ID: 928417866

View in Genome Browser
Species Human (GRCh38)
Location 2:31111585-31111607
Sequence GCTTTTTTTGCAATTTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928417866_928417873 11 Left 928417866 2:31111585-31111607 CCACCACAAATTGCAAAAAAAGC 0: 1
1: 0
2: 1
3: 28
4: 416
Right 928417873 2:31111619-31111641 CCCACCCTTATAGGGAGTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 63
928417866_928417868 2 Left 928417866 2:31111585-31111607 CCACCACAAATTGCAAAAAAAGC 0: 1
1: 0
2: 1
3: 28
4: 416
Right 928417868 2:31111610-31111632 AGCCCTGAACCCACCCTTATAGG 0: 1
1: 0
2: 0
3: 7
4: 108
928417866_928417869 3 Left 928417866 2:31111585-31111607 CCACCACAAATTGCAAAAAAAGC 0: 1
1: 0
2: 1
3: 28
4: 416
Right 928417869 2:31111611-31111633 GCCCTGAACCCACCCTTATAGGG 0: 1
1: 0
2: 0
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928417866 Original CRISPR GCTTTTTTTGCAATTTGTGG TGG (reversed) Intronic
900775155 1:4577846-4577868 GCTTTTGTTGCAATTGTTTGGGG + Intergenic
900949579 1:5850730-5850752 GCTTTTTTTGCGGCTTCTGGAGG - Intergenic
903023063 1:20407605-20407627 GCTTTTGTTGCAATTGCTGTTGG - Intergenic
904203253 1:28835566-28835588 GCTTGTTTTGCCAGTCGTGGAGG + Intronic
904306515 1:29593620-29593642 TTTTTTTTTGCAGTTTATGGAGG + Intergenic
904339491 1:29824906-29824928 GCTATGTTTGCCCTTTGTGGAGG + Intergenic
907880348 1:58544364-58544386 ACTATTTTTGCAAATTGGGGAGG - Intronic
907984479 1:59517076-59517098 GCTTTGTTTGCACTTTGTGGGGG + Intronic
908129262 1:61058265-61058287 GTTTTTTTTTTAATTTTTGGAGG + Intronic
908378025 1:63565498-63565520 GCTTTTGTTGCAATTGCTTGTGG - Intronic
909247059 1:73299732-73299754 CTTTTTTTTGCCATTTGAGGAGG - Intergenic
909731076 1:78890466-78890488 TTTTTTTTTTCAATTTGTGGAGG + Exonic
910190905 1:84594467-84594489 GCTTTTGTTGCAATTGCTTGTGG - Intergenic
910317950 1:85909693-85909715 TCTTTTTTAGCAAATTGTGGTGG + Intronic
910441022 1:87252168-87252190 GATGTTTGTGCACTTTGTGGGGG - Intergenic
911078059 1:93899031-93899053 GCTTTTTTTCCACTTAGGGGTGG + Intronic
912603336 1:110962288-110962310 TCTTTTTTTTAATTTTGTGGTGG - Intronic
914348763 1:146821861-146821883 ACTTTTTTTGTATTTTGTAGAGG - Intergenic
914920495 1:151844032-151844054 GCTTTCTTTGCAGTTTGGTGGGG + Intergenic
915134374 1:153720135-153720157 GTTTTTTTTGCCATGTGTGATGG + Intergenic
915215619 1:154338803-154338825 GCATTTTTTTCTTTTTGTGGGGG - Intronic
915301873 1:154956365-154956387 GCTTTTCTCTCAGTTTGTGGGGG - Intergenic
916275373 1:162988242-162988264 GCTTAATTTGCAATATGAGGAGG - Intergenic
917242359 1:172962248-172962270 GCTTTTGTTGCAATTTCTTCTGG + Intergenic
919670223 1:200331404-200331426 CCTTTTTTTGGAAGCTGTGGAGG - Intergenic
921672599 1:217942683-217942705 CCTTTTGTTGAAATTTTTGGGGG - Intergenic
922149666 1:222987968-222987990 TCTTAGTTTGCATTTTGTGGAGG + Intronic
922872408 1:228913903-228913925 CCTTTTTTTGCTGTTAGTGGTGG + Intergenic
923401904 1:233623876-233623898 GCTTTTTTGGCAAGGTGCGGTGG - Intronic
923785005 1:237058004-237058026 GTTTTGTTTGCAATTTGCAGTGG + Intronic
924728457 1:246691124-246691146 GCTTATTTTTTAATTTTTGGTGG + Intergenic
924779902 1:247137572-247137594 GCTTTTGTTGCAATTGCTGTCGG - Intronic
924900747 1:248396351-248396373 GCTTTTGTTGCAATTGGTTTTGG - Intergenic
1063648929 10:7914093-7914115 TTTTTTTTTGCAATTTTTTGAGG + Intronic
1064524538 10:16240314-16240336 GTTTTTTTTGGTATTTTTGGTGG - Intergenic
1066754036 10:38691942-38691964 GGTATTTCTGCAATTTCTGGGGG - Intergenic
