ID: 928411671

View in Genome Browser
Species Human (GRCh38)
Location 2:31059112-31059134
Sequence CTGTTTAAGCACAAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928411671 Original CRISPR CTGTTTAAGCACAAGTTGGA GGG Intronic
900576479 1:3385045-3385067 CTGTTTGGGCTCAAGTAGGAAGG - Intronic
905026209 1:34851644-34851666 CTGTGTTAGCACAAGTCGGCTGG - Intronic
910988038 1:93025769-93025791 CTGATAAAGCACCAGTTGAAAGG + Intergenic
917443715 1:175088849-175088871 CTGTTTGAGCACAGCCTGGAAGG - Intronic
920827851 1:209438483-209438505 CTGATTCAGCACATGTGGGATGG + Intergenic
1065828037 10:29589511-29589533 CTGTTTAAGGCCAAATTAGATGG + Intronic
1065949722 10:30641096-30641118 CTGTTTAAAGCCAAGTTAGATGG - Intergenic
1068966641 10:62918390-62918412 ATCTTTAAGCACAAGCTGGCTGG - Intronic
1068985776 10:63106468-63106490 GTTTTTAAGGACAAGTTGGTGGG - Intergenic
1069310544 10:67030148-67030170 GTGCTAAAGCACCAGTTGGATGG + Intronic
1070406168 10:76098820-76098842 GTGTTTAAGGACAATTTGGTGGG + Intronic
1072540411 10:96394202-96394224 CTGGGCAAGCACAAGTTGTAGGG + Intronic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1079164591 11:18027551-18027573 AAGTTCAAGCAAAAGTTGGAAGG - Intronic
1079235530 11:18686555-18686577 CTGTTTAAGCAAATTGTGGAAGG + Intergenic
1081164848 11:39795228-39795250 CTGTTTAATCTCAAGTTTCATGG - Intergenic
1081944005 11:46972455-46972477 CTGTTTAAGAGCAAGTCTGAAGG + Intronic
1081962681 11:47149871-47149893 ATGTTCAAGCAGAAGTTTGAAGG - Intronic
1085602600 11:77868757-77868779 CTGTGTAAGAACCAGTGGGAAGG - Intronic
1087128729 11:94651100-94651122 CTGTCTAAGGACAAGATAGAGGG + Intergenic
1087835486 11:102870465-102870487 CTGATATTGCACAAGTTGGATGG - Intronic
1088207431 11:107409710-107409732 GTGTTCAAGCACAAGTTAGATGG + Intronic
1088314034 11:108488997-108489019 CTGTAAAAGCAAAACTTGGAAGG + Intronic
1097800572 12:63909411-63909433 CTGTTGAAGCACAAAGTGAAAGG - Intronic
1098241702 12:68473786-68473808 CTGCTTGAGCACAAGATCGACGG + Intergenic
1101178615 12:102185263-102185285 CTTTTTAAGCATCAGTTGAAAGG + Intronic
1105212219 13:18263674-18263696 CTGTCTAACCACAAGGTGGAAGG - Intergenic
1106920733 13:34560795-34560817 CTGTTTAACCACAGGTTTGGTGG + Intergenic
1109292674 13:60495776-60495798 GTTTTTAAGGACAAGTTGGTGGG + Intronic
1109502927 13:63261146-63261168 CTATTAAAGCTCAAGTTGAATGG - Intergenic
1109748006 13:66651918-66651940 CTTTTTCAGCACCAGTTGAAAGG - Intronic
1111580179 13:90212191-90212213 CCTTTTAAGCACAGATTGGAAGG - Intergenic
1111812299 13:93106116-93106138 CTGTTTAAGCAGAGGTTGAAGGG + Intergenic
1112294400 13:98173918-98173940 CTGTTTCAGCAAAAGTCTGAGGG + Intronic
1114656695 14:24319991-24320013 CTGTTTAAGAAGAATTGGGAAGG + Intronic
1117321310 14:54626185-54626207 CTGTTTTAGCACCAGTTACAGGG + Intronic
