ID: 928413292

View in Genome Browser
Species Human (GRCh38)
Location 2:31070824-31070846
Sequence AGAGAGGCTGGCCCTACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928413292 Original CRISPR AGAGAGGCTGGCCCTACCCA GGG Intronic
900717879 1:4156831-4156853 CTTGAGGCTGCCCCTACCCAAGG + Intergenic
900725355 1:4212939-4212961 AGGGAGCATGGCCCTGCCCAGGG + Intergenic
901507436 1:9694015-9694037 AGAGAGGTTGGCCCAGCCCAGGG + Intronic
901901417 1:12366538-12366560 ATAGGGGCTGCCTCTACCCAGGG - Intronic
902080966 1:13820522-13820544 TGAGAGGCTGTCCCTTCCCTGGG - Intronic
902216179 1:14935816-14935838 AGAGATCCTGGCCTTACCCATGG + Intronic
902436857 1:16403749-16403771 AGAGATGCTGGCCTTACCAGAGG - Exonic
903656463 1:24951573-24951595 AGAGAGGCTGGAGCGACTCAAGG - Intronic
904752056 1:32747120-32747142 AGAGGGGCAGGACTTACCCAAGG - Intronic
904859217 1:33522205-33522227 ACAGAGGCTGCTCCTAGCCATGG - Intronic
904919907 1:33999021-33999043 AGAGAGGCTGGCCATACCTGGGG - Intronic
906480276 1:46194882-46194904 AGCCAGGCTGGCCCTGCCCTGGG - Exonic
914948101 1:152084990-152085012 AGAGAGGCTGGTACTACAAAGGG - Exonic
917670798 1:177271660-177271682 AGAGAAGCTGTCCCTGCCCCTGG + Intronic
919785552 1:201255709-201255731 AGAGAGCCTGTCCCTTCCCTCGG - Intergenic
919894918 1:202003575-202003597 AGGGAGGCTGGCACTCCACAAGG + Intronic
919894935 1:202003644-202003666 AGGGAGGCTGGCACTCCACAAGG + Intronic
920369611 1:205469940-205469962 AGGCAGGCTGGCCCAACTCAAGG + Intergenic
920571698 1:207022689-207022711 AGAGAAGCTGGGGCTACCCCAGG - Exonic
920656132 1:207876630-207876652 AGAGAGGGGGGCCCTACTCAAGG - Intergenic
920701013 1:208218055-208218077 AAAGAGGCTGGCCTGACCCAGGG + Intronic
921293867 1:213683825-213683847 AGGGAGGCTGGCTCTGCCCCTGG - Intergenic
921872116 1:220152436-220152458 AGGGAGGCTGGCCCGGGCCATGG - Intronic
924111127 1:240701046-240701068 AGAGAGGCTGGCCTTAGACATGG + Intergenic
1063463343 10:6228196-6228218 AGACAGGCTTGCCCTAGCAAAGG - Intronic
1064256005 10:13743262-13743284 AGTGAGGCTGGGCCTGCCCTTGG - Intronic
1067574467 10:47400472-47400494 AGAAAGCCTGGCCATACCCAGGG - Intergenic
1070289423 10:75104903-75104925 AGAGAGTCAGGCCCTGCCCTGGG + Intronic
1070804616 10:79263842-79263864 AGTGAGGCTGGGCCTTCCCTAGG - Intronic
1070823971 10:79380261-79380283 AGAGAGGGTGGCCCTGCTCTGGG - Intergenic
1070836262 10:79448705-79448727 AGAGAGGGCAGGCCTACCCAAGG - Intergenic
1070965166 10:80525817-80525839 AGAGTGGCTGGCCCTTACCTAGG - Exonic
1073539368 10:104305882-104305904 ACAGAGGCTGCCCCTACTCAGGG - Intergenic
1073982745 10:109173451-109173473 AGACAGGCAGGCTTTACCCACGG + Intergenic
1075198665 10:120383014-120383036 AGAGAGGATGCCCCCACCTATGG + Intergenic