1066794257 10:39101555-39101577 TCTTTTTGTACAATTTGTGAAGG + Intergenic
1067228867 10:44393038-44393060 TCTTTCTTTGTAATTTATGGAGG - Intergenic
1068001309 10:51337374-51337396 GCTTTTTTTGCAATTGCTTTTGG - Intronic
1068242045 10:54315557-54315579 GCTTTTGTTGCAATTGCTGTTGG + Intronic
1068285239 10:54924972-54924994 GCTTTTGTTGCAATTTCTTTTGG + Intronic
1069082609 10:64104267-64104289 GCTAATTTTGGAATTTTTGGGGG + Intergenic
1069203188 10:65649111-65649133 ACTATTTTAGCAAGTTGTGGAGG + Intergenic
1069271583 10:66534969-66534991 GCAATTTTTGCAATCTGTTGAGG - Intronic
1071471847 10:85989000-85989022 GCTTTTTGTGCGGTTTGTGAGGG + Intronic
1072310201 10:94147114-94147136 GTTTTTTTTTCAAGTTGAGGAGG + Intronic
1073813094 10:107172748-107172770 GCTTTATGTGACATTTGTGGTGG - Intergenic
1073992610 10:109279952-109279974 CTCTTTTGTGCAATTTGTGGTGG + Intergenic
1074160283 10:110831088-110831110 GCTTTTATTGCAAGCTGTGTGGG + Exonic
1074589609 10:114800237-114800259 GATGTTTTGGAAATTTGTGGAGG + Intergenic
1075186558 10:120264525-120264547 GCATGTTTTGCACTTTGTGCAGG + Intergenic
1076072951 10:127506811-127506833 GCCTGTTTTGCTATTTGTGGAGG - Intergenic
1076088832 10:127660808-127660830 GGTTGTTTTTCAATTTTTGGGGG + Intergenic
1077926399 11:6685794-6685816 GCTTTCTCTGCAATTTCTGTGGG + Intergenic
1078121402 11:8513668-8513690 ACTTTTTTTTTAATTTTTGGGGG + Intronic
1078144306 11:8712616-8712638 GCTTTTTGAGTACTTTGTGGTGG - Exonic
1078288124 11:9978829-9978851 ACTTTTTTTGTATTTTTTGGTGG - Intronic
1078833479 11:15000473-15000495 GCTTTGTTTACAATCTTTGGGGG + Intronic
1079040177 11:17052356-17052378 TCTCTTTTTGCCATTTTTGGAGG + Intergenic
1079113615 11:17624181-17624203 GCTTTTGTTGCAATTTCTTTTGG + Intronic
1079267510 11:18948266-18948288 GCTTTTTTTGCAATTGCTCTTGG - Intergenic
1079693824 11:23453732-23453754 GCTGTTTTTGCAAATTGTCTGGG + Intergenic
1079696570 11:23489143-23489165 GCTTTTGTTGCAATTTCTTTTGG - Intergenic
1079893640 11:26091188-26091210 GCATATTTGGCAATTTCTGGAGG - Intergenic
1079931883 11:26573549-26573571 GCCTTTTCTGCAATATGTGTGGG + Intronic
1080254124 11:30269794-30269816 GCTTCTTTTTCAGTTTGTTGTGG + Intergenic
1081402021 11:42654461-42654483 GCTTTTTTTGCAATTGCTTTTGG + Intergenic
1083012275 11:59413980-59414002 ACTTTTATTGTCATTTGTGGTGG + Intergenic
1083533205 11:63444394-63444416 GGTTTTTTTTAAATTTGTGTGGG + Intergenic
1083846026 11:65334083-65334105 GCTTCTTTGGAAACTTGTGGAGG + Intronic
1085723023 11:78929818-78929840 GCTTTGTTTTCAATGTTTGGTGG - Intronic
1086038753 11:82449157-82449179 GCTTTCTTTGCAACCTGTTGGGG - Intergenic
1086110334 11:83192342-83192364 ACCTTTTAAGCAATTTGTGGCGG - Intergenic
1086972932 11:93103170-93103192 GCTTTTTTTGCAATTGCTTTAGG + Intergenic
1087163894 11:94979183-94979205 GCATTTGTTGAAATTTGGGGAGG - Intronic
1087287865 11:96285437-96285459 GCTTTTTTTGCAATTGCTTCCGG - Intronic
1087440297 11:98175346-98175368 GCTTTTTTTGCAATTGCTTTTGG - Intergenic
1088385074 11:109245185-109245207 GCTTTTGTTGCAATTTCTTTTGG - Intergenic
1089463804 11:118669993-118670015 TCTTTTTTTTTAATTTTTGGAGG - Intronic
1090945015 11:131421695-131421717 GCTTTGTTTAAAATTTGAGGTGG - Intronic
1091883956 12:4002696-4002718 GCTTTATTTGCTGTGTGTGGTGG - Intergenic
1093551247 12:20414206-20414228 GCCTTATTGGCCATTTGTGGAGG - Intronic
1093688815 12:22086059-22086081 GCTTTATTTACATTTTGTAGAGG + Intronic
1094548905 12:31430945-31430967 TCTGTTTTTGCAATTTGCAGAGG - Intronic
