ID: 928407663

View in Genome Browser
Species Human (GRCh38)
Location 2:31027098-31027120
Sequence GATGAGAAACTAGGAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928407660_928407663 1 Left 928407660 2:31027074-31027096 CCATCTGGCACTGTATCCAGGTA 0: 1
1: 0
2: 0
3: 7
4: 117
Right 928407663 2:31027098-31027120 GATGAGAAACTAGGAAACACAGG 0: 1
1: 0
2: 0
3: 18
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928407663 Original CRISPR GATGAGAAACTAGGAAACAC AGG Intronic
900311197 1:2033979-2034001 GATGAGGAAGGAGGAAAAACAGG + Intergenic
900422445 1:2561441-2561463 GAAGAGAAACAAGGAGAGACTGG - Intronic
904907959 1:33912272-33912294 GAAGAGAGACTGGGAACCACTGG + Intronic
907230248 1:52991157-52991179 GATAAGAAACTAGGATTAACTGG - Intronic
908666899 1:66503208-66503230 GATGATAAACTGAGAAACAAAGG + Intergenic
910778793 1:90903859-90903881 AATTAGAGAATAGGAAACACTGG + Intergenic
912835872 1:112995948-112995970 GGTGAAGAACTAGGAAACAGTGG - Intergenic
914695765 1:150078045-150078067 GAGGAGACAGAAGGAAACACAGG - Intronic
915371299 1:155353005-155353027 AATGAAAAATCAGGAAACACTGG + Intronic
917477240 1:175379273-175379295 GATGAGAACCTGGGAGACAGAGG + Intronic
918628006 1:186680589-186680611 AATGAGAAAATCGGAAACCCAGG + Intergenic
918822471 1:189272398-189272420 GTTGAGGGACTAGGAAGCACTGG - Intergenic
918944938 1:191051605-191051627 GATGAAAAACTTTGAAACTCAGG + Intergenic
920288745 1:204901376-204901398 AATGAGAAAGGAGGAAACCCGGG + Intronic
920683976 1:208095182-208095204 GTTTAGAAAGAAGGAAACACAGG - Intronic
921037180 1:211391916-211391938 GATGAGGAAGAAGGAAACATAGG - Intergenic
921071988 1:211668059-211668081 GAAAAGAAATTATGAAACACTGG + Intronic
921570076 1:216767198-216767220 TATGAGTAACTAGGAAAGAAAGG - Intronic
922432184 1:225566077-225566099 GCCAAGAAATTAGGAAACACTGG - Intronic
923015529 1:230123815-230123837 GCTGAGAGACTAGCAAACAAAGG - Intronic
1063833303 10:9982230-9982252 GATGAGAAAAGAGGAAATATAGG + Intergenic
1064018906 10:11793878-11793900 GATCAGAAACCAGCAAACATGGG + Intergenic
1064410237 10:15098155-15098177 GGTGAGAAACTAGGAAAGGTGGG - Intronic
1064625424 10:17256517-17256539 GATGAGGTTCTGGGAAACACTGG + Intergenic
1066182527 10:32977229-32977251 GATTATAAATTAGGAAACATAGG + Intronic
1068911807 10:62386460-62386482 GTTGGGAAACTAGAAAAAACAGG + Intronic
1070207511 10:74278542-74278564 GATGATCAACTAGGAAAGAAAGG - Intronic
1072457046 10:95585644-95585666 GATGAGAATCTCCCAAACACAGG + Intergenic
1073569339 10:104563291-104563313 GATGAGAAGCTGGGAGACCCAGG + Intergenic
1074206565 10:111287922-111287944 GAAGAGAATCTAGCTAACACAGG - Intergenic
1074373479 10:112919764-112919786 GATAACAAACGAGGAGACACAGG + Intergenic
1074642096 10:115397682-115397704 GAAAAGAAAATAGGAAACAAGGG + Intronic
1076122411 10:127946735-127946757 GAAAAGAAACAAGGAATCACAGG + Intronic
1077473291 11:2774866-2774888 GATGAGAAAGGAGGAAGCTCAGG - Intronic
1077826377 11:5812742-5812764 GATAATCAACAAGGAAACACTGG + Intronic
