ID: 928416699

View in Genome Browser
Species Human (GRCh38)
Location 2:31098628-31098650
Sequence CCTAACCCCCACACTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 803
Summary {0: 2, 1: 2, 2: 34, 3: 133, 4: 632}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928416699 Original CRISPR CCTAACCCCCACACTGCTCA AGG (reversed) Intronic
900134088 1:1106888-1106910 GCTAAACCCCTCACTGCCCAGGG - Intronic
900286306 1:1902201-1902223 CCCACCCCCCACCCAGCTCAGGG + Intergenic
901053808 1:6439490-6439512 CCTCCGCCCCACACTGCCCAGGG - Intronic
901926356 1:12568572-12568594 CCAAACCCCCACCCTCCCCAGGG + Intronic
902383603 1:16064247-16064269 CCTACCCCACACACTGCTGGGGG + Intronic
902391569 1:16110055-16110077 CCTAACCACCACACAGCACCAGG - Intergenic
902480488 1:16708839-16708861 CCTCCGCCCCACACTGCCCAGGG + Intergenic
902836704 1:19052021-19052043 CCTAACCCCCACATCATTCAAGG + Intergenic
903011687 1:20335472-20335494 CCTAACCTCCACATTGTTCAAGG - Intronic
903259968 1:22126289-22126311 ACTGACCCCCACACGGCTCAGGG - Intronic
903355511 1:22744276-22744298 CCCTACCCCCACATTGTTCAAGG - Intronic
905099316 1:35504680-35504702 CCTAACCCCTACACTGTTCAAGG + Intronic
905847951 1:41249039-41249061 TCTAACCCCCACATTGTTCAAGG - Intergenic
905870007 1:41397991-41398013 CCTCATCCTCACACTGCCCAAGG + Intergenic
906746670 1:48226634-48226656 CCCAAGCCCCACACTGTTCATGG - Intronic
907020720 1:51064440-51064462 CCTAATCCCCATAGTGTTCAAGG + Intergenic
908048242 1:60196296-60196318 CCTAACTCCCACATTGTTCAAGG - Intergenic
909046206 1:70712933-70712955 CCTAACCCCCATGTTGTTCAAGG + Intergenic
909142536 1:71886924-71886946 GCTAACTCCCACATTGCTCAAGG - Intronic
909487326 1:76188560-76188582 CCTAACTCCCATATTGTTCAAGG - Intronic
909782291 1:79561771-79561793 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
909820898 1:80059531-80059553 CCTAACCCCTACTTTGTTCAAGG - Intergenic
910592894 1:88947139-88947161 ACTGACCCCCACCCTCCTCATGG + Intronic
911140858 1:94501143-94501165 CCTCAGCCCCCCACTGCTCTGGG - Intronic
911930516 1:103897001-103897023 CCTAACTTCCACATTGTTCAAGG + Intergenic
912104613 1:106256814-106256836 CCTGACCCCCATATTGTTCAAGG - Intergenic
912911856 1:113769196-113769218 CCTCACCCCCAAACTCCTCAGGG + Intronic
913397708 1:118390441-118390463 CCTAACCCCCATGTTGTTCAAGG + Intergenic
914329304 1:146651098-146651120 CCTAATCCTCACATTGTTCAAGG - Intergenic
915087657 1:153399047-153399069 CCTCACCCCCACAATTCTCTTGG + Intergenic
915100092 1:153492939-153492961 TCTCACCCCCAAACTTCTCATGG - Intergenic
915500801 1:156315701-156315723 CCTAACCCCCAAGTTGTTCAAGG + Intronic
915824795 1:159064168-159064190 CCTAATCCCTACATTGTTCAAGG + Intronic
915887554 1:159739251-159739273 CCTAACTCCCACGTTGTTCAAGG + Intergenic
916792795 1:168138013-168138035 CCAAACACCCACATTGCTCTGGG + Intergenic
916939035 1:169661331-169661353 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
916940072 1:169668169-169668191 GCTAAGCCCCTCACTGCCCAGGG - Intronic
917348866 1:174056618-174056640 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
918512009 1:185321919-185321941 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
918514993 1:185353577-185353599 CCTAACCCTTACAATGCTCAAGG - Intergenic
918542706 1:185649173-185649195 GCTAATCCCCTCACTGCCCAGGG + Intergenic
918661502 1:187094073-187094095 CCTAACTCCCACATTACCCAAGG - Intergenic
918910664 1:190563954-190563976 CCTAACCATCACATTGTTCAAGG - Intergenic
919030317 1:192234115-192234137 CCTCACCCACACCCTCCTCAGGG + Intergenic
920192377 1:204201853-204201875 CCTAAGTCCCTCACTCCTCAGGG - Intronic
921080346 1:211733968-211733990 CCTAACTCCCTCATTGTTCAAGG - Intergenic
921299748 1:213739439-213739461 CCTAACCCCTACGTTGTTCAAGG + Intergenic
921537934 1:216375121-216375143 CCTAACCCCCATATTGTTAAAGG - Intronic
922087385 1:222363820-222363842 CCTACCCCCCTCACTACCCAAGG - Intergenic
922131458 1:222783864-222783886 ACTAACCCCACCACTGCTGAGGG - Intergenic
923006335 1:230052947-230052969 CCTAACCCCCATGTTGTTCAAGG - Intergenic
923249177 1:232163477-232163499 CCTACCCCCCACACAGCCCCTGG - Intergenic
923266771 1:232322063-232322085 TCTAAGCCCCGCATTGCTCAAGG + Intergenic
923861320 1:237894729-237894751 CCTAGCCCCCACATTGTTCAAGG - Intergenic
923931092 1:238697928-238697950 CCTAACCCCTGTATTGCTCAAGG - Intergenic
924377552 1:243429450-243429472 CCTAACCCCCATGTTGCTCAAGG + Intronic
924389661 1:243539505-243539527 CGTAACTCCCACATTGTTCAAGG + Intronic
1063247248 10:4234468-4234490 CCTAACCCCCACGTTGTTCAAGG - Intergenic
1063848701 10:10161011-10161033 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1063877630 10:10496795-10496817 CCACACCCCCAAACTTCTCATGG - Intergenic
1064452526 10:15455602-15455624 CTTAACCCACACACTCCTCCAGG + Intergenic
1064729131 10:18311391-18311413 CCTAACCGCCACATTGCTCAAGG - Intronic
1064859621 10:19814156-19814178 CCTGACCCCCATACTGTTCAAGG - Intergenic
1065554900 10:26905660-26905682 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1065697779 10:28395676-28395698 CCTACCCCCCACAATACACAAGG - Intergenic
1065895891 10:30162969-30162991 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1065983870 10:30930320-30930342 GCTAAGCCCCTCACTGCCCAGGG + Intronic
1066129713 10:32380990-32381012 CCTAACCCCCACATACTTCAAGG - Intergenic
1066478323 10:35770232-35770254 TCTAACCCTCACATTGTTCAAGG - Intergenic
1066568687 10:36748427-36748449 GCTAAGCCCCTCACTGCTCAGGG - Intergenic
1066590569 10:36989538-36989560 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1066648749 10:37636143-37636165 CCTAGCCCCCACATTGTTTAAGG - Intergenic
1066986696 10:42474981-42475003 CATATCCCCCACATTGTTCAAGG - Intergenic
1067031634 10:42881833-42881855 CCTAGCCCCCACATTGTTTAAGG - Intergenic
1067068967 10:43118959-43118981 CCAAACCACCATGCTGCTCAGGG + Intronic
1068216667 10:53990926-53990948 GCTAAACCCCTCACTGCCCAGGG - Intronic
1068417326 10:56740815-56740837 CTTAACACCCACACTGTTCAAGG + Intergenic
1068820972 10:61377117-61377139 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1068913385 10:62403001-62403023 CCTAACCCTTGCACTGTTCAAGG - Intronic
1069280848 10:66651709-66651731 GCTAAGCCCCTCACTGCTCGGGG + Intronic
1069863734 10:71487290-71487312 CCTAACCCCCACATTGCTCAAGG - Intronic
1070172719 10:73944717-73944739 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1070985015 10:80681273-80681295 ACTAACCCCCTCTTTGCTCAGGG + Intergenic
1071010566 10:80935660-80935682 CCTAACCTCCACATTGTTCAAGG + Intergenic
1071055697 10:81505940-81505962 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1071107280 10:82112962-82112984 CTTCTCCCCCACACTGCTCCTGG + Intronic
1071456977 10:85858394-85858416 GCTCACCCCCTCACTGCACAGGG + Intronic
1071489412 10:86126030-86126052 CCTAATCTCCACATTGTTCAAGG + Intronic
1071600434 10:86956196-86956218 CCTGCCCCCAACTCTGCTCAGGG - Intronic
1071877361 10:89855677-89855699 TCTACACCCCACACTGCTCAGGG + Intergenic
1072026351 10:91463056-91463078 CCTAACCCTCGCATTGTTCAAGG - Intronic
1073897045 10:108173859-108173881 CCTAACCCTTACATTGCTCAAGG + Intergenic
1074001186 10:109374896-109374918 CCTAACACCCACATTGTTCAAGG + Intergenic
1074107164 10:110397111-110397133 CCTAATCCCCTCATTGTTCAAGG - Intergenic
1074195980 10:111185686-111185708 CCTATCCCCTACATTGTTCAAGG + Intergenic
1074321304 10:112405655-112405677 CCTAACCCCCATGTTGTTCAAGG - Intronic