1076196165 10:128519819-128519841 CGAGGGGCTGGCCCTTCTCATGG + Intergenic
1076199152 10:128544563-128544585 AGAAAGGCTGGCTCTACACTTGG - Intergenic
1076775768 10:132697251-132697273 AGTGAGACGGGCCCTGCCCATGG + Intronic
1077090225 11:775049-775071 GGAGAGGCTGGACTTACCCCAGG + Exonic
1078550847 11:12279711-12279733 AGAGAGGCTGTCTCCACACATGG + Intronic
1079007712 11:16803796-16803818 AGGAAGGCTGGCCTTACCCACGG - Intronic
1080419939 11:32100818-32100840 GAAAAGGCTGGCCCTACACAAGG + Intronic
1081321188 11:41693804-41693826 AGAGGGGCTGGATCTACCCTGGG - Intergenic
1081633149 11:44702917-44702939 AGAGTGGCAGGCCCTAGGCAGGG + Intergenic
1081664150 11:44906695-44906717 AGAGGGGCTGACCCACCCCAGGG - Intronic
1081810029 11:45909409-45909431 TGAGAGGCTGGCTCTTCACAGGG + Intergenic
1083815429 11:65130052-65130074 CCAGAGGCTGGCCCTGCCCCTGG - Exonic
1083919954 11:65777203-65777225 AGAGGGTCTGGCCTTGCCCAAGG - Exonic
1084727243 11:70949741-70949763 AGAGAGGCTGGCCCAGGCCACGG - Intronic
1087279901 11:96198647-96198669 AGAGAGTCTGTCACTGCCCACGG + Intronic
1088984089 11:114890258-114890280 AGAGAGCCTGGCCCCAGCCAGGG - Intergenic
1089015136 11:115159431-115159453 AGTGAGGCTGGCCTTCCCCTGGG + Intergenic
1089626477 11:119754358-119754380 AGAGAGGTGTGCCTTACCCAAGG + Intergenic
1090078454 11:123594283-123594305 AGAGAGGCTGTCCAGACCCCTGG + Intronic
1090200189 11:124848546-124848568 AGTGAGGCTGGACTTTCCCAGGG + Intergenic
1090756670 11:129797919-129797941 AGAGAGGCTGGCCTGACCAATGG + Intergenic
1096231944 12:49901604-49901626 AGAGACCCTGCCCCTACCCCAGG - Intronic
1096354636 12:50930047-50930069 AGAGAAGCTGGCCCGCTCCAGGG - Exonic
1096388322 12:51210082-51210104 AGAGTAGCTGGGACTACCCATGG + Intronic
1099432897 12:82609363-82609385 AGAGAGGCTTGACTTTCCCAAGG - Intergenic
1099996353 12:89783655-89783677 ACAGAGGCTGCCCCTAGCCTAGG - Intergenic
1101348086 12:103904818-103904840 AGAGAGGCATGTCCCACCCAGGG + Intergenic
1103727383 12:123004877-123004899 GGAGAAGCTGGCTCCACCCAGGG + Intronic
1103923335 12:124410757-124410779 ACAGCGGCTGCCCCTCCCCAGGG + Intronic
1104721516 12:131047249-131047271 ACAGAGACTGGCCACACCCAGGG - Intronic
1104882859 12:132084444-132084466 TGAGGGGTTGGCCCTACCCTCGG + Intronic
1105281909 13:18969537-18969559 AGAGAGCCTGGCCCTGCTCTGGG - Intergenic
1106698753 13:32206508-32206530 AGAGAGGCTGGCCCTCCAGTGGG + Intronic
1108211996 13:48148560-48148582 AGAGAGCCTGGGCCTACCACAGG + Intergenic
1116858386 14:49973936-49973958 AGTGAGGCTGGCTCTGCCCCAGG + Intergenic
1119799179 14:77427483-77427505 AGAGTAGCTGGCACTGCCCATGG + Exonic
1121638296 14:95468405-95468427 CGAGGAGCTGGCCCAACCCAGGG + Intronic
1122247937 14:100417422-100417444 AAAGAGCCTGGCCCCACACATGG - Intronic
