ID: 928415763

View in Genome Browser
Species Human (GRCh38)
Location 2:31090300-31090322
Sequence CACTCAGAGCTCCCTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928415755_928415763 15 Left 928415755 2:31090262-31090284 CCAAGCTCTGACGATAACACTAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 928415763 2:31090300-31090322 CACTCAGAGCTCCCTGGGACTGG 0: 1
1: 0
2: 1
3: 18
4: 290
928415754_928415763 23 Left 928415754 2:31090254-31090276 CCTTCTAGCCAAGCTCTGACGAT 0: 1
1: 0
2: 0
3: 6
4: 56
Right 928415763 2:31090300-31090322 CACTCAGAGCTCCCTGGGACTGG 0: 1
1: 0
2: 1
3: 18
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928415763 Original CRISPR CACTCAGAGCTCCCTGGGAC TGG Intronic
900104226 1:975463-975485 CACCCAGGGCTCCCGGGGAGGGG + Exonic
900130239 1:1084284-1084306 CCCACAGAGCACCCTGGGACTGG + Intronic
900397237 1:2458118-2458140 CTGTCAGAGCTCCCGAGGACAGG - Intronic
900414198 1:2527657-2527679 CACCCAGGCCTCCCTGGGGCAGG - Intergenic
900756699 1:4440340-4440362 CTGTCCGAGTTCCCTGGGACTGG + Intergenic
901185953 1:7373369-7373391 AACTCGGGGCTCCCTGGGGCTGG - Intronic
901499666 1:9644027-9644049 CACTCTGAGCACCCAGGGAGTGG - Intergenic
901828875 1:11880082-11880104 CACTCTCAGCTCTCTGGAACTGG - Intergenic
902243313 1:15102815-15102837 CAGTCAGAGCTCCCTGTTAGTGG + Intronic
903026223 1:20431290-20431312 CAGTTAGAGCTCCCTGGGAATGG + Intergenic
903130891 1:21279050-21279072 CACCCAGACCCCCCTGGGCCTGG + Intronic
903282500 1:22257887-22257909 CACTCACAGCTCCCTGGGCATGG + Intergenic
903739382 1:25549790-25549812 CACTGAGAGCTCCCAGGTGCTGG + Intronic
904328700 1:29744311-29744333 CACACAGAGCTCCCTTGGGAGGG - Intergenic
905271671 1:36791537-36791559 TCCTCAGGGCTCCCTGGGGCTGG + Intergenic
906102865 1:43274191-43274213 CCCTCACCTCTCCCTGGGACTGG - Intergenic
907885799 1:58591462-58591484 CAGTCAGAGGCCCCTGGGGCTGG - Intergenic
908525089 1:64980330-64980352 CACACAAAGCTCCCTGGGTTTGG + Intergenic
915399416 1:155611539-155611561 TACTCAGCACTCCCTGGGAGGGG - Exonic
915416529 1:155747119-155747141 TACTCAGCACTCCCTGGGAGGGG - Intergenic
915546816 1:156603978-156604000 CTCTCATAGCCCCCAGGGACAGG - Intergenic
915592168 1:156876702-156876724 ATCTCAGAGCTCCCTGGGGACGG - Intronic
915850211 1:159313846-159313868 GTCCCAGAGTTCCCTGGGACAGG - Exonic
916578781 1:166089662-166089684 CATCCAGAGTGCCCTGGGACTGG + Intronic
917060595 1:171033178-171033200 CACTCTAAGCTCCCTGGGCAGGG - Intronic
917079039 1:171237587-171237609 CACACTGAGCTCCCTGGCAGAGG + Intergenic
917356469 1:174131364-174131386 CACACTGAGCTCCCTGGGCAGGG - Intergenic
919168683 1:193927392-193927414 AACTCAGGGCTCCCTGAGCCAGG - Intergenic
919654003 1:200180207-200180229 CACGCATAGCTCCCTGGGCTGGG - Intergenic
921563435 1:216686681-216686703 AAGTCAGGGCTCCCTGGGAAAGG - Intronic
922718641 1:227889307-227889329 CCCCCAGAGCTACCTGGGAAGGG - Intergenic