1075023889 10:118969725-118969747 CCAAATCCCCACATTGCTCTGGG + Intergenic
1075218451 10:120560958-120560980 CCTATCCCCCACATTATTCAAGG + Intronic
1075376029 10:121978635-121978657 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1075624649 10:123953413-123953435 ACTGACCCCCACACTCTTCATGG - Intergenic
1076695629 10:132246034-132246056 CCCCACCCCGACACTGCCCAGGG + Intronic
1077583791 11:3435190-3435212 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1077694515 11:4382222-4382244 ACTAACCCCCTCCTTGCTCAGGG - Intergenic
1077764590 11:5144529-5144551 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1078378682 11:10819481-10819503 CCTAACCTCCACATTGTTCAAGG + Intronic
1078562144 11:12381522-12381544 CATAACCCCCACATAGTTCAAGG - Intronic
1078787186 11:14506160-14506182 ACTAAACCCCACACTGTTCGAGG + Intronic
1078947350 11:16084523-16084545 CCTAACCCCAACCCTACTGAGGG + Intronic
1079000068 11:16745290-16745312 CCTAACCCCCACATTGCTCAAGG - Intronic
1079190978 11:18276339-18276361 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1079279619 11:19075606-19075628 CCCACCCCCCAAACTGCTGATGG + Intergenic
1079756809 11:24274487-24274509 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1079807149 11:24946994-24947016 CCTAACTTCCACATTGTTCAAGG - Intronic
1079898996 11:26157476-26157498 CCAAAACCCCACACTCCACATGG - Intergenic
1080223513 11:29934277-29934299 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1080250444 11:30227572-30227594 ACTAACCCCCTCCTTGCTCAGGG - Intergenic
1080360305 11:31506036-31506058 CCTGATCCGCACACTGTTCAAGG + Intronic
1080503080 11:32888414-32888436 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1080517252 11:33035921-33035943 CATAACCCCCACATTGTTCAAGG + Intergenic
1080618682 11:33968219-33968241 CCTTAACCCCTCTCTGCTCATGG - Intergenic
1081046413 11:38278845-38278867 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1081136155 11:39442308-39442330 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1081371915 11:42314473-42314495 CCTAACCCCTGCATTGTTCAAGG - Intergenic
1081613033 11:44574684-44574706 CCAAAACACCAAACTGCTCACGG - Intronic
1083550860 11:63589244-63589266 CTTAACCACCACACTGACCAGGG + Intronic
1083652635 11:64212065-64212087 CCTGAGCCCCAGACTTCTCAGGG - Intronic
1084186651 11:67476206-67476228 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1084240693 11:67817862-67817884 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1084408273 11:68991477-68991499 CCCATCCCCCACTCTGCTCTGGG + Intergenic
1084454135 11:69257700-69257722 CCTACTCCCCACACTTCCCAGGG - Intergenic
1084831737 11:71774850-71774872 GCTAAGCCCCTCACTACTCAGGG - Intergenic
1085027744 11:73247017-73247039 CCTAACCCCTGCACTGTTCAAGG + Intergenic
1085659233 11:78347853-78347875 CCTAACCCCCATGTTGTTCAAGG - Intronic
1086587325 11:88469449-88469471 CCTAACCCCCACATTGTTCAAGG - Intergenic
1087079329 11:94154668-94154690 CCCGACCCCCACATTGTTCAAGG - Intronic
1087245180 11:95826652-95826674 CCTAACCCCTCCATTGTTCAAGG + Intronic
1088033107 11:105276333-105276355 CCTAACCCTCACATTGGTCAAGG - Intergenic
1088297372 11:108314616-108314638 TCTAACCCTTACACTGTTCAAGG - Intronic
1088424287 11:109685222-109685244 CCTAACCCCCATACTTATGATGG + Intergenic
1088543994 11:110941615-110941637 CCTAACCCCCACATTGTTCAAGG - Intergenic
1089094418 11:115906845-115906867 TCTGAGCTCCACACTGCTCAGGG + Intergenic
1090480115 11:127060617-127060639 CCTAACTCCCATATTGTTCAAGG + Intergenic
1090641316 11:128731255-128731277 ACTAACCCCAGCACTGCTCAGGG + Intronic
1090768662 11:129898940-129898962 CCTTACCACCACATTGCTAAAGG - Intergenic
1090782724 11:130021787-130021809 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1091818761 12:3458870-3458892 CCCAAGCCCCCCACTTCTCAGGG + Intronic
1092189019 12:6504252-6504274 CCTAACCCCCACGTTGTTCAAGG - Intronic
1092238495 12:6823855-6823877 CCCCACCCCCACAGAGCTCAAGG + Exonic
1092626233 12:10332664-10332686 CCTAATGCCCACATTGTTCAAGG - Intergenic
1092981842 12:13803303-13803325 CCTAACCCCCACATTGTTCAAGG + Intronic
1093172353 12:15874742-15874764 GCTAAGCCCCTCACTGCCCAGGG - Intronic
1093327333 12:17793990-17794012 TCTAACCCCTACACTGTTCAAGG - Intergenic
1093527093 12:20115475-20115497 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1093570494 12:20661547-20661569 CCTAGGCTGCACACTGCTCAGGG - Intronic
1093682605 12:22020108-22020130 CCTAACCCCCACATTGTGCAAGG + Intergenic
1093682833 12:22023168-22023190 GATAACCCCCACATTGCTAAGGG - Intergenic
1093805317 12:23425380-23425402 CCTAATCCCCACAGTGTTCAAGG + Intergenic
1095187400 12:39216689-39216711 CCTAACCCCCACACTGCTCAAGG + Intergenic
1097253679 12:57655881-57655903 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1097902421 12:64886460-64886482 CCTAACCCCCACCATGTGCATGG + Intergenic
1098603210 12:72358592-72358614 TCTAACCCGCACATTGTTCAAGG + Intronic
1099190209 12:79554251-79554273 GCTAAGCCCCTCATTGCTCAGGG + Intergenic
1099466401 12:82993684-82993706 TCTAACCCTCACATTGTTCAAGG + Intronic
1099999416 12:89815059-89815081 CCTAACCCCCACATTTTTCAAGG + Intergenic
1100384638 12:94094405-94094427 CCTAACCCTCACATTGATCAAGG - Intergenic
1100647194 12:96544035-96544057 CCTAACCCTCATATTGTTCAAGG - Intronic
1100766764 12:97874889-97874911 CCTAATCCTCACATTGTTCAAGG + Intergenic
1100821589 12:98436793-98436815 CCTAACTCCCACATTGTTCAAGG + Intergenic
1102210604 12:111124129-111124151 CTTGGCCCCTACACTGCTCAGGG - Intronic
1102411433 12:112723131-112723153 CCTAATCCCTACACTGCTCAAGG - Intronic
1102430682 12:112880639-112880661 CTTAACTCCCACATTGTTCAAGG - Intronic
1102511231 12:113416927-113416949 GCTAACCCCCTCCTTGCTCAGGG - Intronic
1103497556 12:121374579-121374601 GCTAAGCCCCTCACTGCCCAAGG - Intronic
1103612320 12:122131393-122131415 CCTAAACCCCACATGGCCCAGGG - Intronic
1103807100 12:123582185-123582207 CCAAACCCCCACGTTGTTCAAGG + Intergenic
1104871128 12:131997098-131997120 CCTAATCCCCACATTGTTCAAGG - Intronic
1104910744 12:132239170-132239192 CCCCACCCCCACACAGCTCCTGG - Intronic
1105204008 13:18204440-18204462 CCTAACCCTTGCACTGTTCAAGG - Intergenic
1105270303 13:18867599-18867621 CCTCACCCCCACATTATTCATGG + Intergenic
1105486283 13:20836145-20836167 TCTAACCCTCACATTGTTCAAGG + Intronic
1106423647 13:29605103-29605125 CCTAAGCCCCACATTGTTCCAGG + Intergenic
1106736538 13:32593246-32593268 CCTAACCCCTTCGCTGTTCAAGG - Intronic
1107497926 13:40946919-40946941 CCTAACCCCCACATTGTTTGGGG + Intronic
1107555255 13:41512427-41512449 ACGGAACCCCACACTGCTCACGG + Intergenic
1109124928 13:58505666-58505688 GCTCAGCCCCTCACTGCTCAGGG + Intergenic
1110371256 13:74743189-74743211 TATAAGCCCCAGACTGCTCAAGG + Intergenic
1111021370 13:82456847-82456869 CCCAGCCCCCACATTACTCAAGG + Intergenic
1111176386 13:84601792-84601814 CCTAACCCCCAAGTTGTTCAAGG + Intergenic
1111852819 13:93598212-93598234 TCTAACCCCCACAGTATTCAAGG + Intronic
1112301924 13:98238901-98238923 GCCAACCCCCACATTGTTCAAGG + Intronic
1112461084 13:99604453-99604475 CCTCATCCCCAGAATGCTCATGG - Intergenic
1112557193 13:100479345-100479367 CCTAGCCCCCATATTGTTCAAGG - Intronic
1113009961 13:105752918-105752940 CCTAGCCCCTGCACTGTTCAAGG + Intergenic
1113163962 13:107416734-107416756 CCCAACCCTCACGTTGCTCAAGG + Intronic
1114771227 14:25430252-25430274 CCAAACTCCCACGCTGGTCATGG - Intergenic
