ID: 928410563

View in Genome Browser
Species Human (GRCh38)
Location 2:31051015-31051037
Sequence ACCTCGGAGAAACCACCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928410557_928410563 22 Left 928410557 2:31050970-31050992 CCCACAGAGATGAAGTCAAGGAA 0: 1
1: 0
2: 0
3: 24
4: 259
Right 928410563 2:31051015-31051037 ACCTCGGAGAAACCACCTTCAGG 0: 1
1: 0
2: 4
3: 30
4: 220
928410558_928410563 21 Left 928410558 2:31050971-31050993 CCACAGAGATGAAGTCAAGGAAT 0: 1
1: 0
2: 3
3: 18
4: 224
Right 928410563 2:31051015-31051037 ACCTCGGAGAAACCACCTTCAGG 0: 1
1: 0
2: 4
3: 30
4: 220
928410560_928410563 -6 Left 928410560 2:31050998-31051020 CCAAGAGATGCTGCGCCACCTCG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 928410563 2:31051015-31051037 ACCTCGGAGAAACCACCTTCAGG 0: 1
1: 0
2: 4
3: 30
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928410563 Original CRISPR ACCTCGGAGAAACCACCTTC AGG Intronic
900389375 1:2427384-2427406 ATCCCGGAGAAACCACCAGCAGG - Intronic
902051812 1:13569112-13569134 ACCTAGGAGGAACACCCTTCAGG + Intergenic
904571290 1:31467742-31467764 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
905346533 1:37314934-37314956 AGCTTGCACAAACCACCTTCAGG + Intergenic
906186522 1:43866230-43866252 ACCTGGGAGAAGCCATCTTTTGG + Intronic
906582488 1:46947612-46947634 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
906583255 1:46953792-46953814 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
907505825 1:54917514-54917536 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
908867017 1:68559792-68559814 AGCTCAGTGAAACCCCCTTCAGG + Intergenic
910590743 1:88926303-88926325 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
915000255 1:152582898-152582920 ACCTCAGATAAAGCACCTCCTGG + Intronic
916232331 1:162552849-162552871 ACATCTGAGAAACCATCTTGTGG + Intergenic
916667632 1:166980898-166980920 AGCTCTGAGAAACAATCTTCTGG - Intronic
917311932 1:173687873-173687895 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
919559176 1:199096359-199096381 ACCTAGGATGAACCCCCTTCAGG + Intergenic
919563330 1:199152135-199152157 TCCTCAGAGAAACCAGCTCCAGG + Intergenic
920425370 1:205870842-205870864 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
921357915 1:214303903-214303925 ACCCCGGTGAAGCCAGCTTCTGG - Intronic
924859216 1:247904142-247904164 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1065810338 10:29437386-29437408 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1065930857 10:30477364-30477386 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1068791988 10:61039033-61039055 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1069364742 10:67685473-67685495 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1069861659 10:71475481-71475503 ACCTCTGAAAAGCGACCTTCAGG + Intronic
1071283285 10:84122621-84122643 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1071327171 10:84529004-84529026 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1071346947 10:84702063-84702085 CCCTCTGAGAAGCCACCTTGGGG - Intergenic
1072472133 10:95722738-95722760 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1075584265 10:123645726-123645748 ACCTGGGAGAGCTCACCTTCCGG + Intergenic
1075752977 10:124789302-124789324 ATTTAGGAGAAACCACCTCCAGG + Intronic
1076224498 10:128763077-128763099 ACATGGGAGAACCCACCTCCTGG + Intergenic
1079255031 11:18820386-18820408 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1079933978 11:26595654-26595676 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1080248098 11:30202287-30202309 ACCTCATAGAAAACATCTTCTGG - Intergenic
1081033664 11:38115535-38115557 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1081070407 11:38603572-38603594 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1081101379 11:39006802-39006824 ACCCCGGAGTCACCACCTGCTGG - Intergenic
1083089742 11:60187371-60187393 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1084029653 11:66473812-66473834 TCCTCGGAGAAGCCGCCTGCCGG - Exonic
1085317774 11:75555683-75555705 CCCTCGGACAAGCCCCCTTCAGG + Intergenic
1085586942 11:77717399-77717421 ACCTGGGAGAAAACAGCTTCTGG + Intronic