1079489131 11:20967920-20967942 GATGGGAAAAGAGTAAACACTGG - Intronic
1079506889 11:21163096-21163118 CTTGAGAAATTTGGAAACACTGG + Intronic
1080957674 11:37119362-37119384 CATGAGAAACCATGAAACAGAGG + Intergenic
1082995813 11:59254469-59254491 GATGTGAAACCAGGAAACCAGGG - Intergenic
1083655519 11:64227311-64227333 TGTGAGAAACTAGAAAACACGGG + Intronic
1083904137 11:65659194-65659216 GATGGGAAACCAGGATAAACTGG - Intronic
1084179899 11:67441022-67441044 GCAGAGAAGCTAGGAACCACAGG + Intronic
1084311309 11:68317709-68317731 GGTGACAAACTAGGACAAACTGG - Intronic
1086105432 11:83141829-83141851 GTTGGGGAACCAGGAAACACTGG + Intergenic
1087024515 11:93636568-93636590 GATGGGAAAGTAGGAAGCATTGG - Intergenic
1087514379 11:99139331-99139353 GCAGAGAAACTTGCAAACACAGG + Intronic
1088546317 11:110962910-110962932 GATCACAAACTAGCAAACAGAGG + Intergenic
1088549846 11:111001633-111001655 GAAGTGAACCCAGGAAACACTGG + Intergenic
1088559884 11:111103483-111103505 TATAAGAAACTAGAAAACAATGG - Intergenic
1088964454 11:114703927-114703949 GATAATAAAGTAGGAATCACTGG - Intronic
1090000302 11:122950508-122950530 GATGAGAACCTAGGAATGAATGG - Intronic
1090085327 11:123645488-123645510 GATGCCAAGCTAGCAAACACTGG - Intronic
1092510267 12:9147641-9147663 GATGACAGAGTAGGAAACCCTGG - Intergenic
1093316823 12:17662665-17662687 GAGGAGAAATGAGAAAACACAGG + Intergenic
1093893250 12:24548591-24548613 GCTGTGAAACATGGAAACACTGG + Intergenic
1095361465 12:41346099-41346121 GCTTATAAACTAGGAAACATTGG - Intronic
1095666294 12:44803115-44803137 GATGAGTAACAAGTAAACACTGG + Intronic
1097505939 12:60470140-60470162 TATGAGAAAATAACAAACACAGG - Intergenic
1099058102 12:77870627-77870649 GATGAGAATCTACCACACACTGG + Intronic
1099460473 12:82915141-82915163 GATGAGAAACTAAGAGAGGCAGG + Intronic
1099741802 12:86647066-86647088 GATGAGAGACATGGAAACATCGG + Intronic
1101245848 12:102883873-102883895 AATGGGAAACTAGGGAACAGAGG - Intronic
1101493762 12:105235100-105235122 GTTGAGACACTAGGAAATAAAGG + Intronic
1106964248 13:35039820-35039842 GATGAGAAAAGAGGAAGCAAAGG - Intronic
1107022195 13:35763858-35763880 GGTGGGAAATTTGGAAACACAGG + Intergenic
1107315760 13:39129990-39130012 GATGAGAGAATAGAAAGCACAGG - Intergenic
1107407123 13:40125389-40125411 GCTGAGTAATGAGGAAACACAGG + Intergenic
1107995944 13:45861122-45861144 CAGGAGAAACCAGGAGACACAGG - Intergenic
1109495266 13:63162065-63162087 GTGGAGAAAATAGAAAACACAGG - Intergenic
1110036595 13:70693772-70693794 GATGACAGAATAGGAAGCACTGG - Intergenic
1110386856 13:74922356-74922378 GCTGAGTAACTATGAAACAAGGG - Intergenic
1110744648 13:79038330-79038352 GATGAGAAATCTGAAAACACTGG - Intergenic
1112151716 13:96771913-96771935 GATGAAATACTATGAAATACAGG + Intronic
1114072850 14:19128469-19128491 GATGAGAAAAGAGGAAGCAAAGG - Intergenic
1114089410 14:19271503-19271525 GATGAGAAAAGAGGAAGCAAAGG + Intergenic
1114904660 14:27112030-27112052 AATGAGAAATAAGAAAACACTGG - Intergenic
1115097957 14:29661582-29661604 CCTGAGAAAGTAGGAAACATTGG - Intronic
