ID: 928403985

View in Genome Browser
Species Human (GRCh38)
Location 2:31000187-31000209
Sequence TCCCTAAACCCTGAGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928403979_928403985 25 Left 928403979 2:31000139-31000161 CCAAGCGGCTGTTTGAATATGTA 0: 1
1: 0
2: 0
3: 1
4: 75
Right 928403985 2:31000187-31000209 TCCCTAAACCCTGAGTGTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 155
928403978_928403985 26 Left 928403978 2:31000138-31000160 CCCAAGCGGCTGTTTGAATATGT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 928403985 2:31000187-31000209 TCCCTAAACCCTGAGTGTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928403985 Original CRISPR TCCCTAAACCCTGAGTGTTC TGG Intronic
901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG + Intronic
904901349 1:33859757-33859779 TTCCAAAACCCTCAGTGCTCAGG - Intronic
905174165 1:36125641-36125663 GCCCTAAAGCCTGAATGTGCGGG - Intergenic
905856060 1:41314947-41314969 TCCTTCAACCCTGAGTATCCTGG - Intergenic
907825199 1:58009742-58009764 TCACTAAACCTTGAGTTTCCTGG - Intronic
907825203 1:58009794-58009816 TCACTAAACCTTGAGTTTCCTGG - Intronic
908955542 1:69621775-69621797 TCCCTAAACCCTTACTGGACTGG + Intronic
910877694 1:91892613-91892635 TCCCTGAACCCTCTCTGTTCAGG + Intronic
912412666 1:109489202-109489224 TCCCTCAGCCCTGAGTGTGGGGG + Intronic
916498541 1:165366868-165366890 TCCCAAAACCCTGAGAGTACAGG + Intergenic
918703281 1:187631925-187631947 TCCTCAAACCCTAAGTCTTCTGG + Intergenic
919279648 1:195472227-195472249 TCCCTAAACAGTGAGTAGTCAGG + Intergenic
920837278 1:209523020-209523042 TCCCTAAACACTGATTTCTCTGG - Intergenic
921717516 1:218433379-218433401 TTCCTAAAGCCTCAGTGTTTAGG + Intronic
922004772 1:221518891-221518913 TCCCTTATCCCAGAGTGTTTGGG + Intergenic
923070755 1:230562443-230562465 TCCCTCAAGCCTTGGTGTTCAGG - Intergenic
923126471 1:231039141-231039163 ACCCTAAATCATGTGTGTTCTGG + Intronic
924140944 1:241022682-241022704 ACCCTGATCCCTGAGTTTTCAGG + Intronic
1065429298 10:25637564-25637586 TCCCTCACCCCTGCGTGTCCAGG - Intergenic
1065921520 10:30397546-30397568 TCCCTCAAGCCTCAGTGTTCAGG - Intergenic
1068357314 10:55926127-55926149 TCACTATACCCTCAGTGTTTAGG - Intergenic
1069829934 10:71276865-71276887 TCCCTATACCCTAGGTGTCCTGG - Intronic
1069884318 10:71614037-71614059 TACCTAAACCCTCTGTGCTCTGG - Intronic
1072588382 10:96803310-96803332 TCCCTAAGCTCTGAGCCTTCAGG + Intergenic
1072840735 10:98771378-98771400 TCACTAAACTCTGAGGGTTCAGG - Intronic
1072985260 10:100134066-100134088 TCCCTCAACCCTGAGACCTCTGG + Intergenic
1073428624 10:103471590-103471612 TCCCCAAACCCTTCCTGTTCGGG + Intergenic
1073767250 10:106696363-106696385 TCCCTTAAATCTGATTGTTCTGG - Intronic