1118628297 14:67679117-67679139 CTGTGTAATAACAAGATGGAAGG + Intronic
1127586698 15:60384723-60384745 CTGTGAAAGCACAGGTTGTATGG - Intronic
1128590618 15:68893363-68893385 GTTTCTAAGCAGAAGTTGGATGG + Intronic
1130833927 15:87630944-87630966 GTGTTTAAGGACAACTTGGTGGG - Intergenic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1132292096 15:100710952-100710974 CTCTTTAAGCTCTAGTAGGAAGG + Intergenic
1134123338 16:11599872-11599894 GTGTTTGAGCACAGGTTTGAAGG - Intronic
1135214410 16:20552433-20552455 ATGTTTAAGTATAAGTAGGAAGG + Intronic
1135923372 16:26671099-26671121 CTGTTGAAGCACAATATTGAAGG - Intergenic
1138674099 16:58638511-58638533 CTTTTTATGAACAAGTTGGTGGG - Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1145293214 17:21566592-21566614 AAGATTAAGGACAAGTTGGAAGG + Intronic
1145386753 17:22419345-22419367 AAGATTAAGGACAAGTTGGAAGG - Intergenic
1147841640 17:43375995-43376017 CTTTTTAAGGACAACTTGGTGGG + Intergenic
1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG + Intergenic
1154067144 18:11117982-11118004 CTGTTTATGTACTAGTTGGATGG + Intronic
1155656137 18:28195188-28195210 CTATTTAAGGAAAAGTGGGAAGG - Intergenic
1157537609 18:48471564-48471586 CAGTTGCAGCACCAGTTGGAAGG - Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1166322422 19:42026862-42026884 CAGTTTAAGAACAAGGTGGCTGG - Intronic
927217787 2:20678565-20678587 CTGTTTAAGCAGGACTTGGGTGG + Intergenic
927583556 2:24278172-24278194 ATTTTAAAGGACAAGTTGGAGGG - Intronic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
930064695 2:47318957-47318979 TTGTTTAATCACATGCTGGATGG - Intergenic
930167193 2:48214650-48214672 CTTTTTAAGGACAACTTGGTGGG + Intergenic
932926470 2:75980720-75980742 CTAGTAAAGGACAAGTTGGAAGG + Intergenic
934301405 2:91778728-91778750 CTGTCTAACTACAAGGTGGAAGG + Intergenic
938042118 2:128084364-128084386 TTGTTTAAGAACAAGTTGTTAGG - Intergenic
938418634 2:131125367-131125389 CTGTTAAAGCACCAGTTGGCGGG + Intronic
939950044 2:148459454-148459476 CTGTTGTAGAACAAGTTGAATGG + Intronic
940378705 2:152988329-152988351 CTCTTTAAGAAAAAGTTGGCTGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942300032 2:174552250-174552272 ATGTTTAAGCACACTTTGGGAGG - Intergenic
944001353 2:194842488-194842510 CTTTATAAGCACAAGATGGGGGG - Intergenic
944166858 2:196732063-196732085 TGGTTTAAGCACAGGTTTGATGG + Exonic
944502083 2:200372289-200372311 CTGTTCAAGCAGAAGCTGGCTGG - Intronic
946492015 2:220157738-220157760 CTTTTTAAGGACAACTTGGTGGG + Intergenic
948108965 2:235439175-235439197 GTGTTTAATGACAAGTGGGAAGG - Intergenic
1168999032 20:2153559-2153581 CTGGGTAAACACTAGTTGGAGGG - Intronic
1170036217 20:11992954-11992976 TTGTTAAACCACAAGCTGGACGG - Intergenic