922921466 1:229308653-229308675 GGCTAAGAGCTCCCTGGGACAGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1063953735 10:11247309-11247331 CACTGGGAGCTCCCTGTGAGAGG + Intronic
1065515595 10:26521406-26521428 CAGTCAGGCCTCCCAGGGACTGG + Intronic
1066001978 10:31113146-31113168 GACTCAGAGCTGCCTGGGCTTGG - Intergenic
1069061769 10:63902184-63902206 CACACAGAACTCCTTGGGAAAGG + Intergenic
1069915285 10:71783336-71783358 CACTCAGAGCTGACCGGGGCGGG - Intronic
1070159194 10:73855465-73855487 CACTCAGCTCTGCCTGGGCCTGG + Intronic
1070547420 10:77463627-77463649 CACTCAAATCTCCATGGAACAGG + Intronic
1070819045 10:79344081-79344103 CACACAGGGCTACCTGGGAGAGG + Intergenic
1070825422 10:79387779-79387801 CACTCAGAGCGGTCTGGGAATGG + Intronic
1072547459 10:96450501-96450523 CACTCAGAGCACCCTGTAAGAGG + Intronic
1072837912 10:98736290-98736312 CACTCACAGTTCCATGTGACTGG - Intronic
1073485911 10:103819182-103819204 ACACCAGAGCTCCCTGGGACTGG - Intronic
1074406824 10:113187225-113187247 GCTTCAGAGCTCTCTGGGACTGG - Intergenic
1075062188 10:119264924-119264946 GACACTGAGCTCCCAGGGACAGG - Intronic
1076620167 10:131781968-131781990 AACTCACAGCTCCCAGGGCCAGG - Intergenic
1077111245 11:863151-863173 GTCTCTCAGCTCCCTGGGACCGG + Intronic
1077116009 11:884937-884959 CACCCAGCTCTCCCTGGGCCAGG - Intronic
1077463611 11:2723051-2723073 CGCTCAGACCACCCTGGCACGGG - Intronic
1077606794 11:3617672-3617694 CACTCAGGGCTCCCCTGGAGTGG - Intergenic
1077918382 11:6625604-6625626 CACTCGGAGCTCCCAGGGTTGGG + Exonic
1081252310 11:40850751-40850773 AACTCCCATCTCCCTGGGACAGG - Intronic
1082162555 11:48900775-48900797 CCCCCAGAGCTCCCTGGGCGTGG - Intergenic
1082243278 11:49892369-49892391 CCCCCAGAGCTCCCTGTGCCTGG - Intergenic
1083038471 11:59663291-59663313 CATTCAAAACTCCCTGAGACAGG - Intronic
1083421604 11:62556416-62556438 GACTCAGGCCTCCCTGGGGCAGG + Intergenic
1084109225 11:67002743-67002765 CACTCAGCACTCCCGGGGGCAGG - Intergenic
1084474348 11:69380488-69380510 CACACAGGCCTCCCTGGCACAGG - Intergenic
1084978393 11:72815520-72815542 GACTCACAGCTCCCTGGGTCGGG - Intronic
1085282995 11:75342837-75342859 CAACCAGAGCTCTCTGGGAAGGG - Intronic
1085427215 11:76415262-76415284 CATGCAGGGCTCCCTGGGCCAGG + Intergenic
1085448364 11:76616018-76616040 TTATCAGAGCTCCCTGGGGCTGG - Intergenic
1088820740 11:113454631-113454653 AAGTCAGAGCTCCCTGGACCAGG + Intronic
1090238617 11:125166513-125166535 CACTCCGAGCCGCCTGGGTCGGG - Intronic
1091147254 11:133290587-133290609 CACTCAGGGGTCTCTGGGTCTGG - Intronic
1091508760 12:1100196-1100218 CACTCACTGCTCCCTTTGACAGG - Intronic
1091680080 12:2520924-2520946 CATTCATAGCTTCCTGGGCCTGG + Intronic
1091784105 12:3231873-3231895 CGCTCTGAGCTCCCTGTGCCTGG + Intronic
1093410426 12:18858672-18858694 CACTCTGACCTCCCTGTGCCAGG + Intergenic
1094137932 12:27149306-27149328 CACTCAGAGAAACATGGGACAGG + Intergenic