1076106719 10:127829133-127829155 TCCCTGAAGCCGGTGTGTTCTGG - Intergenic
1076768546 10:132650911-132650933 TTCCTGATCCCTGAGTGTGCAGG + Intronic
1077883648 11:6369967-6369989 TCACTAAACCAAGTGTGTTCAGG - Intergenic
1079424805 11:20330093-20330115 TCCCTATGCCCTCAGTCTTCTGG + Intergenic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1084279914 11:68081528-68081550 TTTGTAAACCCTGACTGTTCTGG - Intronic
1088282315 11:108147946-108147968 TCCCCCAACCCTGAATGTTGAGG - Intergenic
1093013925 12:14137307-14137329 TCCCTTAAACTTGAGTTTTCTGG + Intergenic
1093637445 12:21488357-21488379 TCCCTAAACTCTTGGTGTTCTGG + Intronic
1095218629 12:39580724-39580746 TTTCTAAATCCTAAGTGTTCAGG + Intronic
1098946724 12:76598223-76598245 TCTCTCCAACCTGAGTGTTCTGG + Intergenic
1098964093 12:76767659-76767681 TCCCTAAACCCTGGGATTACAGG - Intronic
1101571703 12:105959459-105959481 TCCTAAAACCCTTAGAGTTCTGG - Intergenic
1104685038 12:130779381-130779403 CCCCTAGACCCAGAGTGATCTGG + Intergenic
1114352516 14:21869106-21869128 TCCTTCAACCCTGAGTGTCCAGG + Intergenic
1115516665 14:34192197-34192219 ACCCTGAACCCTGACTATTCTGG - Intronic
1117881439 14:60316831-60316853 GCCCTAAGCTCTGTGTGTTCAGG - Intergenic
1118755277 14:68838632-68838654 TCCAGAAAGCCTGAGTGTCCAGG + Intergenic
1118948024 14:70406827-70406849 ACCCTGATCCCTGAGTTTTCAGG + Intronic
1119888650 14:78165691-78165713 TCCTTAAGGCCTGAGTGCTCAGG + Intergenic
1120208912 14:81615269-81615291 TCTCCAATCCCTGAGTTTTCAGG - Intergenic
1129209400 15:74058785-74058807 TCCCTCAAGCCTCAGTGTTCAGG - Intergenic
1129477815 15:75797942-75797964 TCCCTCAAGCCTCAGTGTTCTGG + Intergenic
1129735986 15:77963845-77963867 TCCCTCAAGCCTCAGTGTTCAGG - Intergenic
1129835877 15:78705214-78705236 TCCCTCAAGCCTCAGTGTTCAGG + Intronic
1130511469 15:84593411-84593433 TCCCTCAAGCCTCAGTGTTCAGG - Intergenic
1130543832 15:84840578-84840600 ACCCCAGACCCTGAGTGTCCGGG + Exonic
1132161578 15:99547788-99547810 TCCCAAAATGCTGAGAGTTCAGG - Intergenic
1133392326 16:5420631-5420653 TCCCCCAACCCTGAGTCTGCAGG + Intergenic
1136021720 16:27444781-27444803 ACCCTAAGCCCTGAGCTTTCTGG + Intronic
1139655879 16:68387068-68387090 TCCCAAAGCTCTGATTGTTCTGG - Intronic
1143752277 17:9037019-9037041 TCTTTAAATCATGAGTGTTCAGG + Intronic
1146527741 17:33581326-33581348 TGCCAACACCCTGAGTGATCCGG + Intronic
1146929677 17:36768397-36768419 TCCCTGAACCCTGAGACCTCCGG - Intergenic
1147129295 17:38397173-38397195 TCCCTAAAACCTCCGTGCTCTGG - Intronic
1147544436 17:41389750-41389772 ACCCCAGAACCTGAGTGTTCAGG + Intronic
1149406612 17:56358308-56358330 TCCCTAAACCCTGTGTGTCACGG - Intronic