1115174601 14:30547763-30547785 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1115253549 14:31374441-31374463 CCTAACCTCCATGCTGTTCAAGG + Intronic
1115864679 14:37732002-37732024 CCCAACCCTCACATTGTTCAAGG - Intronic
1116073463 14:40080310-40080332 CTTAACCCCAACATTGTTCAAGG + Intergenic
1116311007 14:43326719-43326741 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1116656956 14:47665645-47665667 GCTAAGCCCCCCATTGCTCAGGG - Intronic
1117082586 14:52166861-52166883 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1117193422 14:53316385-53316407 CCCAACCCCCACAGTGGCCATGG - Intergenic
1117282515 14:54254740-54254762 CCTAACCCCTGCATTGTTCAAGG - Intergenic
1117449814 14:55839623-55839645 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1118105240 14:62651221-62651243 CCTAACCCCCTCATTGTGCAGGG + Intergenic
1118138941 14:63058675-63058697 ACTAACCCCCATGCTGTTCAAGG + Intronic
1119161683 14:72458125-72458147 CCTCACCCCCACACTGAGCAAGG + Intronic
1119431176 14:74568976-74568998 CCTATTACCCACACTGCCCAGGG + Intronic
1119578392 14:75750698-75750720 CCTAAACCCCACATTGTTCAAGG + Intronic
1119608896 14:76045066-76045088 CCCAACACCCACATTGTTCAAGG + Intronic
1120419987 14:84272534-84272556 ACAAACACCCACACTACTCATGG - Intergenic
1121488133 14:94336033-94336055 CCTAACCCCCATGTTGTTCAAGG - Intergenic
1121905002 14:97731672-97731694 CCTAACCTCCACATTGTTTAAGG - Intergenic
1122761566 14:104032687-104032709 CCCAAACCACACACTGCTCCTGG - Intronic
1122885177 14:104707601-104707623 CTTAGCCCCCACACTGGGCAGGG - Exonic
1122894385 14:104749043-104749065 CCTGGCCCCCACACCCCTCACGG + Intergenic
1123051877 14:105547941-105547963 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1123454341 15:20405811-20405833 CCTAACCTTCACATTGTTCAAGG + Intergenic
1124046849 15:26158389-26158411 CCCCACCCCCACAGAGCTCAAGG + Intergenic
1124418134 15:29491121-29491143 ACTAAGCCCCTCACTGCCCAGGG + Intronic
1124870743 15:33539589-33539611 CCTAACCCCTACATTGTTTAAGG - Intronic
1125480789 15:40078496-40078518 CCTAATCCCAACATTGTTCAAGG + Intergenic
1126027427 15:44461217-44461239 CCTAAACTCCACATTGTTCAAGG - Intronic
1126561034 15:50044132-50044154 CCTAACCCCCACATCATTCAAGG + Intronic
1127169167 15:56281294-56281316 CCTAACCCCCAGGCTGCAGACGG + Intronic
1127553194 15:60061473-60061495 ACTAACCCCCTCCTTGCTCAGGG + Intronic
1127707309 15:61560015-61560037 CCTAACCCCCACATTGTTCACGG - Intergenic
1127727522 15:61764605-61764627 CCTGACCTCCACCCAGCTCAGGG + Intergenic
1128730221 15:70015751-70015773 CCCACCCCCTACTCTGCTCATGG - Intergenic
1129997147 15:80016636-80016658 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1130065405 15:80598995-80599017 CCTAACCCCCATGATGTTCAAGG + Intergenic
1130309724 15:82742683-82742705 CCTTACCCCCACATTACTAAAGG + Intergenic
1131532581 15:93206425-93206447 CCAAACCTCCCCACTGCTCCTGG + Intergenic
1131550503 15:93353022-93353044 CACAACCCCCAGACTGGTCAGGG - Intergenic
1131581318 15:93646487-93646509 TCTAAGCCCCACACTTCTCTGGG - Intergenic
1131992381 15:98104469-98104491 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1132022777 15:98377342-98377364 CCTTACCACCACACAGCTAAAGG + Intergenic
1132357356 15:101181774-101181796 CCTAACCCCCACGTCGTTCAAGG - Intronic
1133352158 16:5108756-5108778 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1134677268 16:16099423-16099445 CCTAAGCCACACACTGCAGAAGG - Intronic
1135479676 16:22812916-22812938 CATGACCCCCACCCTGATCAGGG - Intergenic
1136223238 16:28842348-28842370 CCTAACCCCTGCATTGTTCAAGG + Intergenic
1136300926 16:29333823-29333845 TGTGACCCCCACACTGCTCGGGG - Intergenic
1136387011 16:29934537-29934559 CCTAACCCCCACAATGTTCAAGG - Intergenic
1137246068 16:46706084-46706106 CCTAACCCTCACATTGTTCAAGG - Intergenic
1137475268 16:48802429-48802451 CCTTACCCCCACACTACTACAGG + Intergenic
1137814514 16:51385868-51385890 ACTAACCCCCTCCTTGCTCAGGG + Intergenic
1138158741 16:54732297-54732319 CCTGACCCCCACTTTGCTCAAGG - Intergenic
1138664263 16:58550718-58550740 CCTAACGCCCATGTTGCTCAAGG + Intronic
1138757906 16:59511408-59511430 CCTAACCCCTACATTATTCAAGG - Intergenic
1138948760 16:61884882-61884904 CCTAACCCCTGCATTGTTCAAGG + Intronic
1139443385 16:66980318-66980340 CCTAACACCCACATTGTTCAAGG + Intergenic
1139676421 16:68526862-68526884 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1140004260 16:71059836-71059858 CCTAATCCTCACATTGTTCAAGG + Intronic
1141837700 16:86553525-86553547 GCTAAGCCCCTCACTGCCCAGGG - Intronic
1141904559 16:87015512-87015534 CATGCCCCCCACACTGCTGAGGG - Intergenic
1142360313 16:89623073-89623095 CCTAACCCCCACACAGCCAGAGG + Intronic
1142528547 17:562668-562690 CCTAAGCCCAACACTGATGAAGG - Exonic
1142670125 17:1484280-1484302 CCGAACCCCGTCACTGCCCAGGG + Exonic
1143736618 17:8915962-8915984 CCCCAACCCCACCCTGCTCAAGG + Intronic
1144042758 17:11427564-11427586 CCTTAGACCCTCACTGCTCAGGG + Intronic
1144119584 17:12138216-12138238 CCTAACCTCCACACCATTCAAGG - Intronic
1144244575 17:13350148-13350170 CATAATCCACACACTGCCCAGGG + Intergenic
1144277503 17:13688154-13688176 CCTAACCCCTGCATTGTTCAAGG + Intergenic
1144481253 17:15630985-15631007 CCCAACCCCTACATTGTTCAAGG + Intronic
1144586237 17:16489663-16489685 CTCCACTCCCACACTGCTCAAGG + Intronic
1144774000 17:17775142-17775164 CCTAACCCCCACATTGTTCAAGG - Intronic
1144917060 17:18732746-18732768 CCCAACCCCTACATTGTTCAAGG - Intronic
1145095374 17:20020860-20020882 CCTGACCCCCTCATTGTTCACGG - Intronic
1146939724 17:36836127-36836149 CCTCACACACACACTCCTCAGGG - Intergenic
1148450740 17:47776369-47776391 TCCCACCCCCACTCTGCTCATGG - Intergenic
1148469627 17:47885070-47885092 CCCCACCCCCACCCTGCTGAGGG - Intergenic
1148825831 17:50393336-50393358 CCTACCCTCCACACTGCTCCTGG + Intronic
1148991244 17:51668886-51668908 GCTAAGCCCCTCACTGCCCAGGG - Intronic
1149028501 17:52057616-52057638 CCTAATCACCACATTGCTCAAGG + Intronic
1149165958 17:53752272-53752294 TCTAACCCCCAAAATGTTCAAGG + Intergenic
1149657645 17:58318781-58318803 CCAAGCCCCCACTCTGCACAAGG + Intronic
1149819818 17:59765414-59765436 CCTAACCCACACATGGTTCAAGG - Intronic
1149926581 17:60707457-60707479 CCTACCCTCCACATTGTTCAAGG + Intronic
1151332281 17:73417466-73417488 CCTAGCCCCCACACTGTTCAAGG + Intronic
1151637899 17:75365011-75365033 CCTAACACCCAAACTTCTAATGG + Intronic
1152025594 17:77807067-77807089 CCTCACCCCCACATTATTCAAGG + Intergenic
1152524154 17:80877949-80877971 CCTAACCCCGCCATTTCTCAGGG - Intronic
1152910115 17:82999422-82999444 CCTAACCCCCACATTGTTCAGGG - Intronic
1153731160 18:8013265-8013287 CCCAGCCCCTACACTGTTCAAGG - Intronic
1154103214 18:11496322-11496344 TCTGAGCCCCACACAGCTCATGG + Intergenic
1154177959 18:12100080-12100102 CCTAAATCCCACACTACTCAAGG - Intronic
1154231159 18:12557393-12557415 GCTAAGCCCCTCACTGCCCAGGG + Intronic
1154234887 18:12595457-12595479 CCTAACCACCACGTTGTTCAGGG + Intronic
1154299303 18:13179107-13179129 CCTACCCCCTACATTGTTCAAGG + Intergenic
1154417734 18:14192373-14192395 CCTCACCCCCACATTATTCATGG - Intergenic
1155076804 18:22364609-22364631 CCCAACCCCCACATTATTCAAGG + Intergenic
1155663506 18:28279772-28279794 CCTAACCCCTGCATTGTTCAAGG - Intergenic
1155766148 18:29635445-29635467 CCTGACCCACACATTGTTCAAGG - Intergenic
1156009884 18:32484590-32484612 CCTAACCTCCACATTGTTCAAGG - Intergenic
1156238738 18:35230239-35230261 CCTAACCCCCAAGTTGTTCAAGG + Intergenic