1122787991 14:104172757-104172779 AAGGAGGCTGGTCCTACACATGG + Intronic
1124285214 15:28396116-28396138 AGAGTAGCTGGGACTACCCAGGG + Intergenic
1124297482 15:28515498-28515520 AGAGTAGCTGGGACTACCCAGGG - Intergenic
1125434113 15:39627329-39627351 AGAGGGGCTTGCTGTACCCATGG - Intronic
1129393157 15:75230669-75230691 AGAGTGGAGGGCCCTGCCCAAGG + Intergenic
1129457057 15:75681698-75681720 AGAGAGTCTGCTGCTACCCATGG + Intronic
1129908819 15:79209294-79209316 AGAGAGGCTGGCCCCAGGCCAGG - Intergenic
1130274760 15:82470573-82470595 AGAGAGTCTGCCACTACCCATGG - Intergenic
1130371125 15:83285567-83285589 GGAGAGGCTTGCCCTGCCCCGGG - Intergenic
1130467105 15:84197947-84197969 AGAGAGTCTGCCACTACCCATGG - Intergenic
1130486497 15:84401230-84401252 AGAGAGTCTGCCACTACCCATGG + Intergenic
1130497159 15:84475589-84475611 AGAGAGTCTGCCACTACCCATGG + Intergenic
1130589404 15:85202540-85202562 AGAGAGTCTGCCACTACCCATGG - Intergenic
1130615038 15:85398018-85398040 AGAGAGGCTGGACTTGCTCAGGG + Intronic
1131132468 15:89909095-89909117 AGAGTGGCTGCCCTCACCCAGGG - Intronic
1131563843 15:93467764-93467786 AGAGAGACTGAACCTACACATGG + Intergenic
1132219842 15:100097084-100097106 GGAGAGGCTGCCTCTACCCTAGG + Intronic
1134565381 16:15247298-15247320 AAAGAGGCTGCCCCCACCCCCGG + Intergenic
1134737115 16:16509400-16509422 AAAGAGGCTGCCCCCACCCCCGG - Intergenic
1134930407 16:18202764-18202786 AAAGAGGCTGCCCCCACCCCTGG + Intergenic
1136221819 16:28834218-28834240 AGAGAGACTGGCCGGGCCCAGGG + Intronic
1136234100 16:28903932-28903954 CCAGAGGCTGGCACTGCCCAGGG - Intronic
1138584696 16:57962317-57962339 TCAGAGGGTGGCCCCACCCAGGG + Intronic
1139282035 16:65779359-65779381 AGAGAGGCTGGGCCTCCTCCTGG + Intergenic
1139907409 16:70376122-70376144 AGAGACGCTGCCCCTTCGCAGGG - Exonic
1140143543 16:72284047-72284069 AGAGAGAGTGGCCCATCCCAGGG - Intergenic
1140230658 16:73114753-73114775 AGACAGGCTGGCCATTCACAAGG - Intergenic
1141055848 16:80812922-80812944 AGAGAGTCTGGGCCTACTTAAGG - Intergenic
1141450357 16:84095723-84095745 GGAGAGGCTGGCTCTTCGCAGGG + Exonic
1141466000 16:84206199-84206221 ATAGAGGGTGGCACTCCCCAGGG - Intergenic
1141491493 16:84376880-84376902 AGTGAGGCTGGCCCTGCTGAAGG + Intronic
1141617109 16:85216100-85216122 CGAGAGGGTGGCCCAGCCCAGGG + Intergenic
1141676740 16:85521763-85521785 AAAGAGGCTGGCCCCTCTCAGGG - Intergenic
1141753529 16:85975723-85975745 AGAGAGGCTGGCCCCCTGCAGGG - Intergenic
1142421255 16:89972068-89972090 AGTGGGGCTGGGCCTGCCCATGG - Exonic
1143490908 17:7284753-7284775 CAACAGGCTGGCCCTACCCTGGG - Intronic
1143545249 17:7591604-7591626 AGAGAGGCTCCCCTTACCCTGGG + Exonic
1145247834 17:21281151-21281173 AGAGAGGCTGACCCAAACCCAGG - Intergenic