1149464745 17:56868438-56868460 TCCCTAAACCCACAATGTTGAGG + Exonic
1153159708 18:2190090-2190112 TCCAAATACCCTGAGGGTTCAGG - Intergenic
1153456785 18:5291611-5291633 TTCCTGAACCCTGAGCGTTGTGG + Exonic
1155608064 18:27630794-27630816 TCGCTAATCTGTGAGTGTTCAGG + Intergenic
1155697665 18:28701925-28701947 TTCCTCAACCCAGTGTGTTCTGG - Intergenic
1156137432 18:34059644-34059666 TCCCTAAATCTGGAGTGGTCTGG + Intronic
1158363516 18:56704648-56704670 TCCCTTAGCACTGAGTTTTCTGG - Intronic
1159411245 18:68078072-68078094 TCCCAAAACCCTGGGTTTGCAGG - Intergenic
1160472696 18:79151867-79151889 CCCCTAAACCCAGAGTGAGCAGG + Intronic
1161667983 19:5588599-5588621 TCCCTAAGCCTTGGGTATTCAGG - Intronic
1162203117 19:9035669-9035691 TGCCTCAGCCCTGAGTGTGCAGG + Intergenic
1162393113 19:10401655-10401677 TCCTTAAATCCTGAGTCTCCTGG - Intronic
1162625554 19:11881816-11881838 TCCTTGAACCCTTAGTTTTCTGG + Intronic
1166704451 19:44900934-44900956 TCCCTCAGACCTGAGTGTCCAGG - Intronic
1167018561 19:46857896-46857918 TCCCAAAACGCTGAGTTTACAGG - Intergenic
1168249006 19:55130429-55130451 TCCCTCCACACTGAGTCTTCTGG - Intergenic
926534773 2:14098100-14098122 TTCGTTAACACTGAGTGTTCAGG + Intergenic
927098799 2:19770838-19770860 TCCATAATCCCTGAGTGTCAAGG - Intergenic
928403985 2:31000187-31000209 TCCCTAAACCCTGAGTGTTCTGG + Intronic
929727099 2:44441255-44441277 TCCCTACATCATGAGTTTTCAGG + Intronic
933638206 2:84730264-84730286 TCCCTAAACTCTAACTGTTGTGG - Intronic
933826178 2:86163034-86163056 TGTCTAGGCCCTGAGTGTTCTGG - Intronic
937280340 2:120713296-120713318 TCCCTGAATTCTGTGTGTTCAGG - Intergenic
938381822 2:130840619-130840641 TCCCTAGTTCCTGAGTGCTCAGG - Intronic
942375690 2:175334405-175334427 TGCCTAAATCCGGAGTGTTCTGG - Intergenic
944961663 2:204881879-204881901 TCCCTGAATCGTGAGTGTTCTGG + Intronic
946337075 2:219044976-219044998 TCCCCAAACCCTGACAGTTTTGG - Intergenic
946499337 2:220229168-220229190 TCCCTAAACCCACATTGTTCAGG - Intergenic
947900589 2:233718292-233718314 TCTCTAAACAGAGAGTGTTCAGG - Intronic
948507519 2:238439517-238439539 TCCCTGCACCCTGCGTGTTCTGG + Intronic
1171953779 20:31443607-31443629 TCTCTACTTCCTGAGTGTTCAGG + Intronic
1174103046 20:48141757-48141779 TCCCTAAGCCCTGAATTTGCAGG + Intergenic
1177788722 21:25698772-25698794 TCCTTAAACCATGTGTATTCAGG - Exonic
1178662591 21:34520050-34520072 GTCCTAAACCCTGAGCTTTCTGG - Intronic
1179659281 21:42864295-42864317 TCCATAAACGCTGAGTGTGCTGG + Intronic
1182924496 22:34109663-34109685 TCCATAAACCCTAAGTGGTCTGG - Intergenic
1184460579 22:44635473-44635495 CTCCTAAAGCCTGAGTGTTTTGG - Intergenic
1184585481 22:45445163-45445185 TGCCTGAACCCTGGGTGTTCAGG - Intergenic