1156260356 18:35440305-35440327 CCTCCTCCCCACACTGTTCAGGG + Intergenic
1156853150 18:41751514-41751536 CCTAACACAAACACTACTCATGG + Intergenic
1157202767 18:45673064-45673086 TCTAACCCCCTCACAGCCCAGGG - Intronic
1157445565 18:47744237-47744259 CCTAACCCCCAGATCGTTCAAGG + Intergenic
1157837180 18:50915617-50915639 TCTAACACCCACATTGTTCAAGG + Intronic
1157856901 18:51112051-51112073 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1157928674 18:51794658-51794680 TCTAACCTCCACATTGTTCAAGG + Intergenic
1158147995 18:54337553-54337575 CCTAACTCCCACATTGTTCAAGG + Intronic
1158633195 18:59133875-59133897 TCTAACCTCCACACTGCTACTGG - Intergenic
1158835905 18:61332036-61332058 CCTAACCCCCATGTTGTTCAAGG + Intergenic
1158877499 18:61747339-61747361 CCTAACCTCTACATTGTTCAAGG + Intergenic
1159098603 18:63934962-63934984 ACTCATCCCCATACTGCTCAGGG - Exonic
1159364101 18:67444065-67444087 CCTTAACCCCACATTGTTCAAGG - Intergenic
1159490911 18:69133150-69133172 ACTAACCCCCTCCTTGCTCAGGG - Intergenic
1159753161 18:72328081-72328103 CCTAACCCCTACATTGTTAAAGG - Intergenic
1161008554 19:1948708-1948730 CCTAAACCCCACCCTGCTCAAGG - Intronic
1162263043 19:9547922-9547944 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1162602878 19:11682776-11682798 TCTAACCCCCACCTTGTTCAAGG - Intergenic
1163084713 19:14971187-14971209 CCTAACACCCAAATTGTTCAAGG + Intronic
1163263696 19:16206023-16206045 CCTCACTCCCTCCCTGCTCAAGG + Intronic
1164447671 19:28331713-28331735 CCTAACCCAGACAGTGCTCAGGG + Intergenic
1164893434 19:31845872-31845894 CCTAACCCCCATATTGTTCAGGG - Intergenic
1165122653 19:33570660-33570682 TCTAACTCTCACACTCCTCAAGG - Intergenic
1165133254 19:33646564-33646586 ACTAACCCCCTCCTTGCTCAGGG - Intronic
1165846576 19:38821611-38821633 GCTAAGCCCCTCACTGCTCAGGG - Intronic
1166333978 19:42094513-42094535 CCTTACCTCCTCACTGCCCATGG + Intronic
1166607262 19:44155269-44155291 CCTAACCCCCAAGTTGTTCAAGG - Intronic
1166899016 19:46044070-46044092 CCATACCTCCACACTGCTCCTGG - Intronic
1167724608 19:51201595-51201617 TCTGACCCTCACACTGCTAAAGG + Intergenic
1168431054 19:56280921-56280943 CCTAACTCTCACATTGTTCAAGG - Intronic
1168451870 19:56472854-56472876 ACTAACCCCTGCACTGTTCAAGG + Intronic
1168577041 19:57520787-57520809 CCTAATCCCCACATTGTTCAAGG + Intergenic
1168694761 19:58397900-58397922 CCTAAGTCCCAAACTGCTCTGGG + Intergenic
1202714530 1_KI270714v1_random:34747-34769 CCTCCGCCCCACACTGCCCAGGG + Intergenic
925099925 2:1235654-1235676 CCTTACCCCCACGCTGCCCCAGG + Intronic
926383939 2:12317507-12317529 CCTCACACCCACACTGCTTCTGG - Intergenic
926897062 2:17703995-17704017 CCTAACCTCTGCACTGTTCAAGG + Intronic
927150237 2:20191406-20191428 GCTCACACCCACAGTGCTCAGGG - Intergenic
927965394 2:27264671-27264693 CCTTACCCCCTCACCCCTCATGG - Intronic
928014003 2:27637015-27637037 TCTAACCCCCAAATTGTTCAAGG - Intronic
928412705 2:31066941-31066963 CCTCACCCCGACATTGCCCAGGG + Intronic
928416699 2:31098628-31098650 CCTAACCCCCACACTGCTCAAGG - Intronic
928715148 2:34051539-34051561 CTTAGCCCCCACATTGTTCAAGG + Intergenic
929474156 2:42228318-42228340 CCTAACCCCTACATTGCTCAAGG + Intronic
929845662 2:45522964-45522986 CCCAACCTCCACATTGTTCAAGG + Intronic
930260093 2:49135619-49135641 CCTAACCTCCACATTGTTCAAGG - Intronic
930345162 2:50170814-50170836 CCCAACCCCCACATTGTTCAAGG - Intronic
930593387 2:53356549-53356571 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
931189178 2:59983051-59983073 CCTACCACCCACAGTGCCCATGG - Intergenic
931741217 2:65247120-65247142 CCTAACCCCTGCATTGCTCATGG - Intronic
931768092 2:65474669-65474691 GCCAACCCCCACCCTGCTCCTGG - Intergenic
931954642 2:67407531-67407553 TCTAACCCCCACACTGTTCAAGG - Intronic
932879828 2:75490880-75490902 TCAAGCCCCCACACAGCTCACGG - Intronic
933060837 2:77734985-77735007 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
933321374 2:80779548-80779570 CCTAACCCCTGCATTGTTCAAGG - Intergenic
933439251 2:82290024-82290046 TCTAACTCCCACATTGTTCAAGG + Intergenic
933485306 2:82914340-82914362 CCTAACCCTCACATTGTTCAAGG - Intergenic
933511465 2:83246171-83246193 GCTAAGCCCCTCACTGCCCAAGG + Intergenic
934141061 2:89047947-89047969 CCCAACCTCCACATTGTTCAGGG - Intergenic
934220818 2:90080978-90081000 CCCAACCTCCACATTGTTCAGGG + Intergenic
934228173 2:90152595-90152617 CCCAACCTCCACATTGTTCAGGG + Intergenic
934499503 2:94844902-94844924 CCTCACCCCCACATTATTCATGG + Intergenic
935323816 2:101915947-101915969 CCTAACCCTCGCATTGTTCAAGG + Intergenic
936172704 2:110190434-110190456 GCTAAGCCCCTCACTGCCCAGGG + Intronic
936454787 2:112664505-112664527 TCCAACCTCCACACTGTTCAAGG - Intergenic
936831225 2:116650150-116650172 CCTAACCCTCACATTGTTCAAGG - Intergenic
936891398 2:117373933-117373955 TCTAACCCCCACCCTCCTCATGG - Intergenic
937373307 2:121317640-121317662 CCCAACCCCTGCACTGCTCAAGG - Intergenic
937469013 2:122159304-122159326 CCTAACCCTAACCCTGCTCTTGG + Intergenic
937766870 2:125671604-125671626 CCTAACCCGCACATTGTTCAAGG + Intergenic
937821741 2:126318143-126318165 ACTAACCCCCACCTTGCTCAGGG - Intergenic
937860611 2:126705692-126705714 CCTAACCCTCACATTGTTCAAGG + Intergenic
938654040 2:133412422-133412444 CCTCGCACCCACACTGCACATGG - Intronic
939018651 2:136932395-136932417 CCAAACCCCCACAGTGTTCAAGG - Intronic
939719935 2:145635668-145635690 CTTAACCCTCACAGTGTTCAAGG + Intergenic
939825945 2:147015633-147015655 CCTGACCCCCACATTGTTTAAGG + Intergenic
939886436 2:147686497-147686519 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
939902131 2:147863376-147863398 CCTAATCCCCACGTTGTTCAAGG - Intronic
939984273 2:148814690-148814712 ACTAACCCCCACCTTGCTCAGGG + Intergenic
940406599 2:153310788-153310810 CCTAACCCCTGCATTGCCCAAGG + Intergenic
940520886 2:154746343-154746365 CCTAGCCCCCACATTGTTTAAGG + Intronic
941186136 2:162323992-162324014 CCACACCCCCATACTGCCCAAGG - Intronic
941387830 2:164874761-164874783 CCAAATCCCTACATTGCTCAAGG - Intergenic
942158499 2:173156998-173157020 CCTAACCCCTGCATTGTTCAAGG - Intronic
942516259 2:176756778-176756800 CCTAACCCTCGCACTGTTCAAGG - Intergenic
943098577 2:183458672-183458694 CCTACCCCCCGCCCTGCACAGGG - Intergenic
943291335 2:186075834-186075856 CCTAACCCCTACATTGTTCAAGG + Intergenic
943832866 2:192485112-192485134 CCAAATCCCTACACTGCACACGG - Intergenic
943941448 2:194002983-194003005 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
943942717 2:194020276-194020298 CCTAAGCCCCTCACTGCCCAGGG - Intergenic
944453672 2:199871413-199871435 CTTAACCCCTACACTGTTCAAGG + Intergenic
945069640 2:205977341-205977363 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
945146132 2:206740137-206740159 CGTAACCTCCACATTGTTCAGGG - Intronic
946152775 2:217787511-217787533 GCTAAGCCCCCCACTGCCCAGGG + Intergenic
946239498 2:218345097-218345119 TCATCCCCCCACACTGCTCAGGG + Exonic
946392199 2:219423321-219423343 CCCACCACCCATACTGCTCAAGG - Intronic
946504560 2:220284967-220284989 CTTAACTCCCACATTGTTCAAGG - Intergenic
946915269 2:224513263-224513285 CCTATGCCCCACACTGTTCAAGG + Intronic
947126171 2:226870561-226870583 CCTAACCCCCAAGTTGTTCAGGG - Intronic
947795307 2:232890608-232890630 GCACACCCCCAAACTGCTCAAGG + Intronic
947797279 2:232902397-232902419 CCCACTCCCCACGCTGCTCACGG - Intronic
947894736 2:233659228-233659250 CCTAATCTCCACATTGTTCAAGG - Intronic