1094790770 12:33912394-33912416 GCTTTTGTTGCAATTGCTTGTGG + Intergenic
1095029583 12:37252570-37252592 ACTTTTTGTGGAATTTGTAGTGG - Intergenic
1096928821 12:55181264-55181286 GCTTTTGTTGCAATTACTGCTGG + Intergenic
1097022327 12:56029098-56029120 CCCTTTTTTGCAATTTGAGAGGG - Intronic
1097129081 12:56796876-56796898 TTTTTTTTTGCAATTTGAGAAGG + Intergenic
1097337369 12:58397991-58398013 GCTTTTGTTGCAATTGGTTTTGG + Intergenic
1097822935 12:64145872-64145894 GCTTCATGTGCAATTTGGGGAGG + Exonic
1098101485 12:67022232-67022254 GTTGTTTTTGCAATTTTTTGAGG + Intergenic
1098271012 12:68770349-68770371 TCTTTTTTTGAAATTAGTGGAGG + Exonic
1099579047 12:84418508-84418530 GCTTTTGTTGCAATTAGTTGTGG + Intergenic
1100351964 12:93793062-93793084 GCTTCATTAGCAATTTATGGTGG - Intronic
1100629393 12:96372413-96372435 GCTTTTTTTGTGATTTGGTGAGG + Intronic
1100733664 12:97502095-97502117 ACTTTTTCTGCAATCAGTGGAGG + Intergenic
1102138737 12:110597090-110597112 TCTTTTTTTGCTTTTTGAGGTGG + Intergenic
1103970310 12:124666722-124666744 GCTCTTTTTACAATGTGAGGTGG + Intergenic
1105174770 13:17648842-17648864 ACTCTTTTTGTAGTTTGTGGAGG + Intergenic
1105174887 13:17650714-17650736 ACTCTTTTTGTAGTTTGTGGAGG + Intergenic
1105660837 13:22493180-22493202 GCTTTTGTTGCAATTGCTTGTGG + Intergenic
1106156297 13:27160418-27160440 TTTTTTTTTTCAATTTGAGGAGG - Intronic
1107165416 13:37277382-37277404 GCTTTTTTTAAAATCTGTTGGGG - Intergenic
1107803903 13:44136233-44136255 GCTGCTTTTGCATTTTGTAGTGG - Intergenic
1108087162 13:46805481-46805503 GATATTTTGGCAATTTGTGTTGG - Intergenic
1108183058 13:47860863-47860885 GCTTTTTTAGTTATTTGAGGTGG - Intergenic
1108466723 13:50724141-50724163 GCTTTTTCTTCAATTAGTGATGG - Intronic
1108542761 13:51459591-51459613 GTTTTTTTTGCAAGCTGTTGGGG + Intergenic
1108615195 13:52125973-52125995 GGTTTTCTTGCAATTTTTTGTGG + Intronic
1109092868 13:58070795-58070817 GCTTTATTGGCTATTTTTGGTGG + Intergenic
1109681147 13:65755213-65755235 GCTATTTTTGTTCTTTGTGGAGG - Intergenic
1109796326 13:67317976-67317998 GCTTTTGTTGCAATTTCTTTTGG + Intergenic
1109955444 13:69559477-69559499 GCTTTGTTTGTAATTGGTGGTGG + Intergenic
1110657612 13:78018965-78018987 GATTTTTCTGCAATTTGGGGAGG + Intergenic
1111092649 13:83466912-83466934 GGTTTTGTTGCAATTTGTTTCGG - Intergenic
1111329926 13:86751947-86751969 GCTTTTTTTGCAATTGCTTTTGG + Intergenic
1111643777 13:91004370-91004392 GATTTTTCTGCCATTTGTGTTGG - Intergenic
1113019520 13:105868528-105868550 GCTTTTGTTGCAATTGGTTTTGG - Intergenic
1113514136 13:110878551-110878573 GTTTTTTATTCAATTTGTGAAGG + Exonic
1114301925 14:21385927-21385949 GCCTTTTATGCCATTTGTGATGG - Exonic
1115286789 14:31722970-31722992 GCTTTTGTTGCAATTGCTGTTGG + Intronic
1116196879 14:41738459-41738481 GCTTTTGTTGCAATTAGTTTTGG - Intronic
1116498589 14:45592768-45592790 GCTTTTGTTGCAATTGGTTTTGG - Intergenic
1117829686 14:59738124-59738146 GCTTTTGTTGCAATTGCTGTTGG - Intronic
1118537685 14:66786940-66786962 GCTTTGTTTCCAATTTTTGAAGG - Intronic
1119637859 14:76291373-76291395 GTTTTTTTTGCAAGGGGTGGTGG - Intergenic
1120825160 14:88948482-88948504 GCTTTTTTGTCTTTTTGTGGAGG - Intergenic
1121316361 14:92963359-92963381 GATTATTTTGCAAACTGTGGAGG - Intronic
1121905420 14:97737580-97737602 GCTTTTGTTGCAATTTCTTTTGG + Intergenic
1123825877 15:24081718-24081740 ATTTTTTTTTAAATTTGTGGAGG + Intergenic
1124429224 15:29592002-29592024 GCTTTCTCTGAAATTTGTTGGGG - Intergenic