952035498 3:29196082-29196104 AGCCTGAACCCTGAGTTTTCTGG + Intergenic
955251138 3:57283552-57283574 TTCCTAAACACAGAATGTTCGGG - Intronic
955533139 3:59895156-59895178 TCCCCAAACTCTGAATCTTCGGG + Intronic
957280867 3:78149715-78149737 TCCCCAAACCCTCTGTGGTCTGG + Intergenic
957402138 3:79730126-79730148 TCTCTAAACCATGATTGTTAGGG - Intronic
961929904 3:130522347-130522369 ACACTAAACCCTCATTGTTCTGG - Intergenic
962086656 3:132198512-132198534 TCCATAAACTCTTAGTATTCTGG - Intronic
962664870 3:137643807-137643829 TCCCTTAAACCTGATTATTCAGG - Intergenic
963435422 3:145259625-145259647 TTCCTAAATCCTGAGAGTTTTGG + Intergenic
964250236 3:154706958-154706980 TCCCAAATCACTGGGTGTTCAGG + Intergenic
964893634 3:161567421-161567443 TTTCTAAACCCTGTGTTTTCTGG + Intergenic
966851000 3:184164980-184165002 GCCCTAAACCCTGAGGATGCGGG + Intronic
967612656 3:191525994-191526016 TCCCTATCCTCTGATTGTTCAGG - Intergenic
973529394 4:51819558-51819580 TCCTTAAACCCTGACTTTTCTGG - Intergenic
975983764 4:80185061-80185083 TCTCTAATCCCCCAGTGTTCTGG + Intronic
976711428 4:88075556-88075578 TGCCTAAACCATGACTGATCTGG - Exonic
980162244 4:129179674-129179696 TCCCTAAACCAATATTGTTCAGG - Intergenic
985877009 5:2607562-2607584 TTCCCAAGCCCAGAGTGTTCTGG + Intergenic
989401557 5:41013128-41013150 TACCTAAACCTTGAGAATTCAGG + Intronic
991302609 5:65144207-65144229 TCCCTAGTCCCTGAGTGACCTGG + Intergenic
995662230 5:114498125-114498147 TCCCTAGTCCCCTAGTGTTCTGG - Intergenic
996132522 5:119798789-119798811 CCCCTGATCCCTGAGTTTTCAGG + Intergenic
997512105 5:134460953-134460975 TCCCTGAACACTGAGGGGTCAGG + Intergenic
997512108 5:134460955-134460977 TCCCTGACCCCTCAGTGTTCAGG - Intergenic
999105485 5:149067322-149067344 ACCCTAAACTCTGAGTCTTCAGG - Intergenic
999858385 5:155619700-155619722 TCCCTGATTCCTGAGTCTTCAGG - Intergenic
1001152190 5:169241697-169241719 TCCCAAAACCATGACTGTTGAGG - Intronic
1003246314 6:4385229-4385251 TCCTCAAACCCTCAGTTTTCTGG + Intergenic
1003279737 6:4680968-4680990 TCCCAAAACGCTGAGATTTCAGG - Intergenic
1006676933 6:35771334-35771356 TCCCTACAACCTCTGTGTTCAGG - Intergenic
1008960463 6:57260953-57260975 TCCCTCAACCACCAGTGTTCTGG - Intergenic
1009629253 6:66172990-66173012 TCCTCAAACCCTCAGTTTTCTGG - Intergenic
1010098521 6:72075766-72075788 TCCTTTAACCCTCAGTGTTATGG - Intronic
1011212238 6:84967196-84967218 TCCTTGAACCCTTAGTTTTCTGG - Intergenic
1013658356 6:112268991-112269013 TCCCCAGACACTGACTGTTCTGG + Intergenic
1014543827 6:122708889-122708911 TCCCAAAACCCTGAGATTACAGG + Intronic
1014725254 6:124964279-124964301 TTTCAAAACCCTGTGTGTTCAGG + Intronic
1015660710 6:135570844-135570866 TCCGTAAGCTCTGAGGGTTCAGG - Intergenic