1097231820 12:57517042-57517064 CAGTCAGAGCTCCCTGGCTCAGG - Exonic
1098411434 12:70188512-70188534 GACTCTGTGCTCTCTGGGACTGG + Intergenic
1100302023 12:93316362-93316384 GACTGAGAGCTCCCAGGGATAGG + Intergenic
1101970840 12:109310650-109310672 AACTCAGGGCTCCCCTGGACTGG + Intergenic
1102827678 12:115963232-115963254 CCCTCATAGCTGCATGGGACAGG - Intronic
1103161640 12:118734175-118734197 CACTCAGAGCTCCCTCAAATTGG - Intergenic
1103910943 12:124351892-124351914 GACTCAGAGCTCACTGGTCCAGG - Intronic
1104077134 12:125399974-125399996 CACTCAGAGCTGCCTTGGATGGG + Intronic
1104805326 12:131586141-131586163 CACACAGAGCACGCTGGGGCTGG + Intergenic
1104965225 12:132505916-132505938 CTCCCAGAGCTTCCTGGGAATGG + Intronic
1106361854 13:29038664-29038686 AACTCCCATCTCCCTGGGACAGG - Intronic
1107342449 13:39422835-39422857 AACTCACAGTTCCATGGGACTGG + Intronic
1107353043 13:39536334-39536356 CACTCAGATCTCCCTTCGAGAGG + Intronic
1107756509 13:43629192-43629214 CACTCAGGCTTCCCTGGCACGGG + Intronic
1113104634 13:106759130-106759152 AGCTCAGAGCCCTCTGGGACAGG + Intergenic
1113942154 13:114023931-114023953 CACTCAGAGGTCGCAGGGCCTGG - Intronic
1114318004 14:21525039-21525061 CCCTCAGAGCTACCTGGGACAGG - Exonic
1114393780 14:22338273-22338295 CACCCAGGTCTCCCTGGGAGAGG + Intergenic
1115067603 14:29283789-29283811 GCCTCAGAGCACCTTGGGACTGG - Intergenic
1115463414 14:33686832-33686854 CAAACAGAGCTGCCTGGGAAGGG - Intronic
1117288865 14:54313042-54313064 GACTCAGAGCTCCATGTGGCTGG - Intergenic
1118002777 14:61539070-61539092 CAGTCAGAGCTGCTTGAGACTGG + Intronic
1118047103 14:61982347-61982369 GACTCAGAGTTCCATGTGACTGG + Intergenic
1118489475 14:66245000-66245022 CACTCAGTGCTTCCTGAGGCAGG + Intergenic
1118768062 14:68923216-68923238 CACACTGAGCTCCTTGGGGCAGG - Intronic
1118774431 14:68964881-68964903 CACTCTGATGTTCCTGGGACTGG - Intronic
1119613720 14:76084524-76084546 CACTCAGCGCTCCCTATGGCCGG - Intronic
1122155455 14:99747741-99747763 CACTCAGGCCTCCCAGTGACTGG - Intronic
1202845425 14_GL000009v2_random:168620-168642 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1202914825 14_GL000194v1_random:158886-158908 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1202875366 14_GL000225v1_random:202599-202621 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1202877844 14_KI270722v1_random:23823-23845 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1125450023 15:39798414-39798436 CAAGCAGAGCTCCCTGTGTCTGG - Intergenic
1125524422 15:40366013-40366035 CAGTCTCAGCTCCCTGGGCCAGG - Intronic
1126564797 15:50084041-50084063 CCTTCAGAGCTGCCTGGGACAGG - Intronic
1127397248 15:58552562-58552584 CACTCCAGGCTCCCTGGGTCGGG + Intronic
1129241659 15:74255727-74255749 CGCTCAGTGCCCCCTGGGCCTGG + Intronic
1130331194 15:82923543-82923565 CACTCTGAGCCCTCTGAGACTGG - Intronic