1172306163 20:33882309-33882331 CTGTTTGAGCAGAAGCCGGAGGG - Intergenic
1172991867 20:39042573-39042595 CTGTTTCATCACAAATTAGAAGG - Intergenic
1173411188 20:42810630-42810652 CTGTTCAAGTACAGGTTGGATGG + Intronic
1174241375 20:49138039-49138061 CTTTTTAAGGACAAGGTGGGTGG + Intronic
1177099731 21:16885430-16885452 CTGTTTCAGCTGAAGCTGGATGG + Intergenic
1177939285 21:27389317-27389339 CTGCATAAGCTCAAGATGGACGG - Intergenic
1180815032 22:18783994-18784016 CTGTCTAACTACAAGGTGGAAGG - Intergenic
1181201220 22:21218331-21218353 CTGTCTAACTACAAGGTGGAAGG - Intronic
1181700523 22:24618636-24618658 CTGTCTAACTACAAGGTGGAAGG + Intronic
1182769829 22:32786660-32786682 TTGTTTAAGAATAAGTTGCAGGG - Intronic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1185073570 22:48670390-48670412 ATGCTTAAGCACACGCTGGAAGG + Intronic
1203225693 22_KI270731v1_random:77100-77122 CTGTCTAACTACAAGGTGGAAGG + Intergenic
1203265135 22_KI270734v1_random:9684-9706 CTGTCTAACTACAAGGTGGAAGG - Intergenic
949999140 3:9642816-9642838 GTGTTTAAGGACAACTTGGTAGG + Intergenic
951570970 3:24062880-24062902 CTGCCTAAGCAGAAGTTGAAAGG + Intergenic
951598414 3:24343296-24343318 CTGTTTAAGCACCAGAAGCAAGG + Intronic
953015712 3:39073989-39074011 CTGTTAAAGCACCAGTTGCTGGG + Intronic
953681284 3:45040172-45040194 CTGCATAAGCACTAGTTGTATGG + Intergenic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
955373873 3:58377831-58377853 CTGATTAAGCAAATGTAGGAAGG + Intronic
956160545 3:66346858-66346880 CTGTGTAAGGACCACTTGGATGG + Intronic
957391514 3:79578591-79578613 CTGTTTCACCACAAGTTTGCTGG - Intronic
965367012 3:167813551-167813573 TTGTTTAAGAGCAAGTTGAAAGG + Intronic
967313258 3:188126527-188126549 CAGACTAAGCACCAGTTGGACGG + Intergenic
970990157 4:22203759-22203781 CTGTTAAGTCACAAGTTGAAGGG + Intergenic
971300718 4:25440475-25440497 CTTTTAAATCACAAGTTGGCTGG + Intergenic
972595242 4:40524132-40524154 GTGTTTTAGCACATGTGGGAGGG - Intronic
973689763 4:53414825-53414847 CTGAAAAAGCATAAGTTGGAGGG - Intronic
974366137 4:60951913-60951935 ATGTTTAAGGCCAAATTGGAAGG - Intergenic
976689084 4:87849175-87849197 CTTTTTGAGCACAAGGTGGCAGG - Intergenic
980171362 4:129294070-129294092 CTGTTTAAGCAAATGTTTGAAGG + Intergenic
980699737 4:136409615-136409637 CTGTTAAAGCAAAAGTAGCATGG + Intergenic
982167124 4:152624051-152624073 CTGTTTAAGACAAAGGTGGATGG - Exonic
983062856 4:163177818-163177840 ATCTTTAAGCCCAAGTTGGGAGG + Intergenic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
987239308 5:15977677-15977699 CTTATTATACACAAGTTGGAAGG - Intergenic
987660523 5:20867502-20867524 CTGTTTCATCACAAGGTTGAAGG + Intergenic
988166761 5:27601365-27601387 CTCTTGAAGTACAGGTTGGAGGG - Intergenic
988763124 5:34338181-34338203 CTGTTTCATCACAAGGTTGAAGG - Intergenic