1145250825 17:21296084-21296106 AGAGAGGCTGGTCATATCCATGG + Intronic
1145788286 17:27608302-27608324 AGAGAGGCTAAACCTACCCAAGG - Intronic
1145977792 17:28994211-28994233 AGAGAGGCCGGGCAAACCCAAGG - Intronic
1147185996 17:38713351-38713373 CGATAGGCAGGCCCTACCCTAGG + Intronic
1147571227 17:41572218-41572240 AGAGAGGCTGGGCCGCCCCCAGG - Intergenic
1148139556 17:45318386-45318408 GGATAGGCAGGCCCCACCCAAGG + Intergenic
1148194594 17:45704245-45704267 AGAGAGGCTGGCTCTAGTGAAGG - Intergenic
1149866746 17:60155225-60155247 TCAGAGGCTGGGCCTACCCCTGG - Intronic
1153585639 18:6617397-6617419 GGAGAGCCCGGCCCAACCCAAGG + Intergenic
1155441582 18:25868007-25868029 ATAGAGAAGGGCCCTACCCAAGG + Intergenic
1155761578 18:29575061-29575083 CCAGAGGCTAGCCCTATCCATGG - Intergenic
1156259181 18:35428756-35428778 AGAGAGGCTGGCCATGACCCTGG - Intergenic
1156465381 18:37345409-37345431 AGAGAGGCTGGCTGTGCCCAGGG - Intronic
1157132224 18:45017369-45017391 AAAGAGGCTGGGGCCACCCAAGG - Intronic
1160839740 19:1140758-1140780 GCAGAGGCTGGTCCTGCCCAAGG - Intronic
1161173804 19:2827738-2827760 AGTGATGCTTGCCTTACCCAGGG - Exonic
1161234143 19:3189743-3189765 AGGGAGGCTGGGGCCACCCAAGG + Intronic
1161590699 19:5127908-5127930 AGAGAGGCGGGGACTCCCCAGGG + Intronic
1161849418 19:6730952-6730974 AGAGCCGCCGGCCCTGCCCATGG + Intronic
1162184560 19:8894890-8894912 ATAGAGACTGTCCCTATCCAGGG + Exonic
1162508574 19:11103011-11103033 AGGGAGGCTGTCCCTGCCGAGGG + Intronic
1164411713 19:28011800-28011822 AAAGAGGCTGCCCCAAGCCAAGG + Intergenic
1164516740 19:28943242-28943264 AGAGAAGCTGCCCCAAGCCAAGG + Intergenic
1166207265 19:41279210-41279232 AGAGTGACTGTCCCTACCCTTGG + Intronic
1167122473 19:47526668-47526690 AAAAGGACTGGCCCTACCCAGGG + Intronic
1168343631 19:55640363-55640385 GGAAAGGCTGGCACTGCCCACGG - Intronic
925721080 2:6828080-6828102 AGAGAGGCCTGCCCTGCCTAGGG - Intergenic
925978105 2:9155242-9155264 AGCCAGGCTGGCCCTAGCCCTGG + Intergenic
926286672 2:11494171-11494193 AGAGAGGCTGGACAGAGCCAGGG + Intergenic
928341686 2:30447944-30447966 AGAAAGGTAGGCCCTAGCCAGGG + Intronic
928413292 2:31070824-31070846 AGAGAGGCTGGCCCTACCCAGGG + Intronic
929436007 2:41928932-41928954 AAGGAGGCTGGCACTACCCTGGG - Intergenic
936891378 2:117373813-117373835 ATAGAGTCAGGCCTTACCCATGG - Intergenic
937090744 2:119204797-119204819 AGAGAGTGTGGCCCTGCACAAGG + Intergenic
937319847 2:120954633-120954655 AGGGAGGCTGGCCCTCAGCAGGG - Intronic
937876452 2:126829493-126829515 GGAGAGGCTGGAGCTAACCATGG - Intergenic
937984900 2:127634034-127634056 AGGGAGGCTTGCCCTGCTCAGGG + Intronic
938383661 2:130850192-130850214 AGAGAGGCTGCCCCCTCCCTGGG - Intronic