1133925686 16:10190254-10190276 CAGTCCGAGTTCCCTGGGGCTGG - Intergenic
1134088252 16:11373278-11373300 CACTCAGAGCTACCAGGCAAAGG + Intronic
1134124168 16:11605099-11605121 CCCTCAGGGCTCCCAGGAACAGG + Intronic
1136046914 16:27622385-27622407 CACTCAGAGTCCACTGGGACAGG - Intronic
1140133978 16:72188938-72188960 CACTCTGCGCTCCCTTGGTCGGG - Intergenic
1141291592 16:82722869-82722891 CAGTCAGAGCTTCCTGGTGCTGG - Intronic
1141493312 16:84389664-84389686 CCCTCAGTGCTCCCTGGTGCTGG + Intronic
1142107712 16:88315266-88315288 CCCTCTGAGGTCCCTGGGGCAGG + Intergenic
1142127569 16:88417767-88417789 CTCTGAGAGCTCCCCGGCACTGG - Intergenic
1142353406 16:89590019-89590041 CAGCCAGGGCTCCCTGGGCCAGG - Intronic
1142483523 17:232710-232732 GACTCAGATCTCCCTGGTGCAGG - Intronic
1142980765 17:3669869-3669891 TATTAAGAGCTCCCTGGGCCGGG + Exonic
1142994032 17:3750582-3750604 GACTCGGGGCTCCCTGGGGCTGG - Intronic
1145787909 17:27605860-27605882 CAAACAGGGCTCCCTGGGAAGGG - Intronic
1146375061 17:32288245-32288267 ACCTCTGACCTCCCTGGGACTGG + Intronic
1147614325 17:41819461-41819483 CACTCTGAGCTGCCTGGAAGGGG + Intronic
1148051086 17:44770186-44770208 CCCTCAGAGCCTCCTGGGTCGGG - Intronic
1148335912 17:46841435-46841457 CGCCCAGAGGTGCCTGGGACAGG - Intronic
1150114802 17:62537625-62537647 CACCCTGAGCTGCCTGGGATAGG + Intronic
1150580191 17:66466357-66466379 AACGCAGGGCTCCCTGGGTCTGG - Intronic
1151670240 17:75568260-75568282 TGCTGAGAGCTCCCTGGCACAGG - Intronic
1152771773 17:82174193-82174215 CAGTCAGAGCGTCCTGGGAAGGG - Intronic
1153082267 18:1241690-1241712 CACACTGTGCTGCCTGGGACTGG - Intergenic
1155045888 18:22102713-22102735 CACTCAGATCTGCCTGTCACTGG - Intergenic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1157999994 18:52607222-52607244 CACTCTGAGCTACCTCAGACTGG + Intronic
1158410975 18:57205995-57206017 CATTCAGACCTCCCTGGTAATGG + Intergenic
1160363734 18:78306666-78306688 CACTCACAGCTTCCTGGGATTGG + Intergenic
1160718103 19:585499-585521 CACCAAGAGCACCCAGGGACGGG - Intergenic
1161733526 19:5977128-5977150 CATTCGGTGCTCCCTGTGACTGG - Intronic
1162133625 19:8542452-8542474 CCCCCAGAGATCCCTGAGACAGG - Intronic
1163160860 19:15463437-15463459 CACTGTGAGCTCCATGGGGCAGG + Intronic
1163518837 19:17780105-17780127 CACTCAGCTCTCCCTTGAACGGG - Intronic
1164798406 19:31055118-31055140 CAGTCAGCACTCCCTGGTACAGG - Intergenic
1165301616 19:34973359-34973381 CAAGCAAAGTTCCCTGGGACCGG - Intergenic
1165707105 19:37984121-37984143 CACACAGCGCTCCCTGAGACTGG - Intronic
1165747362 19:38237913-38237935 CAATCAGAGGCCCCTGAGACGGG + Intergenic
1202672834 1_KI270710v1_random:9120-9142 AACTCAGAGCTCCAAGGGAATGG - Intergenic
926223081 2:10948923-10948945 CACTCAGAGCACACTGGGGCTGG + Intergenic
926542126 2:14193908-14193930 CCCTCAGATCTCCCTCCGACAGG - Intergenic
927652028 2:24919059-24919081 CTCTCAGGGCTCTCTGAGACCGG + Exonic