994944785 5:106373056-106373078 GTGTTTAAGCATAAGTTTTATGG + Intergenic
996132414 5:119797518-119797540 CTGTTTAAGCACAATTTTAAAGG - Intergenic
996226594 5:121006981-121007003 CTGTGTCTTCACAAGTTGGAAGG + Intergenic
996469259 5:123840909-123840931 CTGAATGAGCAAAAGTTGGAAGG + Intergenic
997139576 5:131364296-131364318 CTGTATAGGCACAAGTTTAAGGG + Intronic
998460441 5:142306029-142306051 CTATAGAAGCACAAGTGGGAAGG + Intergenic
999846614 5:155488388-155488410 CTGTATAATCACATGGTGGAAGG - Intergenic
1003877287 6:10450043-10450065 GTTTTTAAGGACAAGTTGGTGGG - Intergenic
1006599447 6:35215762-35215784 CTGTGAAAGGACAGGTTGGAGGG - Intronic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1015848051 6:137542377-137542399 CTGTTTCAGGACAAGTTGCCCGG - Intergenic
1016608581 6:145963362-145963384 TTCCTTAAGTACAAGTTGGAAGG + Intronic
1016682953 6:146851701-146851723 CTGCTTAAGCCCAAGTGAGAGGG + Intergenic
1018478068 6:164162445-164162467 CTGGTAAAGCACAACTTGGCTGG + Intergenic
1020155595 7:5721384-5721406 CTGTTTATGCTCCAATTGGAAGG + Intronic
1020832707 7:13111340-13111362 GTTTTTAAGGACAAGTTGGTGGG + Intergenic
1025919259 7:65895220-65895242 CATTATAAGCACAAGTTAGATGG + Intronic
1032826628 7:135576065-135576087 GTGTTTAGGGATAAGTTGGATGG + Intronic
1034997392 7:155586866-155586888 CTTTTCAAGCACAAGCTAGAAGG - Intergenic
1038818145 8:30927561-30927583 CTTTTTAAACAAAAATTGGATGG - Intergenic
1044393229 8:91678089-91678111 CTATTTAAGCAAAAATTGGCGGG + Intergenic
1045557350 8:103227336-103227358 CTGTTTAGGAACAAAATGGAAGG - Intronic
1045951219 8:107853854-107853876 TTGTTTAAGCACAAGCTGCTGGG - Intergenic
1050206774 9:3204695-3204717 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1051869696 9:21723632-21723654 CCATTTTAGCACAAGTTGGAAGG + Intergenic
1055209062 9:73767150-73767172 TTTTTTAAGCACAGGTTTGAAGG - Intergenic
1055212468 9:73813294-73813316 CTGTTAAAGCACCATTTGGGAGG + Intergenic
1056710085 9:88985381-88985403 CTGTTTAACCACAACGTGAAAGG - Intergenic
1185824126 X:3233362-3233384 GTGTTTATGAAAAAGTTGGAAGG - Intergenic
1186990220 X:15059238-15059260 CAGTTTAAGTACAAAATGGAAGG - Intergenic
1188043850 X:25402896-25402918 CTGTTCAAGCCCAAGGTGTAGGG + Intergenic
1189234235 X:39475458-39475480 CTGTTTAAACAAGAGTAGGAGGG - Intergenic
1190478470 X:50850956-50850978 CTTTTTAAGGACAACTTGGTGGG + Intergenic
1195292588 X:103443470-103443492 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1197641379 X:128971910-128971932 CAGTTTATGCTCAAGTTGGGTGG + Intergenic
1199252817 X:145683763-145683785 CTGTATAATCTCAAGTTGGGGGG - Intergenic
1199822449 X:151462747-151462769 CTGTTTGAGCCCAGGATGGACGG + Intergenic
1201280705 Y:12339799-12339821 CTGTTCAAACACAGGTGGGAAGG + Intergenic