1124849242 15:33319985-33320007 GCTTTATTTGCAAATAGAGGCGG + Intronic
1125292891 15:38169096-38169118 TTTTTTTTTTCAATTTTTGGAGG + Intergenic
1125378732 15:39063231-39063253 GCTGTTTGTGTAATTTGGGGAGG + Intergenic
1126210481 15:46095638-46095660 GATGTTTTTGCAATTTGTCAGGG + Intergenic
1126627654 15:50700584-50700606 GCTTTATTTTTAATTTGTCGTGG + Intergenic
1129512720 15:76136901-76136923 GGATATTTGGCAATTTGTGGAGG - Intronic
1129595461 15:76960610-76960632 GTTCATTTTCCAATTTGTGGAGG + Intergenic
1129752112 15:78073033-78073055 GCTTTTTTTTGACTTTGTTGGGG - Intronic
1130366575 15:83245628-83245650 GCTTTTGTTGCAATTGGTTTTGG + Intergenic
1130755790 15:86761861-86761883 GCTTTTGTTGCAATTGGTTTTGG + Intronic
1133956977 16:10452868-10452890 GCTTTGTTTGCACTGTGAGGGGG + Intronic
1133959129 16:10477062-10477084 GCTTTTGTTGCAATTGGTTTTGG - Intronic
1136536484 16:30902661-30902683 GCCTTCTTTGCTTTTTGTGGGGG + Exonic
1136728693 16:32385147-32385169 GGTATTTCTGCAATTTTTGGGGG + Intergenic
1138666811 16:58576762-58576784 GCTTTATTTGGAATATGTGGAGG - Intronic
1138935831 16:61721284-61721306 GTATTTTATGCATTTTGTGGAGG + Intronic
1139301395 16:65948189-65948211 GCCTTTTTGACAATTTGTGAGGG - Intergenic
1139985273 16:70893687-70893709 ACTTTTTTTGTATTTTGTAGAGG + Intronic
1202997744 16_KI270728v1_random:132596-132618 GGTATTTCTGCAATTTTTGGGGG - Intergenic
1203024431 16_KI270728v1_random:444938-444960 GGTATTTCTGCAATTTTTGGGGG - Intergenic
1142786390 17:2226897-2226919 GCTTTTTTTCCTTTTTGAGGTGG - Intronic
1145201227 17:20946909-20946931 GCTTTTGTTGCAATTTCTTTTGG - Intergenic
1146423688 17:32714785-32714807 GCTTTTTTTGCAATTACTTTTGG - Intronic
1148454844 17:47805618-47805640 GCTTTTTTTGGAATGGGTTGAGG + Intergenic
1148566582 17:48636545-48636567 TTTTTTTTTCCAATTTCTGGCGG + Intergenic
1149131618 17:53309087-53309109 GCTTTTGTTGCAATTGGTTTTGG - Intergenic
1151918637 17:77137756-77137778 GCTTTTTCAGGAATTTGTTGAGG - Intronic
1153785818 18:8534198-8534220 GCTTTTGTTGCAATTTCTTTTGG - Intergenic
1154274059 18:12944732-12944754 ACCTTTTCTCCAATTTGTGGAGG + Intergenic
1155051947 18:22156269-22156291 GATTTTTTTGCAATTAAGGGGGG - Intergenic
1155450192 18:25954874-25954896 GGTAATTTTGCAAGTTGTGGCGG + Intergenic
1156053758 18:32972047-32972069 GCTTTTTTTGAAATTGGTTTTGG + Intronic
1156195330 18:34768307-34768329 CCTTTTTTTGCTTTTTTTGGGGG - Intronic
1156992630 18:43427878-43427900 TCTTTTTTTGCACTTTGTTGAGG - Intergenic
1157068605 18:44380172-44380194 GCTTTTGTTGCAATTGGTTTTGG - Intergenic
1158279819 18:55812087-55812109 GTTTCCTTTGCAATATGTGGTGG + Intergenic
1158332950 18:56383057-56383079 CTTTTTTTTTCAATTTGTTGTGG + Intergenic
1163800110 19:19359500-19359522 ACTTTTTTTGCAGGTTGTGCTGG + Intergenic
1164335683 19:24317740-24317762 TCTTTTTGTACAATTTGTGAAGG + Intergenic
1164949404 19:32323731-32323753 ACTTTTTTTTCATTTTGTGATGG - Intergenic
1166403092 19:42498519-42498541 GCTTATTCTGCAATTAGTGAAGG - Intergenic
1168174594 19:54615938-54615960 GCTTTTGTTGCAATTTCTTTTGG - Intronic
925830933 2:7895026-7895048 GCTTTGTTTACAATGTGTGCTGG + Intergenic
926474946 2:13310006-13310028 ACTTTTGTTGCAATTTGTTTTGG + Intergenic
927500402 2:23579105-23579127 GTTTTTTAAGCCATTTGTGGAGG + Intronic
927799181 2:26081375-26081397 GGTTTGTTTGCATTTTGGGGTGG - Intronic
928417866 2:31111585-31111607 GCTTTTTTTGCAATTTGTGGTGG - Intronic
929109132 2:38391753-38391775 GCTATTTTGGGTATTTGTGGTGG - Intergenic