928415763 2:31090300-31090322 CACTCAGAGCTCCCTGGGACTGG + Intronic
928509357 2:31987630-31987652 CACCCAGAGCTATCTGGCACAGG - Intronic
929013430 2:37470723-37470745 CACTCTGGACTGCCTGGGACGGG + Intergenic
929091156 2:38218508-38218530 ACCTCAGCGCTCCCTGGGAAAGG - Intergenic
930581464 2:53217111-53217133 AACTCTGATCTCCCTGGGCCTGG - Intergenic
931753834 2:65354164-65354186 CACTCAGGGCTCCCAGGCTCGGG - Intronic
934652752 2:96101764-96101786 CCCTCCGAGCTCCCTAGGGCTGG - Intergenic
934753527 2:96809667-96809689 TACTCAGAGGTCCCTGGCAGAGG - Exonic
936947268 2:117941923-117941945 CACTCAGAGCCCGCTTGGTCTGG - Intronic
937239906 2:120453282-120453304 CACTCAAAGATCACTGTGACTGG - Intergenic
937893994 2:126963519-126963541 CACGCTGAGCTCCCTGGGCAGGG - Intergenic
937962500 2:127471377-127471399 GACTGTGAGCTCCCTGGGGCAGG - Intronic
938379485 2:130828558-130828580 CAGGCTGAGCTCCCTGGGCCTGG - Intergenic
938379712 2:130829643-130829665 CCCTCTGAGTCCCCTGGGACTGG + Intergenic
939411074 2:141825125-141825147 TACAAAGAGCTCCCTGAGACTGG - Intronic
940255421 2:151723384-151723406 CACTGAGAGCTTTCTGGGCCTGG + Exonic
940273414 2:151915378-151915400 CACGCTGAGCTCCCTGGGCGGGG - Intronic
940445646 2:153773096-153773118 CAATCAGATCTCACTGGGTCTGG + Intergenic
942711125 2:178837545-178837567 GACTCAGGGCTTCCTGGGAGAGG + Exonic
944296082 2:198064114-198064136 CTCCCAGAGCTCCCTGAGAGTGG - Intronic
945158660 2:206865516-206865538 CACTCAGAGCTCTTGGGGAATGG + Intergenic
946682616 2:222233170-222233192 CACTCAGAAGGCCCTGGGATTGG - Intronic
948757355 2:240167385-240167407 CACTGAGACCTCTCTGGGAGGGG + Intergenic
1170800121 20:19583752-19583774 GACTCTTAGCTCCATGGGACAGG + Intronic
1170874487 20:20237369-20237391 GGCTCAGAGCTCCCTGGTCCTGG - Intronic
1171198845 20:23224999-23225021 CAGACAGAGCTGCCTGGGACTGG + Intergenic
1172368904 20:34371840-34371862 CACTTAAATCTCCCTGGGCCTGG + Intronic
1173550738 20:43931539-43931561 CACTGTGGGCTCCCTGGGGCTGG + Intronic
1174138190 20:48394878-48394900 CAGGCAGAGCCTCCTGGGACAGG + Intergenic
1174664618 20:52246354-52246376 CACCCAGAGCTCTCTGGAAAGGG + Intergenic
1174797011 20:53530656-53530678 AACTCATAGCTCCATGTGACTGG - Intergenic
1175298091 20:57923234-57923256 CAGACAGAGCTCCCTGGAAAAGG + Intergenic
1175909283 20:62396960-62396982 CACCCAGCGCTGCCTGAGACTGG + Intronic
1175956723 20:62614445-62614467 CACCCAGGGCTCACTGGGTCTGG - Intergenic
1176024409 20:62978484-62978506 CACTCTCAGCCACCTGGGACAGG - Intergenic
1176634176 21:9173531-9173553 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1176639132 21:9281258-9281280 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1179005846 21:37513318-37513340 CACTCAGACCTCCCCAGGACTGG - Intronic