948245237 2:236477138-236477160 CCTAACCCCCATGTTGTTCAAGG - Intronic
948451231 2:238074377-238074399 CCTAACCCTCACATTGTTCAAGG + Intronic
948484248 2:238270607-238270629 TCTGACCCCCACTCTCCTCAGGG - Intronic
948609526 2:239157961-239157983 CCAACCCCGCCCACTGCTCAGGG + Intronic
1168859692 20:1037088-1037110 CCTAACCCCCAAACAGGCCAGGG + Intergenic
1169784196 20:9341258-9341280 TCTAACCCCCACATTGTTCAAGG - Intronic
1169818077 20:9679369-9679391 CCTAAGCCTCACATTGTTCAAGG + Intronic
1169855913 20:10102609-10102631 CCTAACCCCAACCTTGTTCAAGG + Intergenic
1170419354 20:16177251-16177273 CCTAACCCCCACATTGTTCAAGG + Intergenic
1172353866 20:34265567-34265589 CCTAACCCCTGCATTGTTCAAGG + Intronic
1172858470 20:38027415-38027437 CCTAACCCCCACATTGTTCAAGG - Intronic
1172961782 20:38805437-38805459 CCTAACCCCCACCCCGACCATGG - Intergenic
1173538956 20:43837308-43837330 CCCAACCCCCGCATTGTTCAAGG - Intergenic
1173915666 20:46706959-46706981 ACTAACCCCCTCCTTGCTCAGGG - Intergenic
1174091308 20:48050536-48050558 CCTAATGCCCACATTGTTCAAGG - Intergenic
1174443826 20:50577210-50577232 CCTCACCCTCACAGAGCTCATGG - Intronic
1175504710 20:59473375-59473397 CCTAACCCCCACACGGCCTGGGG + Intergenic
1175543054 20:59760172-59760194 CCTGACACCCACACTCATCATGG - Intronic
1175569055 20:60005328-60005350 CCTAACCCCCACATTGTTCAAGG + Intronic
1175741388 20:61421947-61421969 TGTCAGCCCCACACTGCTCAAGG - Intronic
1175775590 20:61651535-61651557 TCCAACCCACACACTGCTCAGGG - Intronic
1176713965 21:10333640-10333662 CCTAACCCTTGCACTGTTCAAGG + Intergenic
1176855573 21:13966904-13966926 CCTCACCCCCACATTATTCATGG + Intergenic
1176947350 21:14998944-14998966 CCTAATCCCCACATTGTCCAAGG + Intronic
1177259257 21:18707459-18707481 CCCAACCCCCACATTGTTCAAGG + Intergenic
1177270664 21:18845283-18845305 CCTGACCCCCAAATTGTTCAAGG - Intergenic
1178195460 21:30339879-30339901 CATAACCCCAACACTGAGCATGG + Intergenic
1178346678 21:31834633-31834655 CCTAACCTCCACATTATTCAAGG + Intergenic
1178794192 21:35728494-35728516 CCTAATCACCACATTGTTCAAGG + Intronic
1179161303 21:38901659-38901681 CCTAACCTCGACATTGTTCAAGG - Intergenic
1179520116 21:41937595-41937617 CCTAACCCTCATGCTGTTCAAGG + Intronic
1180656211 22:17423121-17423143 CCTCACCACCACATTGCTAAAGG - Intronic
1180761024 22:18207543-18207565 CCTAACCCTTGCACTGTTCAAGG + Intergenic
1180774643 22:18417076-18417098 CCTAACCCTTGCACTGTTCAAGG - Intergenic
1180807798 22:18727897-18727919 CCTAACCCTTGCACTGTTCAAGG - Intergenic
1181070755 22:20336086-20336108 CCTAACCCTTGCACTGTTCAAGG - Intergenic
1181193740 22:21164030-21164052 CCTAACCCTTGCACTGTTCAAGG - Intergenic
1181215703 22:21328575-21328597 CCTAACCCTTGCACTGTTCAAGG + Intergenic
1181450543 22:23017261-23017283 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1184023861 22:41839177-41839199 CCTAACTCCCCCAGTGCTCCAGG - Intronic
1184151485 22:42641956-42641978 CCTAACCCCCATACCATTCAAGG + Intronic
1185187604 22:49411892-49411914 CCTAACCCTAACATTGTTCAAGG - Intergenic
949394360 3:3598812-3598834 CCTAACCCCCACATTATTCAAGG - Intergenic
949822816 3:8134660-8134682 CCTAATCCCCACATTGTTCCAGG + Intergenic
950820887 3:15757320-15757342 CCTAACCTCCACATTGTTCAAGG + Intronic
950997740 3:17521589-17521611 CCTAACTCCCATGTTGCTCAAGG + Intronic
951015181 3:17723872-17723894 CTTAACTCCTACACTGTTCAAGG + Intronic
951332950 3:21387455-21387477 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
951415435 3:22417067-22417089 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
952665071 3:35894556-35894578 ACTAACCCCCTCCTTGCTCAGGG + Intergenic
953274442 3:41481184-41481206 CCTAACCCCCACATTGTTCAGGG + Intronic
953965443 3:47301635-47301657 TCCAACCCCCACATTGTTCAAGG - Intronic
954761345 3:52876883-52876905 TCTAACCCCCACGCTGTTCAAGG + Intronic
955219657 3:57012980-57013002 GCTAAGCCCCTCACTGCCCAGGG - Intronic
955660432 3:61293159-61293181 CCTAACCCCCATGTTGTTCAAGG - Intergenic
956392193 3:68785520-68785542 GCTAAGCCCCTCACTGCCCAGGG + Intronic
956438816 3:69260390-69260412 GCTAAGCCCCTCACTGCCCAGGG - Intronic
956495024 3:69815729-69815751 CCTAACCCCTACATTGTTCAAGG + Intronic
957002924 3:74907814-74907836 CCTAACCCCCCCATTGCTCAAGG + Intergenic
957142573 3:76380756-76380778 CCTAACCCCCATGTTGTTCAAGG + Intronic
957844909 3:85719341-85719363 CCTAACCCCCATGTTGTTCAAGG - Intronic
957919667 3:86731693-86731715 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
957979909 3:87495334-87495356 GCTAACCCCCGCATTGTTCAAGG - Intergenic
958177216 3:90011814-90011836 CCTAGCCCCTGCACTGTTCAAGG - Intergenic
958673787 3:97239357-97239379 CCTAACCCCCATGTTGTTCAAGG - Intronic
958731022 3:97960555-97960577 ACTAACCCCCACACTGCACAAGG + Intronic
958964759 3:100546965-100546987 CCTAACCCCTGCATTGTTCAAGG - Intronic
959235409 3:103715573-103715595 CCTAACCCCCACATTGTTCAAGG - Intergenic
959256935 3:104027353-104027375 CCTAACCCCCACATTATTCAAGG - Intergenic
959597029 3:108140006-108140028 CCTAACCTCCACATTGTTCAAGG + Intergenic
959603291 3:108213252-108213274 CATAACCCCCACATTGCTCAAGG + Intronic
959761023 3:109965522-109965544 CCTAACCCCCACTTTGTTCAAGG + Intergenic
960264902 3:115609841-115609863 CCTAACCCCCATGTTGTTCAAGG - Intergenic
960560046 3:119073647-119073669 GCTAAGCCCCTCACTGCCCAGGG + Intronic
961014405 3:123456595-123456617 CCTAACCCCTGCATTGTTCAAGG + Intergenic
961119415 3:124360785-124360807 CCTGAGGCCCACCCTGCTCACGG - Intronic
961298228 3:125904048-125904070 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
961932325 3:130547305-130547327 GCTAAGCCCCTCACTGCTCAGGG + Intergenic
961965622 3:130899194-130899216 CCCAACCCCCACATTGTTCAAGG - Intronic
962343893 3:134606120-134606142 CCTCAGCTCCTCACTGCTCACGG + Intronic
963016019 3:140824656-140824678 CCTAATCCCCACATAGTTCAAGG + Intergenic
963326228 3:143866315-143866337 CCTCACCCCCACAGCCCTCATGG + Intergenic
963397875 3:144756997-144757019 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
963464899 3:145666935-145666957 CCTAACCCTCACATTGTTCAAGG - Intergenic
963554660 3:146772460-146772482 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
963743008 3:149098095-149098117 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
964376255 3:156051881-156051903 GCTAAGCCCCTCACTGCCCAGGG - Intronic
964866441 3:161267371-161267393 CCTAACCCCCATGCTGTTGAAGG + Intergenic
965003523 3:162987472-162987494 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
965092242 3:164179363-164179385 GCTAAGCCCCTCACTGCACAGGG - Intergenic
965333567 3:167407425-167407447 CCTAATCCCCACATTGTTCAAGG - Intergenic
965841699 3:172912837-172912859 CCTAACCACCACGTTGTTCAAGG + Intronic
966401458 3:179551857-179551879 CCTAACCCCTGCATTGTTCAAGG + Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
966951202 3:184819704-184819726 CTTAACCCCCGCATTGTTCAAGG - Intronic
967232511 3:187353673-187353695 CCTAACCCCCACATTGTTCAAGG - Intergenic
967313600 3:188129955-188129977 CCTAACCCCTGCATTGTTCAAGG - Intergenic
968466493 4:754182-754204 CAGAACCCCCAGCCTGCTCAGGG - Intronic
969649829 4:8459251-8459273 CCCAACCCCCACTTTGTTCAAGG + Intronic
970201706 4:13615819-13615841 TCTCACCCCTACTCTGCTCATGG + Intronic
970817896 4:20179278-20179300 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
971043358 4:22778840-22778862 GCTAACCTCCTCACTGCCCAGGG + Intergenic