1086317886 11:85612333-85612355 ACCTAGGAGGAACTCCCTTCAGG + Intronic
1086987287 11:93264083-93264105 ACCTAGGAGAAACTCGCTTCAGG + Intergenic
1087458775 11:98420947-98420969 ACCTAGGAGCAACTCCCTTCAGG - Intergenic
1087894664 11:103573972-103573994 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1090323890 11:125868332-125868354 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1091229730 11:133980633-133980655 ACCTGGGGGAAAGAACCTTCAGG + Intergenic
1092469683 12:8766703-8766725 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1093348401 12:18068502-18068524 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094033385 12:26039583-26039605 AACTCTGAGATAACACCTTCTGG - Intronic
1095079415 12:37980360-37980382 ATCTCAGAGAAACCACTTTGTGG + Intergenic
1095138815 12:38638328-38638350 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1095283742 12:40385934-40385956 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1096352305 12:50910514-50910536 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1097144417 12:56930073-56930095 TCCTTGGAGAAAGCACCTTGAGG + Intronic
1098213074 12:68186531-68186553 AACTCCAATAAACCACCTTCAGG + Intergenic
1098248253 12:68542221-68542243 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1100857854 12:98774010-98774032 TCCACGGAGAAAGCACCTTGAGG - Intronic
1102220416 12:111190664-111190686 ATCTGGGACCAACCACCTTCAGG - Intronic
1102606156 12:114068992-114069014 GCATAGGAGAAACCCCCTTCTGG + Intergenic
1104851714 12:131878807-131878829 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1105225527 13:18428002-18428024 ACCTAGAAGAAACTCCCTTCAGG + Intergenic
1106009944 13:25810364-25810386 TCCTCGGGGAACCCTCCTTCAGG + Intronic
1108876449 13:55055771-55055793 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1109606885 13:64707750-64707772 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1109909667 13:68892815-68892837 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1110696962 13:78502332-78502354 ACATCGGGGTAGCCACCTTCAGG + Intergenic
1111021689 13:82459297-82459319 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1113525282 13:110969838-110969860 ACATAGGAGAAACCCCCTTCTGG + Intergenic
1114009978 14:18356353-18356375 ACCTAGGATAAACTCCCTTCAGG + Intergenic
1114236264 14:20826776-20826798 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1115211093 14:30967875-30967897 ACCTAGGAGGAAGCCCCTTCAGG + Intronic
1116725704 14:48559179-48559201 ACCTAGGAGAAACTCCCTTCAGG + Intergenic
1125690099 15:41589087-41589109 ACCTAGGAGAAACCCCCTTCCGG + Intergenic
1128362857 15:66974801-66974823 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1132381804 15:101371284-101371306 ACCGAGGAGAAGCCGCCTTCTGG - Intronic
1132464647 16:72069-72091 AGCTCGGAGACACCACCCGCCGG + Intronic
1135194533 16:20383515-20383537 ACCTCGGAGCAATCACCTAAGGG - Intronic
1135879346 16:26238994-26239016 ACCTGGGTGACACCAACTTCCGG + Intergenic
1138884062 16:61053858-61053880 ACCCCGGAGAACCCCTCTTCTGG - Intergenic
1141399007 16:83730481-83730503 AACTTGGAGATACCTCCTTCTGG + Intronic
1143276411 17:5714651-5714673 AACTGGGAAAAAGCACCTTCTGG - Intergenic
1143705680 17:8696435-8696457 TCCTCAGAGAAACCACACTCTGG - Intergenic
1146764008 17:35502539-35502561 ACCTAGGAGGAACTCCCTTCAGG + Intronic
1148829106 17:50418511-50418533 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1149110515 17:53022842-53022864 ACCTGGGAGAAACACCCTTGAGG - Intergenic
1149274312 17:55016669-55016691 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1150712078 17:67539979-67540001 AACATGGAGAAACCACCCTCAGG + Intronic
1151150145 17:72077922-72077944 ACCTCTGAGAAAGCACTTTGAGG - Intergenic
1152453556 17:80399235-80399257 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1153401017 18:4683798-4683820 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1153830247 18:8915583-8915605 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1154527847 18:15311520-15311542 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1155746353 18:29360476-29360498 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1156578749 18:38350635-38350657 ACCTCTGAGGATCCACTTTCAGG + Intergenic