1115605498 14:34997779-34997801 TATGAGGAACTAGGAAAAAAAGG - Intronic
1116500172 14:45611399-45611421 CATTAGAAACAAGGAAACAAAGG - Intergenic
1116641381 14:47467945-47467967 GAGCAGAAAATGGGAAACACTGG + Intronic
1117960722 14:61159300-61159322 GATGAGAAATGAGGAATGACAGG + Intergenic
1118003445 14:61544300-61544322 AATGAGATACTCGGGAACACTGG - Intronic
1119233856 14:73003419-73003441 GATGAGATTATAGGAAACAAAGG - Intronic
1119947358 14:78709074-78709096 CATGAGAAACAATGAGACACAGG - Intronic
1120495711 14:85232368-85232390 GATAAGCAATAAGGAAACACAGG - Intergenic
1121189420 14:92012443-92012465 GAAGAAAAACTAGTAAGCACAGG + Intronic
1122563609 14:102635133-102635155 TAAGAAAAACTAGGAAACATTGG - Intronic
1122668580 14:103352532-103352554 GATGATAAAGTTGGATACACGGG - Intergenic
1124693416 15:31844610-31844632 TATGAGGAACCAGGAGACACAGG - Intronic
1125009448 15:34855074-34855096 GACGCGATACTAGGAAACCCAGG - Exonic
1125160333 15:36635942-36635964 GAAGAGAAACTAAGAAACAGAGG + Intronic
1125319293 15:38466405-38466427 GAAAGGAACCTAGGAAACACCGG + Intronic
1125331636 15:38588391-38588413 GATGAAATACAAGGAAACGCAGG + Intergenic
1125354824 15:38805879-38805901 GATGAGCAATTAGAAAACAAAGG + Intergenic
1126772844 15:52074918-52074940 GTTGAGAAACTAGAAAATGCAGG + Intergenic
1127319943 15:57833964-57833986 GATGAGAAACTAGGCATCGAAGG + Intergenic
1128691985 15:69731641-69731663 CATGGGAAACTGGGAACCACTGG + Intergenic
1129651694 15:77495771-77495793 GATGAAAAACTAGGAATAAGGGG - Intergenic
1130570605 15:85039949-85039971 GATGGGAAAAGAGGATACACTGG + Intronic
1130997182 15:88910440-88910462 GATGATCATCCAGGAAACACTGG + Intronic
1131473687 15:92717818-92717840 TATGAGAAAGTAGGATCCACAGG - Intronic
1132955420 16:2590093-2590115 GATGAGAAGCCAGGGGACACAGG - Intronic
1134405031 16:13949446-13949468 GGTGAGAAATGAGGAATCACAGG - Exonic
1139411649 16:66766433-66766455 GATGAAAAAAGAGGAAATACCGG + Intronic
1140964104 16:79947504-79947526 GATGAGAAATTAAGTAAGACAGG + Intergenic
1141108043 16:81249730-81249752 GCTGGGAAAATAGGAAACCCAGG + Intronic
1143301931 17:5916864-5916886 AATGAGGAACAAGGAAACAGAGG - Intronic
1143767890 17:9149619-9149641 GAGGGTAAACTAGGAAACCCTGG + Intronic
1144378106 17:14665593-14665615 GATGAGAAACAGAGAAAAACAGG + Intergenic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1146439909 17:32884869-32884891 GTTGAGAAACTGAGAAACTCTGG - Intergenic
1147546229 17:41404044-41404066 GATGTGAACTTAAGAAACACAGG + Intergenic
1149088393 17:52749211-52749233 GATGCACAATTAGGAAACACAGG - Intergenic
1151115849 17:71733977-71733999 GGTGAGAAACAAGGAAAAAAGGG - Intergenic
1151927431 17:77209213-77209235 GCTGAGAAAATGGAAAACACTGG - Intronic
1151976843 17:77488120-77488142 GATGACAACCAAGGAGACACCGG - Intronic
1152097407 17:78280012-78280034 GATGAGCAAGGAGGACACACCGG + Intergenic
1153364004 18:4233147-4233169 GATCAAAAACTAGGAAATGCTGG + Intronic
1154163531 18:11997309-11997331 GAGCAGGAACTAGGAAACCCTGG + Intronic