971084122 4:23250312-23250334 CCTAACCCCTATATTGCTCAAGG - Intergenic
971422777 4:26489281-26489303 CCTCATCCCCAATCTGCTCAAGG - Exonic
971436568 4:26632209-26632231 CCTAAACCCCACATTGTTTAAGG - Intronic
971618756 4:28828111-28828133 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
972073481 4:35054225-35054247 CCTAACCCCTGCATTGTTCAAGG - Intergenic
972319398 4:37959149-37959171 CCTAACCCTCACATTGTTCAAGG - Intronic
972361828 4:38332817-38332839 CCTTACAGCCACACTGCTCCTGG + Intergenic
972505788 4:39718747-39718769 GCTAAGCCCCTCACTGCCCAGGG + Intronic
972683056 4:41325363-41325385 ACTAACCCCCTCCTTGCTCAGGG - Intergenic
972913878 4:43851926-43851948 CCTAACCCCTGCATTACTCAAGG - Intergenic
973039945 4:45457360-45457382 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
973074028 4:45900459-45900481 ACTAACCCCCTCTTTGCTCAGGG - Intergenic
973549218 4:52015040-52015062 CCTAACCCCCAGTTAGCTCAGGG + Intronic
973930016 4:55782723-55782745 CCTAACCCCTACATTGTTAAAGG + Intergenic
974325281 4:60406308-60406330 CCTAACCCTCTCATTGTTCAAGG + Intergenic
974705977 4:65516109-65516131 CTCAACCCCCACATTGTTCAAGG - Intronic
974839796 4:67286942-67286964 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
974925483 4:68292721-68292743 CTTAAGCCCCACATTGTTCAAGG + Intergenic
975028054 4:69576579-69576601 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
975584996 4:75940587-75940609 CCCAACCCGGACGCTGCTCAGGG + Intronic
975755867 4:77570779-77570801 GCTAAGCCCCTCACTGCCCAGGG - Intronic
975994941 4:80302955-80302977 GCTAAGCCCCTCACTGCCCAGGG - Intronic
976245568 4:83002921-83002943 CCTAATCCCCACATTGTTCAAGG + Intronic
976736292 4:88313392-88313414 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
976737598 4:88326533-88326555 CCTAGCCCCCACATTATTCAGGG + Intergenic
977400068 4:96521229-96521251 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
977416658 4:96742634-96742656 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
978465770 4:109007165-109007187 CCTAACCCCTGCTCTGCTCTTGG - Intronic
978469286 4:109045315-109045337 TCTCACCCCCACATTGTTCAAGG + Intronic
978598550 4:110404206-110404228 CCTAATCCCCACGTTGTTCAAGG - Intronic
979857508 4:125651974-125651996 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
979865211 4:125745107-125745129 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
979918451 4:126469530-126469552 CCCAACCCCCACATCGTTCAAGG + Intergenic
981056329 4:140365958-140365980 CCTAAGCCCCACATTATTCAAGG + Intronic
981111693 4:140942206-140942228 CACAACCCCCACACAGCTCCAGG + Intronic
981140844 4:141267164-141267186 ACTGACTCCCACACTGCTCCTGG - Intergenic
981170224 4:141615104-141615126 CCTAATGCCCACATTGTTCAAGG - Intergenic
981983673 4:150828113-150828135 CCTAACCCCCATGTTGTTCAAGG + Intronic
982393279 4:154889287-154889309 CCAAACTCCCACATTGTTCAAGG - Intergenic
982769243 4:159380736-159380758 CCTAACTCCCGCATTGTTCAAGG - Intergenic
982770140 4:159390075-159390097 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
982846756 4:160262920-160262942 CCTAACCCCTGCATTGTTCAAGG - Intergenic
983134947 4:164068512-164068534 GCTAAGCCCCTCACTGCTCGGGG - Intronic
983142442 4:164168717-164168739 CCTAACCCTCACATTGCTCAAGG - Intronic
983692404 4:170486799-170486821 CCTAACCCCCACATTGTTCAAGG - Intergenic
983835401 4:172377781-172377803 GCTAAGCCCCTCACTGCCCAGGG + Intronic
983843187 4:172482117-172482139 GCTAAGCCCCTCACTGCCCAGGG + Intronic
984153590 4:176165420-176165442 CCTAACCCTCATATTGTTCAAGG - Intronic
984444418 4:179817143-179817165 CCCAACCCCCACGTTGTTCAAGG - Intergenic
984677109 4:182562566-182562588 CCCAACCCCCACTATGCCCAGGG - Intronic
984903932 4:184609667-184609689 ACTAACCCACACACTGTTCTCGG - Intergenic
984984384 4:185313707-185313729 CCTAACCCCCACATTGTTCAAGG - Intronic
985403606 4:189615462-189615484 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
985484292 5:140142-140164 CCGACCCCCCACAGTTCTCAGGG - Intergenic
985534002 5:452900-452922 CCTCACCCCCACAGAGCTCCAGG - Intronic
986919023 5:12662022-12662044 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
987963851 5:24847009-24847031 CCTAACCCCCACATTATTCAAGG - Intergenic
988020526 5:25614800-25614822 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
988035583 5:25823563-25823585 GCTAAGCCCCTCACTGCCCAAGG + Intergenic
988085039 5:26464348-26464370 CCTAACCCCCACGTTGTTCAAGG + Intergenic
988220780 5:28344382-28344404 CCTAAGCCCCACATTGTTCAAGG + Intergenic
988490542 5:31701644-31701666 CCGAAGCCCCACACTGTGCATGG + Intronic
989091813 5:37741715-37741737 CCCAACCCCCAGACTGCTATTGG - Intronic
989559675 5:42836484-42836506 GCTAAGCCCCTCACTGCCCAGGG - Intronic
989650048 5:43677880-43677902 CCTAACCCCTACATTGTTCAAGG - Intronic
990512156 5:56498902-56498924 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
990863600 5:60355548-60355570 CCCAACCCCCACCTTGTTCAAGG - Intronic
990897955 5:60719146-60719168 CCTAACCCCCATGTTGTTCAAGG + Intergenic
990916371 5:60910146-60910168 CCTAACCTCCACACTATTCAAGG + Intronic
992048857 5:72925607-72925629 ACTAAGCCCCTCACTGCCCAGGG - Intergenic
992237631 5:74728145-74728167 CCTAGCCCCCACATTATTCAAGG - Intronic
992284675 5:75222009-75222031 CCTAACTCCCAAATTGTTCAAGG + Intronic
992485965 5:77195544-77195566 CCTTACCCCCACAGTGTTCAAGG - Intergenic
992714978 5:79501467-79501489 TCTAACCCCCACCATGTTCAAGG + Intronic
992990877 5:82281997-82282019 CCTAACCCCCATGTTGTTCAAGG + Intronic
993064913 5:83086237-83086259 CCTAACCCCTATATTGTTCAAGG - Intronic
993261871 5:85667976-85667998 CCTAACTCCCACATTGTACAAGG + Intergenic
993276206 5:85862368-85862390 CCTAAGCCCCACATTGTGCAAGG + Intergenic
993517128 5:88851410-88851432 CCTAACCTCCACATTGTTCAAGG + Intronic
994130010 5:96216306-96216328 CCTAACCCCCACATTGTTCAAGG + Intergenic
994570294 5:101506143-101506165 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
994601306 5:101908926-101908948 CCTAACCTCCACATTGTTCAAGG + Intergenic
995251978 5:110004122-110004144 CTTAGCCCCCACAGTGTTCATGG + Intergenic
995529128 5:113075151-113075173 GCTAAGCCCCTCACTGCCCAGGG - Intronic
995678904 5:114695575-114695597 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
995700355 5:114928952-114928974 GCTAAGCCCCTCACTGCTCAGGG - Intergenic
995789195 5:115865396-115865418 CCTAACTGCCACATTGTTCAAGG + Intronic
996575901 5:124976359-124976381 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
996922765 5:128788302-128788324 CCCAACCTCCACATTGTTCAGGG - Intronic
997425470 5:133799881-133799903 CCAACTCCCCACACTTCTCAAGG + Intergenic
997750412 5:136339283-136339305 ACTAACCCCCTCTTTGCTCAGGG + Intronic
998202823 5:140138779-140138801 CCTGATCCCCACAGAGCTCAGGG + Intergenic
999165384 5:149545174-149545196 CCTAACCCCAGCACTGTTCAAGG + Intronic
999234290 5:150081181-150081203 CCTAACCCTCAACCTGCTCAGGG + Intronic
999505234 5:152187768-152187790 CCTAACCCCCATGCTGTTCAAGG - Intergenic
999672139 5:153967152-153967174 CCTAACACCCACGTTGTTCAAGG - Intergenic
1000085859 5:157886963-157886985 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1000212360 5:159119288-159119310 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1000478715 5:161744612-161744634 CCTAACCTCCCCACAGCTCATGG - Intergenic
1000847521 5:166300067-166300089 CCCAACCCCTACATTGTTCAAGG - Intergenic