1180372439 22:12054101-12054123 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1180415907 22:12712918-12712940 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1180423178 22:12888765-12888787 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1182020540 22:27077760-27077782 CACTGTCAGCTCCATGGGACAGG - Intergenic
1183176943 22:36231274-36231296 CACTCAGATCTCCCCTGGGCTGG - Intronic
1184744918 22:46450618-46450640 CACACAGAGCTTGCAGGGACGGG + Intronic
954422513 3:50426091-50426113 CTCCCAGAGCTCCCAGGGATTGG - Intronic
954747187 3:52793988-52794010 CACCCAGAGCTCCTGGGGGCTGG - Intergenic
955879576 3:63529441-63529463 CACTCAGACCTCCCTGTACCTGG - Intronic
956383027 3:68686076-68686098 AACTCCCATCTCCCTGGGACAGG - Intergenic
957681014 3:83435257-83435279 GAGTCAGAGCCCACTGGGACTGG + Intergenic
960523458 3:118682168-118682190 GACTCAGTGCTCCTTGGGATTGG - Intergenic
960901352 3:122557452-122557474 TACTCAGATCTCCCTGCGATTGG + Intronic
961313443 3:126018142-126018164 CACTCAGGAGTCACTGGGACTGG - Intronic
967445042 3:189555697-189555719 AGATCAGAGCTCCATGGGACTGG + Intergenic
1202747763 3_GL000221v1_random:123761-123783 AACTCAGAGCTCCAAGGGAATGG - Intergenic
968505277 4:968447-968469 CCCCCAGGGCTCCCTGGGGCCGG + Intronic
968969113 4:3784337-3784359 CCCTCAGAGCTCCCTGCGCCCGG + Intergenic
968984051 4:3865833-3865855 CAGTCAGAGCTCATTTGGACAGG + Intergenic
969605341 4:8199586-8199608 CACTCAGAGCTCACAGGTGCTGG + Intronic
970289474 4:14555433-14555455 CACTCAGAGCTCCCCGCAAGAGG - Intergenic
970309425 4:14766692-14766714 CACAAAGAGCTACCTGAGACTGG + Intergenic
970692588 4:18636632-18636654 AACACAGATCTCCCTGGGAATGG - Intergenic
971268416 4:25114688-25114710 GACTCAGACCTTCCTGGGATGGG - Intergenic
971430029 4:26556143-26556165 AACTCCCATCTCCCTGGGACTGG - Intergenic
973163174 4:47044539-47044561 CACTCATAGCTCTCTGAAACAGG - Intronic
973316565 4:48766586-48766608 TACTCAGGGCCCCCTGTGACTGG - Intronic
975459245 4:74631184-74631206 CACTCAGTGCAGCCTGGGAAGGG - Intergenic
975508965 4:75171218-75171240 CACTCAGAGCCCTATGGGGCAGG + Intergenic
975612209 4:76213979-76214001 CACTCAGGGCCACCGGGGACCGG - Intergenic
976362580 4:84197103-84197125 CACTGACACCTCCCTGGCACTGG + Intergenic
978206126 4:106083176-106083198 CACTCTAAGCTCCCTGGGCAGGG + Intronic
979182745 4:117752279-117752301 CACTCACAGCTCCATGTGTCTGG - Intergenic
1202754029 4_GL000008v2_random:39671-39693 AACTCAGAGCTCCAAGGGAATGG + Intergenic
985621598 5:959007-959029 CGTTCAGTGCTCCCTGGCACGGG + Intergenic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
985997434 5:3604815-3604837 CACCCAGGGGTACCTGGGACAGG + Intergenic
991435177 5:66590816-66590838 CATTGAGAGCTCCCTTAGACTGG + Intergenic
991707588 5:69372908-69372930 CACTCAGAAATGCCTGGGAATGG - Intronic
992826102 5:80551550-80551572 GACTCAGATCTTCCTAGGACAGG + Intergenic
993221569 5:85104923-85104945 CACTTAGAGCCCCCTGAGATTGG + Intergenic
995141886 5:108744414-108744436 CCCTCAGAGATCCCTAGGCCTGG + Intergenic