1154394360 18:13973342-13973364 TATGAGAAACTTGGGAACAAAGG + Intergenic
1157149186 18:45198070-45198092 GATGTGAAATTAGGAAGCATTGG + Intergenic
1159424605 18:68269168-68269190 GATGAGGCAATAGTAAACACGGG - Intergenic
1159573328 18:70144888-70144910 AATGAGAAAGTACAAAACACAGG + Intronic
1165694245 19:37888506-37888528 GAAGAGAAACTAGCAAAGAAAGG - Exonic
925076709 2:1022570-1022592 AATCAGAAACTCGGAATCACAGG - Intronic
925287140 2:2723156-2723178 GATGAGAAACTGTGAAACTTAGG - Intergenic
927208785 2:20626268-20626290 GAGGAGAAACTATGAAAGCCAGG + Intronic
928407663 2:31027098-31027120 GATGAGAAACTAGGAAACACAGG + Intronic
928656328 2:33455519-33455541 GGTGAGATACTAGGAAACTATGG - Intronic
928714406 2:34043843-34043865 GATAAGAAAATATGAAAAACTGG - Intergenic
929317473 2:40497239-40497261 GATGAGAAACTAGAAGAAAATGG - Intronic
930309447 2:49720005-49720027 GATGAGATGCTAGAAAACATTGG - Intergenic
932437753 2:71712647-71712669 GAGGAGTATGTAGGAAACACAGG + Intergenic
932793266 2:74673923-74673945 GCAGAGAAAATAGGAGACACAGG - Intronic
933203770 2:79481350-79481372 AATGAGAAAGTAGGAGACAGAGG - Intronic
933584601 2:84167150-84167172 GATGAGAGACTTGTAGACACAGG - Intergenic
933592362 2:84247214-84247236 CATGAACATCTAGGAAACACGGG - Intergenic
933711777 2:85331900-85331922 GAAGAGAAAATAAGAATCACAGG + Intergenic
933815417 2:86064308-86064330 GATGAGGAACTGAGACACACAGG + Intronic
934151093 2:89148291-89148313 GCAGAGAAACTAGGAAAGAAGGG - Intergenic
936167004 2:110129627-110129649 GAGCAGAAACTAGGAAGCATTGG + Intronic
937525856 2:122769124-122769146 GATCTGAAACTATGAAATACTGG - Intergenic
938103350 2:128513062-128513084 GATTGGAAACTTGGAAACCCAGG - Intergenic
940059922 2:149553672-149553694 CCTGAGAAGCTAGGAAGCACAGG - Intergenic
942367891 2:175248145-175248167 GAAGAGAATCAAAGAAACACAGG + Intergenic
944068402 2:195643655-195643677 GATGAGAAAGGAGGAGAAACTGG + Intronic
947765008 2:232632458-232632480 GTTGAGAATCTTGTAAACACGGG - Intronic
948027804 2:234791695-234791717 GGAGAGAAACTAGGAAACAGGGG + Intergenic
1170195089 20:13681307-13681329 CATTAGGAACTAGGAAACCCAGG - Intergenic
1170578206 20:17680646-17680668 GATAAGAAACTAGGATTCAGAGG + Intronic
1172016260 20:31875474-31875496 GATCAGTAACTAGGAAAGAGTGG - Intronic
1172353517 20:34262402-34262424 GAATGGAAAATAGGAAACACAGG + Intronic
1175012160 20:55749106-55749128 GATGACATACATGGAAACACTGG + Intergenic
1175240512 20:57544670-57544692 GAAGAGAATCTTGGAATCACAGG - Intergenic
1175284393 20:57828367-57828389 GTTGAGAAAATAGGAATGACTGG + Intergenic
1175532536 20:59684037-59684059 GATGAGAACCTTGGAAAGAAAGG + Intronic
1176229207 20:64023095-64023117 GCTGAGAAACAAGGAACCCCGGG + Intronic
1177786606 21:25678395-25678417 GAAGAGAAGCTAGGAAATAAAGG + Intronic
1178124187 21:29499566-29499588 GTTGAAAAAACAGGAAACACTGG + Intronic
1178365374 21:31985571-31985593 GAGGAGAAACTGGCAAAGACAGG + Intronic
1178827322 21:36027808-36027830 GATGAGAAGCTAGGAGTCACAGG + Intergenic
1180491296 22:15850844-15850866 GATGAGAAAAGAGGAAGCAAAGG - Intergenic