1000903548 5:166936460-166936482 GCTAAGCCCCTCACTGCCCATGG + Intergenic
1000922339 5:167153138-167153160 CCTAACCCCTGCACTGTTCAGGG - Intergenic
1001285543 5:170420710-170420732 CCTAACTCCCACATCGTTCAGGG + Intronic
1001350582 5:170959541-170959563 CCTAACTCCCACATTGTTCAAGG - Intronic
1001383746 5:171320973-171320995 CCTAACCCCCACATTGTTCAAGG + Intergenic
1001465173 5:171957802-171957824 CCTAACCTCCAAACTGCCAAGGG - Intronic
1001571079 5:172731162-172731184 CGTAACCCCCATGTTGCTCAAGG + Intergenic
1001843556 5:174901634-174901656 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1001984797 5:176064199-176064221 CCTAACCCCCACATTATTCATGG - Intronic
1002232715 5:177779994-177780016 CCTAACCCCCACATTATTCATGG + Intronic
1002263273 5:178009814-178009836 CCTAACCCCCAAATTATTCATGG - Intronic
1002555173 5:180031563-180031585 CCTAACCTTCTCACTGTTCAAGG + Intronic
1002817705 6:694741-694763 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1002913785 6:1511845-1511867 CTCTACCCCCACACTGTTCAAGG + Intergenic
1003224471 6:4191542-4191564 CCCAAGCCCCTCACTGCCCAGGG + Intergenic
1003269258 6:4592873-4592895 ACTAACCCCCTCCTTGCTCAGGG - Intergenic
1003647151 6:7922360-7922382 CCTAACTCCCACATCGTTCAAGG - Intronic
1003748003 6:9024382-9024404 GCTAATCCCCTCACTGCCCAGGG - Intergenic
1003901590 6:10660002-10660024 GCTAAGCCCCTCACTGCCCAAGG - Intergenic
1004339337 6:14794632-14794654 CCTAACTCCCACACTGTTCAAGG + Intergenic
1004604686 6:17183005-17183027 ACTAACCCCTACCTTGCTCAGGG + Intergenic
1004607376 6:17206682-17206704 GCTAAGCCCCTCACTGCGCAGGG + Intergenic
1006497898 6:34437239-34437261 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1007738734 6:43998215-43998237 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1008139945 6:47820782-47820804 CTTAACCCCGACATTGTTCAAGG - Intronic
1008230896 6:48984060-48984082 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1008532797 6:52479995-52480017 CCTAACTCCCACATTGTTCAAGG - Intronic
1008810855 6:55496931-55496953 CCTAACCTCCAAATTGTTCATGG + Intronic
1009304325 6:62069085-62069107 CCTAACCCCCATGTTGTTCAAGG - Intronic
1009471415 6:64031273-64031295 GCTAAGCCCCTCACTGCCCAGGG - Intronic
1010270367 6:73910104-73910126 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1011113687 6:83866521-83866543 CTTAACCTCTACACTGCTCCCGG + Intronic
1011129341 6:84037727-84037749 GCTAAGCCCCTCACTGCCCAGGG + Intronic
1011410331 6:87060001-87060023 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1011680357 6:89777490-89777512 ACTAACCCCCTCTTTGCTCAGGG + Intronic
1011974760 6:93282759-93282781 GCTAAGCCCCTCACTGCTCGGGG - Intronic
1012105957 6:95158694-95158716 CCTAATCCCCACATTGTTCAAGG - Intergenic
1012488406 6:99748473-99748495 CCTAACTCCCACATTGTTCAAGG - Intergenic
1013205618 6:107942601-107942623 CCTAACCCCAACGTTGTTCAAGG - Intronic
1013437238 6:110122874-110122896 CCTTACCCCTACACTGTTCAAGG + Intronic
1013856524 6:114580264-114580286 CCTAACCCCTACATTGTTCAAGG - Intergenic
1013901171 6:115157468-115157490 TCTAACCCCCACATTGTTCAAGG + Intergenic
1014586293 6:123202067-123202089 GCTAAGCCCCTCATTGCTCAGGG - Intergenic
1014669662 6:124285681-124285703 CTTAATCCTCACACTGTTCAAGG - Intronic
1015563610 6:134542634-134542656 CACAAACCCCACACTGTTCAAGG + Intergenic
1015699446 6:136019585-136019607 CCTAACCCCCTCATTATTCAAGG - Intronic
1015891165 6:137970891-137970913 TCTAACCCCCAAGTTGCTCAAGG - Intergenic
1015977575 6:138806455-138806477 CCTAACTCCCACATTGGTCAAGG - Intronic
1016064288 6:139662965-139662987 CCTAACCCCTACATTGTTCAAGG - Intergenic
1016172936 6:141041816-141041838 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1016482883 6:144501159-144501181 CTTTACACTCACACTGCTCATGG - Intronic
1016574331 6:145550975-145550997 CCTAACCCCCACATTAATGAAGG + Intronic
1016752452 6:147646099-147646121 TCTAACCCCCATATTGTTCAAGG - Intronic
1017383525 6:153857184-153857206 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1017652176 6:156593762-156593784 CCTAACCCCCACATTGTTCAAGG + Intergenic
1017795810 6:157843243-157843265 CCTAACCCCCACATTGTTCAAGG - Intronic
1017854164 6:158334593-158334615 CCTAACCCCCGCATTGTTCAGGG + Intronic
1018687163 6:166312273-166312295 CCTAACCCCCACATTGCTTAGGG + Intergenic
1019017390 6:168889966-168889988 CACAAACCCCACACTGCTCCAGG - Intergenic
1019564957 7:1674584-1674606 CCCACCCCCCTCACTGCTCTGGG - Intergenic
1019926525 7:4196641-4196663 GCTCACCCCCACAGTGCTCTGGG + Intronic
1020193926 7:6022436-6022458 CCTAACCCCCCCACTGTTCAAGG + Exonic
1020760474 7:12262325-12262347 CCTTGCCCCCACACTGTTTATGG + Intergenic
1021154565 7:17194365-17194387 CCTGACCCCCTCCCTGCCCAGGG + Intergenic
1021325511 7:19262006-19262028 TCTAGCCCCCACATTGTTCAAGG - Intergenic
1022378806 7:29840789-29840811 ACTGACCCCCACCCTGCTCCTGG - Intronic
1023047344 7:36222056-36222078 CCTAACCCCCATGTTGTTCAAGG - Intronic
1023114636 7:36850457-36850479 CCTAACTCCCATATTGTTCAAGG + Intergenic
1023283959 7:38599629-38599651 CCTAACCGCCACATTGTTAAAGG + Intronic
1023648559 7:42344586-42344608 CCCCACCCCCACCCTGCTCCTGG - Intergenic
1023907537 7:44533157-44533179 CCTAATCTCCACATTGTTCAAGG + Intronic
1024299363 7:47874957-47874979 ACTAACCCTGACACTGCTCTGGG + Intronic
1024748212 7:52431485-52431507 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1026253020 7:68687223-68687245 CCTAAACCCCTCACTTCTAAAGG - Intergenic
1026814197 7:73496787-73496809 CCTAACCCCCATGCTGTTCAAGG - Intronic
1027571714 7:79876476-79876498 CCCACCCCCCACATTGTTCAAGG - Intergenic
1027579719 7:79977847-79977869 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1027698292 7:81437333-81437355 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1028727171 7:94101008-94101030 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1030177256 7:106667456-106667478 TCTAATCCCCACATTGTTCAAGG - Intergenic
1030251629 7:107451944-107451966 CCTAGCCCCCACATTGTTCAAGG + Intronic
1030565473 7:111149378-111149400 CCTAAACCCCACGTTGTTCAAGG - Intronic
1031060669 7:117047880-117047902 CCTAACCCCTGCACTGTTCAAGG - Intronic
1031108624 7:117577706-117577728 CCTAACCCCCACATTGTCCAAGG - Intronic
1031165900 7:118226330-118226352 CCCAACCCCTACATTGTTCAAGG - Intronic
1031200511 7:118678319-118678341 CCTAACCTCTACATTGTTCAAGG + Intergenic
1031537381 7:122952068-122952090 CCCAACCCCCACATTGTTCTAGG - Intergenic
1031565463 7:123291581-123291603 CCTAACCCCCACGTTGTTCAAGG - Intergenic
1031681635 7:124681782-124681804 TCTAACACCCACATTGTTCAAGG + Intergenic
1031902859 7:127429286-127429308 GCTAAGCCCCTCACTGCCCAGGG - Intronic
1031942278 7:127801786-127801808 CCTAAACCCCACACTATTCAAGG - Intronic
1032369969 7:131339206-131339228 CCTAGGCCCCACATTGTTCAAGG + Intronic
1032440529 7:131939519-131939541 CCTAAACCCCATATTGTTCAAGG - Intergenic
1032823129 7:135543116-135543138 CCTCACCCCTAACCTGCTCATGG - Intergenic
1033085393 7:138336678-138336700 GCTAACACCCACATTGCTCAAGG + Intergenic
1034303996 7:150036796-150036818 CCTAACACCCACAGTCCTCCAGG + Intergenic
1034304514 7:150038692-150038714 CCTAACACCCACAGTCCTCCAGG + Intergenic
1034400622 7:150859194-150859216 CCTACCCCCCATATTGTTCAGGG - Intronic
1034608899 7:152346620-152346642 CCTAACCCTCTCATTGTTCAAGG - Intronic
1034907788 7:154965856-154965878 CCTAGGCCCCACACTGTTCAGGG + Intronic
1035259245 7:157650992-157651014 CCTCAGACCCACACGGCTCACGG - Intronic