929357526 2:41043828-41043850 GCTTTTGTTGCAATTGTTGTTGG - Intergenic
930402972 2:50914361-50914383 GATCTTTTGGCAATTTGTGATGG - Intronic
930563719 2:52993655-52993677 GCTTTTGTTGCAATTGCTGTTGG + Intergenic
930702773 2:54475840-54475862 GTTTTGTTTGTAGTTTGTGGAGG - Intronic
930770225 2:55123241-55123263 GCATTTTTTGCAACTTGCTGAGG - Intergenic
930892345 2:56405070-56405092 GCTTCTTTTTCACTTTATGGAGG - Intergenic
930921505 2:56760503-56760525 GCTTTTGTTGCAATTGCTGTTGG - Intergenic
931594107 2:63922177-63922199 GCTTTTTTTCAATTTTGAGGGGG + Intronic
933140345 2:78784460-78784482 TCTTTTTTCCCACTTTGTGGTGG - Intergenic
933652958 2:84864035-84864057 GCTTTTTTTGGAATTTATGATGG + Intronic
934100351 2:88647243-88647265 GCTTTTGTTGCAATTGCTGTTGG - Intergenic
934698425 2:96417689-96417711 GCTTTTGTTGCAATTGGTTTTGG + Intergenic
936676387 2:114720587-114720609 GCATTTTTTTAAATGTGTGGTGG - Intronic
936752542 2:115663000-115663022 TCTTTTTTTACAATTTTTGTGGG + Intronic
936790753 2:116148652-116148674 GCTTGCTTTGCAGTTTGTGGTGG + Intergenic
937586721 2:123560606-123560628 GCTTTTGTTGCAATTTCTTTTGG + Intergenic
938193955 2:129309533-129309555 GCTGTGATTGCTATTTGTGGTGG + Intergenic
938667807 2:133557343-133557365 TCTCTCTTTGCTATTTGTGGAGG - Intronic
939352007 2:141050745-141050767 GCTTTTGTTGCAATTGCTGTTGG - Intronic
939715587 2:145579663-145579685 GCATCTCTAGCAATTTGTGGAGG - Intergenic
940693196 2:156946020-156946042 GCTTTTTTTGAAATTTTTAAAGG - Intergenic
942261215 2:174165955-174165977 ACTTTTTTTGTATTTTTTGGTGG - Intronic
942405987 2:175655655-175655677 GCTTTTTTTGCAATTGATTTTGG - Intergenic
942529645 2:176895631-176895653 ATTTTTTTTTCAATTTGTGTGGG + Intergenic
943124179 2:183776072-183776094 GCTTTTTTTGCCATTGCTCGTGG + Intergenic
943468733 2:188264983-188265005 GTTTTATTTTCAATTTTTGGAGG - Intergenic
943980521 2:194543922-194543944 GCTTTTGTTGCAATTGGTTTTGG - Intergenic
945329878 2:208526754-208526776 GCTTTTGATGTAATTTGTGTAGG + Intronic
946936045 2:224721727-224721749 CATTTTTTTGGAATTTTTGGTGG + Intergenic
947686308 2:232088576-232088598 GTTTTTTTTGTCATTTCTGGTGG + Intronic
947915081 2:233826685-233826707 GCTTTTGTTGCAATTGCTGTTGG - Intronic
947921694 2:233880850-233880872 AGTTTTTTTTTAATTTGTGGAGG + Intergenic
948962244 2:241348608-241348630 GTTTTTTTTTTAATTTGTTGAGG + Intronic
1169128891 20:3152552-3152574 GCTTTAGTTGCACATTGTGGTGG - Intronic
1169290850 20:4350653-4350675 GATTTGTTTGCATTTTGTTGAGG + Intergenic
1169517936 20:6338327-6338349 GCTATTTTTGGAATTGGTGGAGG + Intergenic
1170882699 20:20311177-20311199 GATAGTTTTGCATTTTGTGGGGG - Intronic
1173276035 20:41583592-41583614 TCTGTTTTTGCCATTTCTGGAGG - Intronic
1176011281 20:62897706-62897728 GCTTTTTGTGCAAGTTGAGGGGG - Intronic
1177661527 21:24089878-24089900 GTTTTTGTTGCTGTTTGTGGTGG - Intergenic
1177971246 21:27792598-27792620 GCATTTGTTGCAATTTCTTGTGG - Intergenic
1178126416 21:29520387-29520409 GCTTTTTGTGCATATTCTGGAGG + Intronic
1178311028 21:31530207-31530229 GCTATTCTTGAAATATGTGGAGG - Intronic
1180305509 22:11120070-11120092 GGTATTTCTGCAATTTCTGGGGG - Intergenic
1180544028 22:16482249-16482271 GGTATTTCTGCAATTTCTGGGGG - Intergenic
1182928116 22:34146477-34146499 TATTTTTCTGCAATTTTTGGAGG + Intergenic
1184486889 22:44785175-44785197 GCTTTTCTAACAATTTCTGGAGG - Intronic
950226448 3:11238931-11238953 GGTTTTTTTCCACTTTTTGGTGG + Intronic
950659754 3:14459900-14459922 TTTTTTTTTGTAATTTGAGGTGG + Intronic