1184756622 22:46519685-46519707 GCAGAAAAACCAGGAAACACTGG + Intronic
955187827 3:56732059-56732081 GATGAGAAACTGAGAATCACAGG + Intronic
956569098 3:70673964-70673986 GATGGGAATCTGGAAAACACTGG - Intergenic
956968268 3:74489599-74489621 GAACAGAAACTAGGAAACTAGGG - Intronic
959121356 3:102236392-102236414 GATGATAAACTGGCAAACACTGG - Intronic
959204315 3:103284871-103284893 GACAAGAAACTGGGAAATACTGG - Intergenic
959719584 3:109471482-109471504 GATGAAAAACTGGGAACCATTGG + Intergenic
959854028 3:111127133-111127155 GAAGAGAACCTAAGAAACTCAGG + Intronic
960714947 3:120565658-120565680 GAAGAGTAGCTAGGAAACACAGG + Intergenic
960798982 3:121518708-121518730 GAAGAGAAATTAGGAAATCCAGG - Intronic
961406082 3:126680405-126680427 GATCAGAAACTAGGAGTCACTGG + Intergenic
961849603 3:129802384-129802406 GATGGTGAACTAGGAAACATAGG + Intronic
962648714 3:137466510-137466532 GATGTGAAAATAGGCAAAACAGG + Intergenic
962929480 3:140023487-140023509 GATGGGAACCTCTGAAACACAGG + Intronic
963658887 3:148098341-148098363 GATTAGCAACTAGGAAATAACGG - Intergenic
966211628 3:177459405-177459427 GAACAGAAACAGGGAAACACAGG + Intergenic
968250612 3:197208264-197208286 GATGAGGACATAGGAAAAACAGG + Intronic
969070817 4:4537225-4537247 AATGAGAAACTAGAAAATGCAGG - Intronic
969702452 4:8774987-8775009 GATGAGAGACCAGCAACCACGGG + Intergenic
970648222 4:18147523-18147545 GAGGAGAAATTTGGACACACGGG - Intergenic
971254412 4:25001173-25001195 TCTGGGAAACCAGGAAACACAGG - Exonic
973219314 4:47707701-47707723 GATGAGAAAATAGGAAAGGGTGG + Intronic
973864705 4:55100500-55100522 GATGCCTAACTAGGTAACACTGG - Intronic
973897565 4:55430038-55430060 GATGAGAAAACAGAACACACAGG + Exonic
974609389 4:64196022-64196044 GATGGGAGACTAGGAAAGACGGG - Intergenic
975061741 4:70011537-70011559 AATGAAAAACTACAAAACACTGG - Intergenic
975628497 4:76374498-76374520 GATGAAAAAAATGGAAACACAGG - Intronic
978654994 4:111054507-111054529 AATAATAAACAAGGAAACACTGG + Intergenic
979040898 4:115792624-115792646 GATAACAGAGTAGGAAACACAGG - Intergenic
980603712 4:135061152-135061174 GATGAGAAAAGAGGAAAAATAGG - Intergenic
980857375 4:138455654-138455676 GCTGACAGACTGGGAAACACCGG - Intergenic
981108283 4:140905930-140905952 GAGGAGAAATTAGGAGACAGAGG + Intronic
981537444 4:145814582-145814604 GAGGTGAGACCAGGAAACACTGG - Intronic
982246617 4:153359177-153359199 GATGAACAAGTAGGAAACAGCGG - Intronic
982258201 4:153470188-153470210 GATGAGAAAACAGGACAAACAGG - Intronic
983126089 4:163951953-163951975 AATGAAAAACAAGGAAACACGGG - Intronic
983317965 4:166156314-166156336 AATGAGATAATAGGAAAAACAGG + Intergenic
983672091 4:170249138-170249160 GGTGAGAAAATAGGAAAAAATGG - Intergenic
983763327 4:171442117-171442139 GATTAGGAACAAGGAAAAACTGG + Intergenic
983832449 4:172344906-172344928 GACGTGGAACTAGGAAAGACAGG - Intronic
983982286 4:174013207-174013229 GATGAGAAAATTGGAAACATAGG - Intergenic
984307319 4:178010290-178010312 GAGGAAAAACTATAAAACACTGG - Intergenic