1035275565 7:157746138-157746160 CCTACACCCCACAGTCCTCATGG + Intronic
1035275579 7:157746190-157746212 CCTAGACCCCACAGTCCTCATGG + Intronic
1035275670 7:157746545-157746567 CCTACACCCCACAGTCCTCACGG + Intronic
1035295498 7:157864911-157864933 CCTGACCCCCAACCTGCACAAGG + Intronic
1035606438 8:933239-933261 CCTAACCCACAGAATGATCAGGG - Intergenic
1036135057 8:6152823-6152845 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1036419689 8:8584091-8584113 CTCAACTCCCACACTGTTCAAGG - Intergenic
1036532909 8:9612722-9612744 CCTAACCCCTGCATTGTTCAAGG - Intronic
1036763295 8:11527995-11528017 ACTAACCCCCTCCTTGCTCAGGG - Intronic
1038280163 8:26156777-26156799 ACTAACCCCCTCCTTGCTCAGGG - Intergenic
1038847601 8:31244351-31244373 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1039730473 8:40270234-40270256 TTTAACCCCCAAACTGCTCTTGG - Intergenic
1040062587 8:43116632-43116654 CCTAATCTCCACATTGTTCAAGG - Intronic
1040099707 8:43487894-43487916 CCTAAGTCCTACACTGTTCAAGG - Intergenic
1040636537 8:49280869-49280891 CCTAACTCCTACATTGTTCAAGG - Intergenic
1041353497 8:56974282-56974304 CCCAACCCCTGCACTGTTCATGG + Intronic
1041484064 8:58354657-58354679 CCTAGACCCCACATTGTTCAAGG + Intergenic
1042548506 8:69972366-69972388 CCTAACCTTGACCCTGCTCATGG + Intergenic
1043094212 8:75946100-75946122 CCTAATCCCTGCATTGCTCAAGG + Intergenic
1043115621 8:76250373-76250395 CCTAACCCCCACATTGTTCAAGG + Intergenic
1043726003 8:83611404-83611426 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1043949608 8:86292889-86292911 CCTAACTCCCACAATGTTCAAGG - Intronic
1044014344 8:87032217-87032239 CCTACCCCCCACATTGTTCAAGG - Intronic
1044115368 8:88328076-88328098 CCTGAGCCCCACCCAGCTCATGG - Intergenic
1044404891 8:91816479-91816501 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1044874689 8:96653461-96653483 GCTAAGCCCCGCATTGCTCAAGG - Intronic
1045832117 8:106475102-106475124 GCTAACTCCTACACTGTTCAAGG - Intronic
1045993293 8:108334984-108335006 CCTAACCTCCACGTTGTTCAAGG + Intronic
1046190616 8:110790084-110790106 CCTAATCCCCTCCTTGCTCAGGG - Intergenic
1046497764 8:115036807-115036829 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1047049685 8:121097037-121097059 ACTAAACCCCTCCCTGCTCAGGG - Intergenic
1047664049 8:127070526-127070548 CCTAACTCCCACATTACTCAAGG + Intergenic
1048294306 8:133203127-133203149 CCGACCGTCCACACTGCTCACGG + Intronic
1048306216 8:133286627-133286649 CCCAGCCCCCTCACTGCTAAAGG + Intronic
1049140649 8:140950783-140950805 CCTCACCCCCGCACTGTTCAGGG + Intronic
1049157703 8:141076803-141076825 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1049857932 8:144875285-144875307 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1049944513 9:581016-581038 GCTAAGCCCCTCACTGCCCAGGG + Intronic
1050224296 9:3433597-3433619 CCAAACCACTACACTGTTCAAGG + Intronic
1050972929 9:11899896-11899918 CTTAAACCCCACATTGTTCAAGG - Intergenic
1053657654 9:40235641-40235663 CCTCACCCCCACATTATTCATGG - Intronic
1053678283 9:40461121-40461143 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1053908017 9:42864921-42864943 CCTCACCCCCACATTATTCATGG - Intergenic
1053928265 9:43089464-43089486 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1054285443 9:63163827-63163849 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1054291360 9:63296658-63296680 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1054358121 9:64084194-64084216 CCTTACCCCCACATTATTCATGG - Intergenic
1054369778 9:64381915-64381937 CCTCACCCCCACATTATTCATGG - Intronic
1054389379 9:64601196-64601218 GCTAAGCCCCTCACTGCCCAGGG - Intergenic
1054506337 9:65915174-65915196 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1054526942 9:66140584-66140606 CCTCACCCCCACATTATTCATGG + Intronic
1054677404 9:67871667-67871689 CCTCACCCCCACATTATTCATGG - Intronic
1056258026 9:84820051-84820073 CTTAACCCCCACATTGTTAAAGG - Intronic
1056312808 9:85358495-85358517 CCCAACCCCCACAGTGGCCATGG - Intergenic
1056735584 9:89206710-89206732 ACTAACCCCCTCCATGCTCAGGG - Intergenic
1056964339 9:91153423-91153445 ACTAACCCCCTCCTTGCTCAGGG - Intergenic
1056964424 9:91154116-91154138 CCTAACCCCTGCATTGTTCAAGG - Intergenic
1057059393 9:91989907-91989929 CCTAACTCCCACATTGTTCAAGG - Intergenic
1057513795 9:95703830-95703852 CCTAACCACTACATTGTTCAAGG + Intergenic
1057626460 9:96681991-96682013 CCTAACCCCTGCATTGTTCAAGG - Intergenic
1057907198 9:98992350-98992372 GCTAAGCCCCTCACTGCCCAGGG + Intronic
1057980956 9:99662703-99662725 CCTAACTCCCACATTGTTCAAGG - Intergenic
1058291826 9:103252019-103252041 CCTAACCCCTGCATTGTTCAAGG - Intergenic
1059614652 9:115935851-115935873 CCCCACCCCCACACAGCTCCTGG + Intergenic
1060579514 9:124731920-124731942 CCTAACCCCCACATTGTTTAAGG + Intronic
1060610686 9:124961734-124961756 CCTAACCCCTGCATTGTTCAGGG - Intronic
1060742799 9:126110681-126110703 CCCAAATCCCACACTGCTCCTGG - Intergenic
1185713489 X:2322881-2322903 CCTAACTCCCACATTGTTCAAGG + Intronic
1185910860 X:3979760-3979782 CCTAATCCCCACATTGTTCAAGG - Intergenic
1186034415 X:5405423-5405445 CCGAATCTCCACATTGCTCAAGG + Intergenic
1186500990 X:10050418-10050440 CCTGACCCCCACAGGGCTCCAGG - Intronic
1187061854 X:15794294-15794316 CCTAACTCCCACATTGTTCAAGG - Intronic
1187087064 X:16051634-16051656 ACTAACCCCCTCCTTGCTCAGGG - Intergenic
1187342746 X:18435922-18435944 CCTAACCCCTACCTTGTTCAAGG - Intronic
1187377735 X:18771629-18771651 CCTAACCCCAGCATTGCTCAAGG - Intronic
1187453128 X:19416843-19416865 CCTAACTCCCACATTGTTCAAGG + Intronic
1189192963 X:39126907-39126929 CCTAGCCCCCACATTGTTCAAGG + Intergenic
1189209833 X:39275732-39275754 GCTAAGCCCCTCACTGCCCAAGG - Intergenic
1189378465 X:40484181-40484203 CTCAACCTCCACACTGCTAAAGG - Intergenic
1189558546 X:42169505-42169527 CCTAACCTCCACATTGTTCAAGG - Intergenic
1190484209 X:50908535-50908557 CCTAACCCCCATGTTGTTCAAGG + Intergenic
1190823920 X:53999489-53999511 CCCAACCTCCACATTGTTCAAGG + Intronic
1191077296 X:56468871-56468893 CCCATCCCCCACAGTGGTCATGG - Intergenic
1192747147 X:73950483-73950505 CCTAACCCCCCCATTCCTCAAGG - Intergenic
1193319787 X:80107834-80107856 CCTAACCCCTGCATTGCTTAAGG - Intergenic
1193738680 X:85191470-85191492 CCTAACCCCCACGTTGTTCAAGG - Intergenic
1194173490 X:90618002-90618024 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1194620094 X:96160571-96160593 ACTAACCCCCTCCTTGCTCAAGG - Intergenic
1195506590 X:105665182-105665204 CCTAACCCCTGCATTGTTCAAGG + Intronic
1196850123 X:119929672-119929694 CCTAACTGCCACATTCCTCATGG + Intronic
1197129208 X:122984805-122984827 CCTAACCCACAAATTGTTCAAGG - Intergenic
1198303619 X:135356560-135356582 CTTAACCTCCACATTGCTCAAGG - Intronic
1198455922 X:136817653-136817675 TCTAGCCCCCACATTGTTCAAGG - Intergenic
1199418407 X:147614303-147614325 CCTAACCTTCACATTGCTCAAGG + Intergenic
1200301706 X:154983053-154983075 CCCAACCCCCACATTGTTCAAGG + Intronic
1200519711 Y:4195694-4195716 GCTAAGCCCCTCACTGCCCAGGG + Intergenic
1200902960 Y:8451638-8451660 ACTATCCCCCACAATGCACAGGG - Intergenic
1201260947 Y:12158613-12158635 GCTAAGCCCCTCACTGCCCATGG + Intergenic
1201341314 Y:12937347-12937369 CCTAATCCCTGCATTGCTCAAGG - Intergenic
1201890828 Y:18942214-18942236 CCTAATCTCTACACTGTTCAAGG + Intergenic
1202052038 Y:20791397-20791419 CCTACCACCCACAGAGCTCAGGG - Intergenic