950682977 3:14597862-14597884 GCTTTATTTGCATTTTTTGGAGG + Intergenic
951308151 3:21091724-21091746 CCTTGTTTTGAAATTTGAGGTGG - Intergenic
951957235 3:28270779-28270801 GCTTTTGTTGCAATTGGTTTTGG + Intronic
952524164 3:34192570-34192592 GATACTTTTGCAATTTGTGGAGG - Intergenic
952840775 3:37643500-37643522 TTTATTTTTGCAATTTGTGGGGG + Intronic
952844649 3:37677418-37677440 ATTTTCTTTGAAATTTGTGGAGG - Intronic
953060738 3:39426944-39426966 TCTTTGTATGCAACTTGTGGGGG + Intergenic
953122814 3:40062123-40062145 GCTTTTGTTGCAATTTCTTTTGG + Intronic
955006777 3:54975952-54975974 GATTTTTCTGCCATTTGTTGTGG + Intronic
955691267 3:61592818-61592840 GCTTTTATGGGAACTTGTGGGGG - Intronic
955762076 3:62297223-62297245 GTTTTTTTTCCTTTTTGTGGTGG + Exonic
955973876 3:64462503-64462525 GTTATTTTTGCATTTTTTGGCGG - Intergenic
956044211 3:65177760-65177782 GCTTTTTCTTGACTTTGTGGCGG - Intergenic
957258908 3:77875181-77875203 GCCTTTTTTGTCCTTTGTGGGGG - Intergenic
957793523 3:84970881-84970903 GTTTTTGTTGCAATTTTTGTTGG + Intronic
958020998 3:87995476-87995498 GCTTTCTTTGAAATTTATGAAGG + Intergenic
958623323 3:96591831-96591853 ACTTTTATTGCAATTAATGGTGG - Intergenic
959966721 3:112363995-112364017 GCTTTCTCTGCATTTTGAGGAGG - Intergenic
960108884 3:113826283-113826305 CCTTTTATTGCAATTTGGGTGGG + Intergenic
960400012 3:117185180-117185202 GCTTTTTTAGAAAATTGTGATGG + Intergenic
961612028 3:128147355-128147377 GCTTTTCTTGCAGGATGTGGTGG - Intronic
962927519 3:140008530-140008552 GCTGTTCTTGCAATGTGTGGGGG + Intronic
963449901 3:145465248-145465270 GCTTTTGTTGCAATTGGTTTTGG - Intergenic
963481044 3:145875072-145875094 GCTTTTGTTGCAATTGTTGTTGG + Intergenic
963813529 3:149804229-149804251 GCTTTTGTTGCCATTTGTTTTGG + Intronic
964187565 3:153965001-153965023 GCTTTTGTTGCCATTTGTTTTGG - Intergenic
964208514 3:154202032-154202054 GCTTTTGTTGCCATTTGTTTTGG + Intronic
964575699 3:158165214-158165236 GCTTTTCCTGCAATTAATGGAGG + Intronic
964680797 3:159336372-159336394 GCTTTTGTTGCCATTTGTTTTGG + Intronic
964837745 3:160958185-160958207 GCTTTTTTTGCAATTGCTTTTGG + Intronic
965480196 3:169209318-169209340 GCTTTTTTTGCAATTGCTTTTGG - Intronic
967021818 3:185529421-185529443 TTTTTTTTTTTAATTTGTGGGGG + Intronic
967820954 3:193838262-193838284 GCTTTTTTTGCAATTGCTTTTGG - Intergenic
970614489 4:17755289-17755311 GCTTTTTTTTCAATGTTTGCTGG - Intronic
971279671 4:25232755-25232777 CTTTTTTTTGCATTTTGAGGAGG + Intronic
971974260 4:33663181-33663203 GCTTTTTTTGCAATTGCTTTTGG + Intergenic
972453897 4:39232884-39232906 GTTTATTCTGCATTTTGTGGAGG + Intronic
972958121 4:44417300-44417322 GCTTTTTTTCTAATTTATGTGGG - Intronic
973119550 4:46503696-46503718 TCTTTTTTAGCTTTTTGTGGGGG - Intergenic
974680635 4:65156964-65156986 GCATTTTTTGGTATCTGTGGGGG + Intergenic
974885742 4:67814780-67814802 GCTTTTGTTGCAATTGGTTTTGG - Intergenic
976165762 4:82253045-82253067 GCTTTTTTTGTAATTTATTAAGG + Intergenic
976205032 4:82616487-82616509 GCTTTCTTTGCAGTTAGGGGTGG + Intergenic
976283563 4:83348743-83348765 TCTTTTTTTGCAAATTGATGTGG - Intergenic
976835110 4:89363018-89363040 TGTGTTTTTGAAATTTGTGGTGG + Intergenic
977398407 4:96500334-96500356 GCTTTTGTTGCAATTGGTTTTGG + Intergenic
977462453 4:97341990-97342012 GCTTTTGTTGCAATTTCTTTTGG - Intronic
977484179 4:97620893-97620915 GGTTTTTTTTAAATTTGTTGAGG - Intronic
977949578 4:102954915-102954937 GGTATTTTTGCAATTTTTGGGGG - Intronic