938656887 2:133443509-133443531 AGAAAGGAGGGCCCTTCCCATGG - Intronic
938942275 2:136179620-136179642 AGGAAGGCTGGCCAGACCCAGGG - Intergenic
939559527 2:143716252-143716274 AAAGAGGCTGGCCACACCAAGGG + Intronic
940192564 2:151058065-151058087 AGAGAGTATGGCCTTATCCATGG - Intergenic
940898829 2:159107735-159107757 AGAGATGCAAGCCATACCCACGG - Intronic
942541923 2:177023460-177023482 AGAGAGGCTTCCCCTGGCCAGGG - Intergenic
945953723 2:216065738-216065760 ACAGAGGCCTGCCCTACTCAAGG - Intronic
946986505 2:225279868-225279890 AGAGAGGCAGGCCATAGCCTAGG - Intergenic
948503542 2:238411779-238411801 ACCCAGGCTGCCCCTACCCAGGG + Intergenic
948524371 2:238561044-238561066 GGAGAGGCTGGCCCAGACCAGGG - Intergenic
1171193782 20:23180844-23180866 AGAGAAGGAGGCCCTCCCCATGG + Intergenic
1172916427 20:38447071-38447093 AGAGAGGCTGTGCCGACCTAGGG - Intergenic
1173971307 20:47154528-47154550 AGAGACCCTGCCCTTACCCATGG + Intronic
1174532437 20:51224785-51224807 AGAGAGGCTGCCACAAGCCAAGG + Intergenic
1174572007 20:51508707-51508729 AGAGACTCTGGCCTTTCCCAAGG + Intronic
1175461830 20:59157580-59157602 AGAGACCCTGGCCCTTCCCAGGG - Intergenic
1175769674 20:61615890-61615912 AGCGAGGCTGACCCCACCGAAGG - Intronic
1177197371 21:17917564-17917586 AGAGATTCATGCCCTACCCAAGG + Intronic
1179047189 21:37856427-37856449 AGAGAGGCTGGCTCTGACTAAGG - Intronic
1179928570 21:44551843-44551865 ACAGAGGCTGGGCCTCCCCCGGG - Intronic
1179940588 21:44637023-44637045 ACAGAGGCTGGGCCTCCCCCAGG + Intronic
1181018715 22:20086887-20086909 AGGGATGCAGGGCCTACCCATGG - Intronic
1182353253 22:29710600-29710622 AGAGAGGAAGGACCTATCCAAGG - Intergenic
1182359640 22:29739030-29739052 AGAGAGCCTGGCCCTAAGGAGGG + Intronic
1182442589 22:30372898-30372920 AGAAAGGCTTCCCCTACCCTGGG - Intronic
1182545038 22:31070201-31070223 CGTGAAGCTGGCCCTGCCCATGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184300922 22:43560522-43560544 AGCATGGCTGCCCCTACCCAAGG - Intronic
1185018592 22:48359961-48359983 AGAGAGGCTGGCGCTCTGCAGGG - Intergenic
1185394192 22:50578405-50578427 AGAGTGGCTGGCCCCACGCACGG - Exonic
950345204 3:12287511-12287533 AGAGTGGCTTGCCCTTCACACGG - Intronic
950487266 3:13281183-13281205 AGAGAAGCTGGGGCTGCCCAAGG - Intergenic
953033306 3:39191703-39191725 TGAGAGGCTGGCCCAGCCCTAGG - Intronic
953040515 3:39251653-39251675 AGAGATGCTGTCCTTACTCAGGG - Intergenic
953419318 3:42742306-42742328 AGAGAAGCTGGGACTACCCAGGG + Intronic
954244089 3:49317054-49317076 ACAGAGGCAGGCCCTGCCCATGG + Intronic
954406740 3:50349369-50349391 GCAGAGGCTGGCCATACCAATGG + Exonic
954671079 3:52291698-52291720 AGAGGGGCTATCCCAACCCAGGG - Intronic
954756528 3:52843430-52843452 CTAGAGGCTGGCGCTACACATGG + Intronic