1160014104 18:75127659-75127681 ACCTCGGGGAGGCCACCTCCTGG + Intergenic
1161842678 19:6692490-6692512 ACCTTGTAGAAACCACCTCCTGG - Intronic
1162268033 19:9592115-9592137 ACCTAGGAGAAACCCCCTTCTGG - Intergenic
1163358343 19:16829561-16829583 CCCTCGGGGAACCCATCTTCTGG + Intronic
1163867235 19:19784298-19784320 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1163900907 19:20099462-20099484 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1163929160 19:20372127-20372149 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1164121708 19:22271683-22271705 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1164130863 19:22360549-22360571 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1164992557 19:32694965-32694987 ACATAGGAGGAACCCCCTTCAGG - Intronic
1165509578 19:36258272-36258294 ACGTGGGAGAAACCACCCTCTGG - Intergenic
926503198 2:13679826-13679848 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
926533588 2:14082648-14082670 ACCTGGGACAAAGCACCTTGGGG + Intergenic
926864233 2:17340965-17340987 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
928410563 2:31051015-31051037 ACCTCGGAGAAACCACCTTCAGG + Intronic
928676893 2:33659318-33659340 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
932344214 2:70985167-70985189 ACCTGGGTGACAACACCTTCTGG + Exonic
933389687 2:81654018-81654040 ACTTAGGAGAAACTCCCTTCTGG - Intergenic
934867591 2:97826974-97826996 ACCTAGGAGGAACTCCCTTCAGG + Intronic
935048188 2:99500413-99500435 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
936461219 2:112714916-112714938 AGCTTGGAGAAACCATCTTGAGG - Intergenic
936716584 2:115193867-115193889 ACCTAGGAGAAACTCCCTTCAGG - Intronic
936839413 2:116752147-116752169 ACCTCCGAGAAATCATCATCCGG + Intergenic
937057417 2:118951247-118951269 ACCTAGGAGGAACTCCCTTCAGG - Intronic
937411514 2:121680946-121680968 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
938526945 2:132142976-132142998 ACTTAGGAGAAACTCCCTTCAGG - Intergenic
939493829 2:142905452-142905474 ACCTAGGAGGAACTCCCTTCGGG - Intronic
940352585 2:152705805-152705827 ACCTAGGAGAAACTCCCTTCAGG + Intronic
941537336 2:166740143-166740165 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
944039497 2:195337848-195337870 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
948066286 2:235083243-235083265 ACCTCCACGAAACCACCTGCAGG + Intergenic
948362775 2:237434560-237434582 AGCTCAGAGAGACAACCTTCTGG - Intergenic
1168823964 20:796405-796427 ACCTGGGAGAAACCCCCTTCTGG + Intergenic
1171144450 20:22769432-22769454 CCCTAAAAGAAACCACCTTCAGG - Intergenic
1172117799 20:32582790-32582812 ACCTCAGAAAAACCGCCCTCCGG + Intronic
1173882103 20:46423233-46423255 ACCTCAGAGAAACCAGATTGAGG + Intronic
1175513988 20:59557008-59557030 ACCTAGGAGGAACTCCCTTCCGG - Intergenic
1175619418 20:60430876-60430898 AACTAGGAGAAACCACCCACGGG - Intergenic
1176769580 21:13057025-13057047 ACCTAGGAGAAACTCCCTTCAGG + Intergenic
1177263742 21:18758476-18758498 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1177895991 21:26856576-26856598 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1178836935 21:36106290-36106312 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1180434476 22:15287162-15287184 ACCTAGGATAAACTCCCTTCAGG + Intergenic
1180516681 22:16150969-16150991 ACCTAGGAGAAACTCCCTTCAGG + Intergenic
1181424186 22:22822431-22822453 ACCTCGAAGTAACCTCTTTCTGG - Intronic
1182311807 22:29414639-29414661 ACCTAGGAGGAACTACCTTCAGG - Intronic
1182577136 22:31280601-31280623 GCCTGGGAGAAAACACCTTTGGG - Intergenic
1182688461 22:32138665-32138687 ACCTAGGAGGAACTACCTTCAGG + Intergenic
1185417855 22:50720039-50720061 ACCCCGGGGAAGCCACCGTCCGG - Intergenic
949610162 3:5696084-5696106 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
949611358 3:5706969-5706991 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
950594768 3:13970009-13970031 TCCTAGGAGAAACTCCCTTCAGG - Intronic
950846371 3:16019691-16019713 ACCTAGGAGAAACCCCCTTCTGG - Intergenic
951020976 3:17780534-17780556 ACCTAGGAGGAACTCCCTTCAGG + Intronic