978022719 4:103833505-103833527 GCTTTTGTTGCAATTTCTTTTGG + Intergenic
978185550 4:105853136-105853158 GCTTTTGTTGCCATTGGTGTTGG + Intronic
978383986 4:108161946-108161968 GGTTTTTTTGCTGTTTTTGGAGG - Intronic
980330520 4:131404385-131404407 GCTAATTTTTCAATTTTTGGTGG + Intergenic
980581044 4:134751157-134751179 GCTTTTTATTGAATTTTTGGTGG - Intergenic
980996941 4:139788244-139788266 GCTTCTTTTCCAACCTGTGGTGG + Intronic
981133462 4:141184530-141184552 GCTTTTTTTGCAATTGCTTTTGG + Intronic
981944230 4:150322335-150322357 GCTTTATTTATACTTTGTGGTGG + Intronic
982682716 4:158451132-158451154 GCTTTTGTTGCAATTTCTTTTGG - Intronic
982703352 4:158680650-158680672 ACTTTGTTTTCATTTTGTGGAGG + Intronic
982896154 4:160929566-160929588 GCTTCTTTTGTAATTGCTGGAGG + Intergenic
982909862 4:161126532-161126554 CTTTTTTTTTCAATTTATGGTGG + Intergenic
982929852 4:161390977-161390999 GCTTGTTTTGAAATCTGAGGTGG - Intronic
983912404 4:173254641-173254663 TCTGTTTTTGGAATATGTGGTGG + Intronic
984326809 4:178265361-178265383 GCTTTTACTGCTTTTTGTGGAGG - Intergenic
985219307 4:187685704-187685726 TTTTTTTTTCTAATTTGTGGTGG + Intergenic
985824595 5:2183101-2183123 GCATTTTTTCCAAGTTGTCGTGG + Intergenic
985845358 5:2341192-2341214 GCTTTTGTTGCAATTGCTTGTGG + Intergenic
985880308 5:2634310-2634332 GAATTTTGTGCAACTTGTGGAGG - Intergenic
986072591 5:4300631-4300653 GCTGTTTTTTCACTTAGTGGAGG + Intergenic
986269685 5:6219965-6219987 GCTTGTTCTGCAATTGGTGAAGG + Intergenic
986875171 5:12098601-12098623 GCTTTTTTTGCAATTGCTTTTGG + Intergenic
986896906 5:12382288-12382310 TTTTTTTTTGGAATTTTTGGAGG + Intergenic
986975561 5:13389229-13389251 GTTTTTGTTGCAATTTCTTGTGG - Intergenic
987597845 5:20024074-20024096 ACTTTGTTTGCAATATGTGATGG - Intronic
987712673 5:21522224-21522246 GCTTTTTTTGCAATATGGACAGG + Intergenic
988741026 5:34071536-34071558 GTTTTTTTTTCAGTTTCTGGTGG - Intronic
989509580 5:42269388-42269410 GTTTTTTTTTTTATTTGTGGTGG + Intergenic
991227313 5:64287929-64287951 GCTTTTTTTGCAATTGCTATTGG + Intronic
991618797 5:68523846-68523868 GCTCTTATTCCAATTTGTAGTGG + Intergenic
992189951 5:74281961-74281983 GCTATTTTTGAAATTTGTAGAGG + Intergenic
992274049 5:75096539-75096561 GCTTTTGTTGCAATTGCTTGTGG + Intronic
995028422 5:107450998-107451020 GCTTTCTTTGCAATGTCTAGAGG + Intronic
995731345 5:115245674-115245696 GCTTTTGTTGCAATTTATCAAGG + Intronic
995848272 5:116517871-116517893 GCTTTTTGTGCACTTGGTGATGG + Intronic
996174858 5:120343799-120343821 GCTTTTGTTGCAATTGCTGTTGG - Intergenic
996287268 5:121809071-121809093 GCTTTTTTTGCAATTGCTATTGG + Intergenic
996345585 5:122485134-122485156 GCTTTTTTTGCAATTGCTTTAGG + Intergenic
996659373 5:125982394-125982416 GCTTTATTTGTAATTTGTATGGG + Intergenic
997919280 5:137963167-137963189 GCTTTTTTTGCAGATTCTTGTGG - Intronic
998051110 5:139036181-139036203 GCTTTTGTTGCAATTGGTTTTGG + Intronic
999011750 5:148049378-148049400 GCTTTTTTTTTTATTTGTGTAGG + Intronic
999120602 5:149206704-149206726 GCTTAGTTAGCAATTTGAGGAGG + Intronic
1000277529 5:159751765-159751787 GTTTTTTTTGCATCTTGTTGTGG + Intergenic
1000718902 5:164681263-164681285 GCATTTTTTGCAATCTGTGTAGG + Intergenic
1002039064 5:176497655-176497677 TAATTTTTTGCAATTTGTGATGG + Intronic
1002938136 6:1691862-1691884 TCTTTTGTTGGGATTTGTGGTGG + Intronic
1002955479 6:1858950-1858972 GCTTTTTTTGTGTTTTGGGGGGG + Intronic
1003115532 6:3281410-3281432 GCCTTTGTTGCTTTTTGTGGTGG + Intronic