985120053 4:186631253-186631275 GATGAGACACTAGGATACTGCGG - Intronic
986060592 5:4186578-4186600 TATGAGAAACTGGGACACAAAGG + Intergenic
986627335 5:9734717-9734739 GATGAGAAACTAAGACAACCTGG + Intergenic
987548724 5:19349629-19349651 GATGTCAAAAGAGGAAACACAGG + Intergenic
988382717 5:30518713-30518735 GATGAGAAACCAAGAAAAATTGG + Intergenic
989467744 5:41776455-41776477 GATGAAAAACAAAAAAACACAGG - Intronic
990020142 5:51116721-51116743 GATGAGAAACTCTGAATCAAGGG - Intergenic
990277385 5:54212504-54212526 GCTGAGAAAACAGGGAACACAGG + Intronic
991446904 5:66709960-66709982 GATGGGCCACTAGAAAACACTGG - Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993249267 5:85496120-85496142 GAGGAGAAACTATAAGACACTGG + Intergenic
993531916 5:89035680-89035702 GATGATAAACTATGAGACCCAGG - Intergenic
998099563 5:139421108-139421130 CATGAGAAGCTGGGAAACAGAGG + Intronic
998771475 5:145550683-145550705 AATAAGAAACTAGGAAACCAAGG + Intronic
998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG + Intronic
999240571 5:150125046-150125068 GATGAGATACCAGGAAAGACAGG - Intronic
999743471 5:154574396-154574418 GAGGGGAAATCAGGAAACACAGG - Intergenic
1000014987 5:157268030-157268052 GATGAGAAACTTGTGTACACAGG + Intronic
1001223256 5:169921620-169921642 GAGGTGAAACTGGAAAACACTGG - Intronic
1001364666 5:171124076-171124098 GATAAGATACAAGAAAACACAGG + Intronic
1001461235 5:171916536-171916558 GATGAAGAACAAGGAAACAAAGG + Intronic
1006228844 6:32564776-32564798 AAGGAGAAACGAGGAAATACAGG - Intronic
1007627296 6:43253770-43253792 GAGGAGAAACCAGGAGACCCAGG - Intronic
1009985515 6:70777687-70777709 GAAGAAAACATAGGAAACACTGG - Intronic
1010624895 6:78126065-78126087 AAAGAGAAACTAGGAAATACTGG - Intergenic
1011023558 6:82841129-82841151 GATGTTAAAATAGGAAAAACTGG + Intergenic
1011818814 6:91225715-91225737 GGTGAGGAACTAAGAAGCACAGG + Intergenic
1013158520 6:107519104-107519126 GGAGAGAAATTAGGAGACACTGG + Intronic
1013158762 6:107521186-107521208 GGAGAGAAATTAGGAGACACTGG - Intronic
1013740530 6:113278629-113278651 AGTGAGAAACTAGGCAACAGTGG + Intergenic
1014066628 6:117134592-117134614 AATGAGAAACTAGGGAAGAGAGG + Intergenic
1014660128 6:124159709-124159731 AAGGAGGAACTAGGAAACAAAGG + Intronic
1016316677 6:142796979-142797001 GATGAGAGACATGTAAACACAGG - Intronic
1016510979 6:144842713-144842735 AATGAAAACCTGGGAAACACTGG - Intronic
1019170952 6:170132930-170132952 AATGAGAAACTGAGAAACGCAGG - Intergenic
1021321940 7:19223134-19223156 GAAGAGACACTGGGAGACACTGG - Intergenic
1026403118 7:70036507-70036529 GGTGGGAAACTAGGAAACCAAGG - Intronic
1026591352 7:71698688-71698710 GAGGAGAAAGAAGGAAACAGAGG + Intronic
1027610846 7:80358777-80358799 AAAGTAAAACTAGGAAACACTGG - Intergenic
1030760383 7:113342792-113342814 GATGAGACAATAGGAAGCAGAGG - Intergenic
1031402229 7:121339136-121339158 GATAAGAAACTGGGAATCCCAGG + Exonic
1031491212 7:122391470-122391492 GATGAGAAATTAGGAAGAAAAGG + Intronic
1032189901 7:129758866-129758888 GATGATAAACTACGTAACAGAGG - Intergenic
