCTGGGGGG - Intronic
1053360889 9:37486058-37486080 AGGTGTTGCCGAGTGCGAGGTGG + Exonic
1059471547 9:114508503-114508525 AGGTGAAGCCACTTGCTGTGGGG - Intergenic
1062435075 9:136543427-136543449 AGGTGATGCCACCTCCTGGGCGG - Intronic
1062435097 9:136543511-136543533 AGGTGATGCCACCTCCTGGGCGG - Intronic
1188422998 X:30011862-30011884 AGATGATGCAAATTGCTTGGGGG + Intergenic
1189301813 X:39957829-39957851 AGGTGATGGTAATGGCTATGGGG + Intergenic
1189376506 X:40470900-40470922 AGATAATGCCAATTCCTATGGGG - Intergenic