995266448 5:110167129-110167151 CTCTCAGAGGTCCATAGGACAGG - Intergenic
996094353 5:119382339-119382361 CACTCAAGACTCCCAGGGACTGG - Intronic
996405554 5:123099428-123099450 CACCCAGATCTGCCTGGTACCGG - Intronic
997882069 5:137600285-137600307 CAACCAGAGCTCCCTGGGGCAGG + Intergenic
998140670 5:139697768-139697790 CACCCAGAGCTCCCTGTGCTGGG + Intergenic
998788796 5:145743916-145743938 CACGCTAAGCTCCCTGGGCCGGG + Intronic
999110981 5:149121303-149121325 CACACAGGGCTGCCTGGGCCAGG + Intergenic
1000173601 5:158728228-158728250 CACTGAGAGCTTCCTGGGGTGGG + Intronic
1001274422 5:170339972-170339994 CACTCAGGGCTCCAGGTGACTGG - Intergenic
1001753549 5:174149346-174149368 GACAGAGAGCTCCATGGGACAGG - Intronic
1002167498 5:177357633-177357655 AACTTAGAGCTCCCTGGTCCTGG + Intergenic
1003324610 6:5083026-5083048 CACTGAGAGCTCCCCGGGGGTGG + Intergenic
1006245423 6:32730569-32730591 CACTGAGAGCTCCCTGGCCTGGG - Intergenic
1006837318 6:37006863-37006885 GCTCCAGAGCTCCCTGGGACAGG - Intronic
1007493804 6:42245086-42245108 AACCCAGGGCTCTCTGGGACGGG - Intronic
1008773682 6:55009295-55009317 CACGCTGAGCTCCCTGGGCGGGG - Intergenic
1008785146 6:55158823-55158845 AACTCCCATCTCCCTGGGACAGG + Intronic
1009518078 6:64644837-64644859 TATTCAGAGCTGCCTGGCACAGG - Intronic
1010170167 6:72965962-72965984 CACTTTAACCTCCCTGGGACTGG - Intronic
1010775460 6:79879540-79879562 CACACTGAGCTACCTGGAACTGG - Intergenic
1017207418 6:151818378-151818400 GACCCAGAGAGCCCTGGGACAGG - Intronic
1017782220 6:157724375-157724397 GACTCAGGTCTCCCTGGGCCTGG - Intronic
1019988926 7:4679003-4679025 CACACAGAGTTCCCTGGCAGGGG + Intergenic
1020254962 7:6497833-6497855 CACTCAGCGCTCGCTGGGGAGGG + Exonic
1022443485 7:30452021-30452043 CACTCTGTGCTCGCTGGGGCAGG - Exonic
1023247060 7:38216441-38216463 CACACAGAGCTGCTTGGGAGAGG - Intronic
1024021540 7:45375117-45375139 AACTCACAGCTCCATGTGACTGG + Intergenic
1027612040 7:80373711-80373733 CAATCATTGCTACCTGGGACAGG - Intronic
1030701591 7:112646999-112647021 CACGCTCAGCTCCCTGGGAGGGG - Intergenic
1032044515 7:128593305-128593327 CACCCTGAGCTGCCTGGGATAGG + Intergenic
1032659708 7:133969966-133969988 AACTCCCATCTCCCTGGGACAGG - Intronic
1033050708 7:138001753-138001775 CGCGCAGAGCTGCCTCGGACCGG + Exonic
1035233885 7:157484111-157484133 CCCTCAGAGCTGCCTGGGTGGGG - Intergenic
1035412040 7:158652269-158652291 TACTCAGAACTCCCCAGGACGGG - Intronic
1037856052 8:22371150-22371172 CACTCTGGGCTCCCTTGGGCAGG - Intronic
1037946893 8:22995329-22995351 TACTGAGAACTCCCTGGGACCGG - Intronic
1040968158 8:53105029-53105051 CATGCAGAGATCACTGGGACAGG + Intergenic
1042227385 8:66524786-66524808 TGCTCTGAGCTCCCTGGGAGTGG + Intergenic
1044873368 8:96641831-96641853 CTCTGATATCTCCCTGGGACAGG - Intergenic
1047186440 8:122637348-122637370 GACCCAGAGCTCTCTGGGGCTGG - Intergenic