954807373 3:53228429-53228451 AGAGAGGCCATCCCTTCCCATGG + Intronic
955639978 3:61072106-61072128 AGAGAGAATGACCTTACCCATGG - Intronic
956754096 3:72368392-72368414 GAAAAGGCTGGCCCTCCCCAGGG - Intergenic
961382150 3:126501900-126501922 AGGGAGGCCGGCCCAGCCCAGGG + Exonic
961549553 3:127661202-127661224 ACAGAGCCTGGCCATCCCCAGGG + Intronic
961621993 3:128231601-128231623 ACTCAGGCTGGCCCTCCCCAGGG + Intronic
961765147 3:129204677-129204699 AGAGACACTGTCCCTGCCCACGG + Intergenic
963426894 3:145141097-145141119 AAAAAGACTGGCCCTACCAAGGG - Intergenic
965504390 3:169496525-169496547 AGAGAGGGTTGCTCTTCCCAAGG + Intronic
966876971 3:184327997-184328019 AGAGAAGCTGGTCATACCCTTGG - Exonic
967866652 3:194195483-194195505 AGAAAGGCTGGGACTGCCCAAGG - Intergenic
968519175 4:1028026-1028048 GGACAGGCTGCCCCTCCCCAGGG + Intergenic
969057356 4:4410105-4410127 AGAGAGGAAGGCCTTGCCCAAGG + Intronic
969130389 4:4986852-4986874 AGAGAGACTGCCCCTTCCCAGGG + Intergenic
969186257 4:5476875-5476897 AGAGAGGCTGCCACAACCCAAGG + Intronic
976113204 4:81698999-81699021 AGAGAGGCTGATCTTTCCCATGG - Intronic
979028762 4:115611755-115611777 AGAGAGGCAGGCCAGGCCCAAGG + Intergenic
982226886 4:153174528-153174550 AGACAGGCTGCCCTTTCCCAGGG + Intronic
982258903 4:153476406-153476428 ACTGCGCCTGGCCCTACCCAAGG - Intronic
985540484 5:485264-485286 AGAGGGGGTGGCACTAACCAAGG - Intronic
986556413 5:9014548-9014570 TGAGAGGATGGCCCTCCACAAGG - Intergenic
989383855 5:40835591-40835613 TGCGGGGCTGGCCCTGCCCAGGG + Intergenic
1000440865 5:161261517-161261539 AGAGAGGCTGCCCTTTCCGAAGG + Intergenic
1001712173 5:173787633-173787655 AGAGAGTCTGGCCACACTCATGG + Intergenic
1002319628 5:178367310-178367332 AGAGAGGCGTGACCCACCCAAGG - Intronic
1002881706 6:1258107-1258129 AGAGAGACTTGCCCGACTCAGGG - Intergenic
1006865751 6:37207843-37207865 AGAGAGGCCTTCCCTACCAATGG - Intergenic
1010291328 6:74141343-74141365 AGAGAGTTTGGCACTATCCACGG - Intergenic
1011083416 6:83512748-83512770 AGAAAGGCAGGACCTACCCGAGG + Intronic
1012825839 6:104145638-104145660 AGACAAGATGGCCCTAGCCAAGG + Intergenic
1013362756 6:109410022-109410044 AGAGAAGCGGGCCCTACACGAGG - Intronic
1017331271 6:153200388-153200410 AGAGAGGCTGCCACAAGCCAAGG - Intergenic
1017889764 6:158628656-158628678 GGACAGGCTGCCCCTTCCCACGG - Intronic
1019311039 7:360781-360803 AAAAAGCCTGGCCCTACCCAGGG - Intergenic
1020678259 7:11205368-11205390 AGAGAACCTGGTCATACCCAGGG + Intergenic
1022888040 7:34666783-34666805 ACAGAGGCTGGATCTGCCCATGG + Intronic
1026012600 7:66648391-66648413 GGAGAGGCTGCCCCTGCTCATGG - Intronic
1026943494 7:74302130-74302152 AGACAGGCTGGGCGTTCCCAGGG + Intronic