1032417760 7:131750372-131750394 GAGAAGGAACTAGGAAACAAGGG + Intergenic
1033714801 7:143989178-143989200 TCTGAGAAACTAGGACACAAAGG + Intergenic
1033974300 7:147081269-147081291 GATGAGGAACTATGAGACAGTGG - Intronic
1035108941 7:156464356-156464378 GTTGAGAGAAAAGGAAACACCGG - Intergenic
1036183048 8:6601274-6601296 GACTAGAAACTGGGAAGCACAGG - Intronic
1038393379 8:27226557-27226579 GATGAGAAACAAGAATACCCAGG + Intergenic
1038651087 8:29403847-29403869 CATGAGAAATTAGGAACTACGGG - Intergenic
1039121574 8:34153621-34153643 GATGTGAAATTGGGAGACACAGG - Intergenic
1039247074 8:35620762-35620784 CAACAGAAACTAGGAAACTCAGG - Intronic
1039297567 8:36173126-36173148 GGTGAGAAATTAGGTTACACAGG + Intergenic
1042093611 8:65187474-65187496 GATGAGAAAGAAGAAAAAACTGG - Intergenic
1042345847 8:67727269-67727291 AATGAGAAAATAGGATACAAAGG - Intronic
1042699418 8:71595795-71595817 CAGGAGAATCTAGGAAAAACAGG + Intergenic
1044023505 8:87138124-87138146 GATGAGAGACCAAGAAAAACAGG - Intronic
1044928441 8:97229187-97229209 GATGAGAGCCAAGGAAACAAAGG + Intergenic
1045696303 8:104812377-104812399 GATTAGAGACAAGGAAACTCAGG - Intronic
1046863979 8:119125543-119125565 GAAAGGAAACTGGGAAACACAGG + Intergenic
1047632500 8:126723623-126723645 GATGGAAAACTAGGAAACAGAGG + Intergenic
1047882753 8:129214690-129214712 GAAAAGAAAGTAGGAAACACTGG - Intergenic
1051832360 9:21294245-21294267 CATGAAAGACTAGGAAAGACTGG - Intergenic
1052198773 9:25751600-25751622 GATGAGAAACTAAGTTACACAGG + Intergenic
1053150207 9:35738472-35738494 GGTGAGAAACTGGGCAACAAGGG - Intronic
1055123631 9:72692510-72692532 GATGACAAAATAGGAAGCCCTGG - Intronic
1059845087 9:118266544-118266566 GATAAGAACCTAGGAAAATCTGG + Intergenic
1061445691 9:130635973-130635995 GTTGACAAAGGAGGAAACACAGG - Intronic
1187489323 X:19736329-19736351 AATGGGAAACCTGGAAACACAGG + Intronic
1187740672 X:22352178-22352200 GATGAGTCACTGTGAAACACTGG + Intergenic
1188113775 X:26220608-26220630 TAGGACACACTAGGAAACACCGG - Intergenic
1189115550 X:38338746-38338768 GGTGAGAAACTAGGGAAGAGAGG + Intronic
1190016689 X:46833665-46833687 GAGGAGGCACTGGGAAACACAGG + Intergenic
1192043469 X:67647014-67647036 GATGAGAAAATAGAAAAGAAAGG - Intronic
1193641567 X:84015184-84015206 AATGAGAAACTAGCAAAAAAAGG + Intergenic
1193737748 X:85180077-85180099 GATAAGAAACTATAAAACACAGG + Intergenic
1194948826 X:100100466-100100488 CATGAAAAACAAGGAAAGACTGG + Intergenic
1195617964 X:106927985-106928007 TATGAGAAACCAGAAAACGCTGG - Intronic
1196910928 X:120483549-120483571 GAAGAGAAACTTGGAAAGAATGG - Intergenic
1197058322 X:122147375-122147397 AATAACAAACTAGGAAATACAGG + Intergenic
1197931776 X:131703795-131703817 GCAGGCAAACTAGGAAACACAGG - Intergenic
1197994238 X:132354946-132354968 TTAGAGAAAGTAGGAAACACTGG + Intergenic
1198284153 X:135173248-135173270 AATGAAAAATTAGGACACACAGG + Intergenic
1198810191 X:140528123-140528145 GATGTGAAACAATGAAAAACTGG - Intergenic
1202047199 Y:20747158-20747180 GAAGAGAAGCTAGAAACCACAGG + Intergenic