1048044378 8:130759405-130759427 CACTCAGGGGTCCCTGGGGAAGG - Intergenic
1049196410 8:141318163-141318185 TACTCAGAGCTCCTTGGAGCCGG - Intergenic
1049696991 8:143989130-143989152 GACTCAGAGCGGCCTGGGAGAGG + Intronic
1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG + Intergenic
1049828427 8:144685173-144685195 CACTCACACCCCCCTGGGGCCGG + Intergenic
1051609996 9:18951683-18951705 CACTTATAGCTACCTGTGACTGG + Intronic
1051748943 9:20321721-20321743 CACTCAGACCTACAGGGGACTGG - Intergenic
1051863354 9:21651475-21651497 AACTCCCATCTCCCTGGGACAGG - Intergenic
1055785237 9:79863891-79863913 CACTCAGAGCTGCCAGCAACAGG + Intergenic
1056793212 9:89639529-89639551 AAAGTAGAGCTCCCTGGGACAGG - Intergenic
1057481486 9:95448401-95448423 CACCCTGTGCTCCCTGGGATGGG - Intronic
1057931326 9:99196011-99196033 CACACAGAGCTCCCTGTGGGTGG + Intergenic
1059461267 9:114431925-114431947 CCACCAGAGCTCACTGGGACAGG + Intronic
1059528919 9:115018006-115018028 CACTCAGTGCTCCCAGGGGTGGG + Intergenic
1060113070 9:120920300-120920322 CACTCAGAGCTCCCCAGGGTAGG + Intronic
1060245909 9:121946191-121946213 CACACAGAGTGCCCTGGGCCTGG + Intronic
1060889248 9:127177721-127177743 CACTCACTGGTCCCTGGGGCAGG + Intronic
1061219009 9:129238067-129238089 CACTCACAGCTCCAGGGAACAGG - Intergenic
1061951812 9:133940472-133940494 CACTGAGAACGCCCTGGGAGCGG + Intronic
1062552900 9:137098245-137098267 CCCCCAGAGCTGCCTGGGACTGG - Intronic
1203757015 Un_GL000218v1:141167-141189 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1203716398 Un_KI270742v1:153842-153864 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1203534817 Un_KI270743v1:24397-24419 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1203650626 Un_KI270751v1:117397-117419 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1185737762 X:2506012-2506034 GACTCACAGCTCCATGTGACTGG - Intergenic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1189041038 X:37542550-37542572 CACCCAGAGCCTCCTGAGACTGG - Intronic
1189041283 X:37543687-37543709 CACCCAGAGCCTCCTGAGACTGG - Intronic
1189179187 X:38987367-38987389 CACTCCAAGCTCCCTGGCCCCGG - Intergenic
1190286737 X:48966453-48966475 CACACAGAGCTTCCTGGAAGAGG - Intronic
1190875706 X:54458824-54458846 GACTACGAGCTCCCTAGGACAGG + Intronic
1193039282 X:76987579-76987601 CACGCTAAGCTCCCTGGGAGTGG + Intergenic
1193876323 X:86866882-86866904 CACTCAGAGGTCCTAGAGACAGG - Intergenic
1194559585 X:95403918-95403940 AACTCCCATCTCCCTGGGACAGG + Intergenic
1195933876 X:110106932-110106954 CACTCCAACCTCCCTGGGGCTGG - Intronic
1196247070 X:113413055-113413077 CTCTCACAGCTGCCTGTGACAGG + Intergenic
1197527310 X:127578338-127578360 ACCTCAGGGCTCCCTGAGACAGG + Intergenic
1198025457 X:132701620-132701642 CCCACAGAGCTCAATGGGACAGG + Intronic
1201170594 Y:11258791-11258813 AACTCAGAGCTCCAAGGGAATGG - Intergenic