1031198265 7:118644290-118644312 AGAGTGGCAGGTCCTGCCCAAGG + Intergenic
1032673438 7:134106765-134106787 AGAGGGGCTGGGGCTTCCCAGGG - Intergenic
1032843738 7:135735450-135735472 TGTGAGCCTGGCACTACCCAGGG - Intronic
1034190019 7:149206817-149206839 AGAGAAGGTGTCCTTACCCAGGG - Exonic
1035580565 8:737347-737369 AGAAAGGCTGACCCTGCCCGGGG + Intronic
1036767472 8:11557895-11557917 AGAGAGGCTGGCACCACCAGGGG + Intronic
1038613631 8:29074107-29074129 ACAGTGGCTGGCCTTACCCGGGG - Intronic
1042955318 8:74244153-74244175 AGAGCGGCTGGCCCTTGGCAGGG + Intronic
1044892790 8:96855075-96855097 AAAAAGGCTGACCCTCCCCAAGG - Intronic
1045310157 8:100994006-100994028 AGAGAGAAGGGCCCTGCCCAAGG + Intergenic
1045421764 8:102023504-102023526 AGAGAGGCTGCCCATTCCCAAGG + Intronic
1048398434 8:134038380-134038402 AAAGAGGCTGACCCTCCCAAGGG + Intergenic
1049167538 8:141136021-141136043 ACAGAGCCTGCCCCCACCCAGGG + Intronic
1049257992 8:141624140-141624162 TGTGAGGCTGGCCCTACTCCTGG + Intergenic
1049650559 8:143766071-143766093 AGAGAGGCTGCTACTACCCACGG - Intergenic
1053294681 9:36904221-36904243 AGAGAGGCAGGCCCAAGCTAGGG - Intronic
1054452716 9:65411994-65412016 GGAGGGGCCGCCCCTACCCAGGG - Intergenic
1059598105 9:115744913-115744935 AGAAAGGCTGACCCTCCCCCAGG + Intergenic
1060014121 9:120071580-120071602 AGAGATGCTTGACCTTCCCAAGG - Intergenic
1060561364 9:124547136-124547158 AAAGAGAATGGCCCTAGCCATGG + Intronic
1060727696 9:126016955-126016977 AGGGGGCCTGGCCCTGCCCAGGG + Intergenic
1061578800 9:131524185-131524207 AGACAGGCTGTCCCACCCCAGGG - Exonic
1061860832 9:133468049-133468071 AGGGAGGAAGGCCCTGCCCAGGG - Intronic
1062046320 9:134426088-134426110 CAAGAGGCTGGCCCTTCCCAAGG - Intronic
1062384921 9:136305416-136305438 ACAGAGCCTCGCCCTGCCCAGGG + Intronic
1062463090 9:136670009-136670031 GGTGAGGCTGGCTCTACCCTGGG + Exonic
1062615659 9:137394641-137394663 AGAGAGGCTGCACCTCCCCTCGG + Intronic
1186795542 X:13044088-13044110 ACAGAGCCTGGCCCTGCCCCTGG + Intronic
1187500022 X:19832148-19832170 AGAGATGCTTGCTCTACCTAGGG - Intronic
1189273103 X:39765575-39765597 AGAGAGGCTGGGGTAACCCAGGG + Intergenic
1190115088 X:47620999-47621021 ACAGAGGCAGGCCCATCCCATGG + Intergenic
1190320899 X:49178689-49178711 GTAGAGACAGGCCCTACCCATGG + Intronic
1191235065 X:58127535-58127557 AAAGACACTGGGCCTACCCAAGG + Intergenic
1192210991 X:69127615-69127637 AGAGGGGAGGGCCTTACCCAAGG - Intergenic
1194195068 X:90882703-90882725 AGAGCAGCTGCCCCAACCCATGG - Intergenic
1199975004 X:152889388-152889410 AGAAAGGCTGTCCCCACCCCAGG + Intergenic
1202369030 Y:24185081-24185103 ACAGAGTCTGCCACTACCCATGG + Intergenic
1202501755 Y:25485036-25485058 ACAGAGTCTGCCACTACCCATGG - Intergenic