1018267946 6:162045366-162045388 TTCCCAAACCCTGAGTATTAAGG + Intronic
1020068128 7:5205419-5205441 ATGCTAAACACTGAGTGTTCTGG - Intronic
1021413269 7:20352749-20352771 ACCCTAAACACAGAGTATTCTGG - Intronic
1023410743 7:39886815-39886837 TCCCAAAACGCTGAGATTTCAGG + Intergenic
1024314754 7:48005223-48005245 TCCCTAAAGCATGAGTGTTGGGG - Intronic
1026569285 7:71515286-71515308 TCCCTCAACCCTGAGTCCACTGG + Intronic
1027526031 7:79269916-79269938 TCCATAATCCCTGACTGCTCAGG + Intronic
1028763137 7:94517803-94517825 TCCCTAAAACCTTAGTGGGCAGG - Intronic
1031417426 7:121510162-121510184 TCCTCAAACCCTCAGTCTTCTGG - Intergenic
1033552918 7:142463753-142463775 TTCCTATGCCCTGAGTGTGCCGG + Intergenic
1036753933 8:11460202-11460224 TGCCTAAAGCCGGAGTGTTAGGG - Intronic
1037480783 8:19303264-19303286 TCTCTAAACACAGAATGTTCTGG - Intergenic
1038255035 8:25943206-25943228 TCCCAAAACCCTGAGATTACAGG - Intronic
1038458115 8:27691825-27691847 TACCTGAAACCTGAGTGATCTGG - Intergenic
1039689847 8:39851692-39851714 TCCTTAAACCCTCAATCTTCTGG - Intergenic
1039729387 8:40257762-40257784 TCCCTGATCCCTGAGTTTTGGGG - Intergenic
1041496237 8:58488152-58488174 TCCCTAAATCCTCACTGTTTGGG - Intergenic
1042383016 8:68140711-68140733 TCCCTCAACCCTGTGAGTTAGGG - Intronic
1045116628 8:98989943-98989965 TCCCTTGACCCAGAATGTTCAGG - Intergenic
1045759574 8:105588306-105588328 TCCATAAACCGTGAGTATTTTGG - Intronic
1049267235 8:141674769-141674791 GCCCCACACCATGAGTGTTCAGG - Intergenic
1052303136 9:26975419-26975441 TCCTCAAACCCTCAGTTTTCCGG - Intronic
1055117703 9:72623534-72623556 TCCAGAAAACCTGAGTTTTCAGG + Intronic
1057596674 9:96420263-96420285 CCCCTAAACCCTGAAAGTTTTGG - Intergenic
1060474767 9:123978439-123978461 TCTCCAAGCCCTGAGTTTTCTGG - Intergenic
1060476595 9:123991684-123991706 TCTCCAAGCCCTGAGTTTTCTGG + Intergenic
1061649029 9:132031196-132031218 TCCCTAAACCCTGAGCCTCTAGG - Intronic
1186125220 X:6406036-6406058 TCCTTATACACTCAGTGTTCTGG + Intergenic
1186397781 X:9227036-9227058 TCCCTAAACCTTAAATGTTGCGG + Intergenic
1186711256 X:12199804-12199826 ACCCCAATCCCTGAGTTTTCAGG - Intronic
1187027765 X:15454035-15454057 TCCCTAAAACCTCAGAGTCCTGG + Intronic
1188048312 X:25453384-25453406 AGCCTAAAACCTGAGTTTTCAGG + Intergenic
1189633169 X:42976280-42976302 TCCCAACACCCTGAGGGATCTGG + Intergenic
1196763218 X:119218960-119218982 TCCACAAGCCCTGAGTGGTCAGG - Intergenic
1201910424 Y:19128261-19128283 TCCTCAAACCCTCAGTTTTCTGG + Intergenic
1201973020 Y:19816747-19816769 TCCTTAAACCCTGAATTTTCTGG - Intergenic
1202331262 Y:23755874-23755896 TTCCAAAGCCCTGAGTGTACAGG - Intergenic
1202539508 Y:25914186-25914208 TTCCAAAGCCCTGAGTGTACAGG + Intergenic