951170080 3:19531612-19531634 ACCATGGAAAAACCTCCTTCTGG + Intronic
951200942 3:19874889-19874911 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
952554834 3:34520243-34520265 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
952568805 3:34688357-34688379 ACCTCAGAGAAACTAGCCTCTGG + Intergenic
952940479 3:38440518-38440540 ACCTAGGAGGAACCCCCTTTGGG - Intergenic
953622475 3:44545010-44545032 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
958016491 3:87944518-87944540 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
958601572 3:96301565-96301587 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
958630033 3:96672558-96672580 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
959094479 3:101938732-101938754 CCCTCTATGAAACCACCTTCTGG + Intergenic
960063947 3:113350946-113350968 ACCTAGGAGGAACTCCCTTCAGG + Intronic
960720517 3:120621039-120621061 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
962097225 3:132304574-132304596 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
962267004 3:133951007-133951029 ACATAGGAGATACCACCTTTTGG + Intronic
963824547 3:149937838-149937860 TCCACGGAGAGACCACATTCTGG - Intronic
964953194 3:162323059-162323081 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
965054958 3:163699825-163699847 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
965825003 3:172721323-172721345 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
967952941 3:194854725-194854747 GACTTGGAGAAATCACCTTCTGG + Intergenic
970092830 4:12429357-12429379 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
974520237 4:62973342-62973364 ACCTAGGAGGAACCCCCTTCAGG + Intergenic
975314080 4:72932025-72932047 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
976189600 4:82475700-82475722 ACCTAGGAGGAACCCCCTTTAGG + Intergenic
977043716 4:92044221-92044243 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
977727292 4:100311182-100311204 ACCTCGGAGACACCAACACCAGG - Intergenic
977972228 4:103225624-103225646 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
978314008 4:107415866-107415888 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
980438966 4:132816649-132816671 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
980444071 4:132884277-132884299 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
980579983 4:134736803-134736825 AGCTTGGAGAAACCACCTTTCGG - Intergenic
980726848 4:136773282-136773304 TCCTCTGAGACACCACATTCAGG + Intergenic
983174800 4:164575950-164575972 ACATATGAGAAACCACATTCAGG + Intergenic
983708244 4:170684763-170684785 ACCTAGGAGGAACCCCCTTCAGG + Intergenic
988358236 5:30203528-30203550 ACCTAGGAGAAACTCCCTTCAGG + Intergenic
988457256 5:31397269-31397291 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
989096192 5:37783896-37783918 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
989613759 5:43319352-43319374 ACCTAGAAGAAACCCCCTTCTGG - Intergenic
991305922 5:65175813-65175835 ACCTAGGAGGAACTCCCTTCAGG + Intronic
992293751 5:75306353-75306375 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
993055349 5:82974134-82974156 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
995465425 5:112445760-112445782 ACCTAGGAGGAACTGCCTTCAGG + Intergenic
998552711 5:143092971-143092993 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1000236688 5:159368061-159368083 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1002984559 6:2176550-2176572 AGCTCATAGAAACCACCTACTGG + Intronic
1002999266 6:2316190-2316212 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1003444857 6:6175106-6175128 GCCCCGGAGAAACCCCTTTCTGG - Intronic
1004196260 6:13508400-13508422 ACATCTGTGTAACCACCTTCCGG + Intergenic
1004236610 6:13880218-13880240 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1005323889 6:24681007-24681029 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1005461786 6:26075927-26075949 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1008123329 6:47642374-47642396 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1008582524 6:52919837-52919859 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1010893273 6:81339071-81339093 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1011084117 6:83520238-83520260 TCCTTGGAAAGACCACCTTCTGG + Intronic
1011190029 6:84718773-84718795 ACCTAGGAGGAACCCCCTTCAGG - Intronic
1011540127 6:88419653-88419675 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1011570205 6:88726562-88726584 ACCTAGGAGGAACTCCCTTCAGG + Intronic
1013022019 6:106230047-106230069 ACCTAGGAGGAACTCCCTTCAGG + Intronic
1016343409 6:143085836-143085858 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1018191546 6:161313738-161313760 ACCTAGGAGGAACTACCTTCAGG - Intergenic
1019811746 7:3170012-3170034 ACCTCAGATAATCCACCCTCAGG - Intronic
1020044029 7:5026980-5027002 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1020507950 7:9017807-9017829 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1020745202 7:12071254-12071276 ACCTAGGAGACACTCCCTTCAGG + Intergenic
1021737788 7:23656090-23656112 ACTTGGGAGAAACCCTCTTCAGG + Intergenic
1023077753 7:36500648-36500670 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1023436509 7:40145925-40145947 ACCTTGGAGGAACTCCCTTCAGG - Intronic
1023798476 7:43813170-43813192 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1023798933 7:43816207-43816229 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1032725603 7:134587697-134587719 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1035246908 7:157568543-157568565 GCCACGGAGAAGCCACCCTCGGG - Intronic
1038923609 8:32113368-32113390 ACCTAGGACAGCCCACCTTCTGG + Intronic
1039876968 8:41595208-41595230 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1041226953 8:55709902-55709924 ACCTAGGAGGAACTCCCTTCAGG + Intronic
1042088084 8:65130628-65130650 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1051028040 9:12637575-12637597 ACCTCTGAGTGACCACCTTATGG - Intergenic
1052172996 9:25425381-25425403 ACTTTGGAGAAACCACCCACTGG + Intergenic
1052538669 9:29778869-29778891 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1053110956 9:35459791-35459813 ACCTAGGAGGAACCCTCTTCAGG - Intergenic
1053365846 9:37521957-37521979 ACCTCGGACAAGCCACCTGATGG + Intronic
1053705641 9:40750331-40750353 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1054415718 9:64873938-64873960 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1056414615 9:86364445-86364467 ACCCAGGAGAAACCCCCTTCCGG - Intergenic
1186191716 X:7073159-7073181 GCCCCCCAGAAACCACCTTCAGG - Intronic
1186254268 X:7702062-7702084 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1186270191 X:7878528-7878550 GCCTCAGAGAAAGCAGCTTCAGG - Intergenic
1188097989 X:26046097-26046119 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1188136966 X:26503336-26503358 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1189834052 X:45003276-45003298 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1190270070 X:48855672-48855694 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1190771076 X:53514636-53514658 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1191918119 X:66224372-66224394 ACCTAGGAGGAACTCCCTTCAGG - Intronic
1193172121 X:78348594-78348616 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1195847070 X:109240311-109240333 ACCTAGGAGGAACCCCCTTCAGG - Intergenic
1195850718 X:109279110-109279132 ACCTAGGAGGAACTCCCTTCAGG - Intergenic
1196850719 X:119935708-119935730 ACCTCAGAGGAGGCACCTTCTGG + Intronic
1198124489 X:133629085-133629107 ACCTATGAGAAATCACATTCTGG + Intronic
1198489970 X:137129715-137129737 ACCTCGGAGAAAGGACCTGATGG - Intergenic
1198742307 X:139854012-139854034 ACCTAGGAGGAACTCCCTTCAGG + Intronic
1199637610 X:149828200-149828222 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1201308150 Y:12568970-12568992 ACCTAGGAGGAACTCCCTTCAGG + Intergenic
1201648571 Y:16261942-16261964 GCCTAGGAGGAACCCCCTTCAGG - Intergenic
1201654239 Y:16323359-16323381 GCCTAGGAGGAACCCCCTTCAGG + Intergenic
1201900061 Y:19039974-19039996 ACCTAGGAGGAACTCCCTTCTGG - Intergenic
1202192207 Y:22257138-22257160 ACCTAGGAGGAACTCCCTTCAGG - Intergenic