1007541005 6:42644358-42644380 GCTTCTTTAGCAATGTGTTGTGG - Intronic
1008466368 6:51835522-51835544 GCCTTTTATGCAAGGTGTGGGGG - Intronic
1008801555 6:55374653-55374675 GCTTTTGTTGCAATTGCTTGTGG + Intronic
1008970407 6:57360942-57360964 TCTTTTTTTGCAGTTTTGGGGGG + Intronic
1009004980 6:57774167-57774189 ACTTTTTTTGCAATATGGGCAGG - Intergenic
1010948853 6:82010871-82010893 GCTTTTGTTGCAATTTCTTTTGG + Intergenic
1011972106 6:93238425-93238447 GCTTTATTTGCCATTAATGGAGG + Intergenic
1014408213 6:121078666-121078688 ACTTTATTTCTAATTTGTGGAGG - Intergenic
1014712991 6:124830847-124830869 ACATTTCTTGTAATTTGTGGAGG + Intergenic
1014865955 6:126530524-126530546 GCTTGTTTAGCAATATGAGGAGG + Intergenic
1015363544 6:132370711-132370733 GCATTTTTTGCAATGTTTGGAGG - Intronic
1016516922 6:144904205-144904227 TCCTGTTTTGCACTTTGTGGAGG + Intergenic
1016593792 6:145775837-145775859 GCTTTTGTTGCAATTTCTTTTGG + Intergenic
1016635623 6:146286760-146286782 GGTTCTTTTGTAACTTGTGGAGG - Intronic
1016791606 6:148072221-148072243 GCTTTTGTTGCAATTTCTTTTGG + Intergenic
1018090595 6:160344354-160344376 GCTCTCTTTGTTATTTGTGGCGG - Intergenic
1018420774 6:163639136-163639158 AATTTTTTTGCAAGTGGTGGGGG + Intergenic
1021015138 7:15522809-15522831 GCTTTTTTTGCAATTGTTTTTGG - Intronic
1021816606 7:24453211-24453233 ATTTTTTTTGAACTTTGTGGTGG + Intergenic
1022147339 7:27558325-27558347 GCTTATTTTCCATTTTTTGGGGG + Intronic
1022400285 7:30029477-30029499 CCTTTTTTTCTAGTTTGTGGAGG + Intronic
1022805314 7:33815394-33815416 GCTCTGTTTTCACTTTGTGGTGG + Intergenic
1024157700 7:46641516-46641538 TATTTTTTTACAATTTGTGTAGG + Intergenic
1024160836 7:46673836-46673858 GCTTCTTTTGCTCTTTATGGAGG - Intronic
1024169041 7:46765230-46765252 TCTTATTTGGCAATATGTGGGGG + Intergenic
1024624622 7:51195045-51195067 GCTTTTGTTGCAATTGGTTTCGG + Intronic
1025502212 7:61316936-61316958 TCTTTTTGTGCAATTTGCAGAGG - Intergenic
1025517078 7:61663158-61663180 TCTTTTTGTGCAATTTGCAGAGG - Intergenic
1025541415 7:62091982-62092004 TCTTTTTGTGCAATTTGCAGAGG - Intergenic
1026144308 7:67732686-67732708 GCTTTTACTGTAATTTGTGTGGG + Intergenic
1027518062 7:79167384-79167406 TTTTTTTTTGCCATTTTTGGGGG - Intronic
1028451376 7:90988501-90988523 GCTTATTTTGCAACTAATGGAGG - Intronic
1030813448 7:114004746-114004768 GCTTTTGTTGCAATTTCTTTTGG - Intronic
1031103884 7:117515178-117515200 GCTTTTTTTGCAATTGCTTTTGG + Intronic
1033957277 7:146866543-146866565 GCTTTATTTCTAATTTGTGATGG + Intronic
1034065761 7:148135682-148135704 GCTATTTTTTCAATTTTTAGTGG - Intronic
1035816597 8:2547910-2547932 GTTATTTTTGCAATTGGTAGAGG + Intergenic
1036944851 8:13085439-13085461 GCTTTATTTGCAGTGTGTTGAGG - Exonic
1037198279 8:16218962-16218984 GCTTTTTTTGCAATTGGTTTTGG + Intronic
1039237076 8:35513394-35513416 GATTTTTTTGCATTTAGTAGAGG + Intronic
1039619508 8:38983808-38983830 GCTTTTTTTGTATTTTGGGAGGG + Intronic
1040029437 8:42811122-42811144 GCTTTTTTTGACAGTTTTGGAGG - Intergenic
1040115577 8:43614669-43614691 TCTTTTTGTACAATTTGTGAGGG + Intergenic
1040119358 8:43664712-43664734 TCTTTTTGTGGAATTTGTGAGGG + Intergenic
1040131584 8:43803133-43803155 TCTTTTTGTGGAATTTGTGAAGG + Intergenic
1040321444 8:46309174-46309196 TCTTTTTGTGCAATCTGTGATGG - Intergenic
1040327182 8:46354795-46354817 TCTTTTTGTAAAATTTGTGGAGG - Intergenic
1040332529 8:46395748-46395770 TCTTTTTGTGGAATTTGTGAAGG - Intergenic
1040332824 8:46400900-46400922 TCTTTTTTTACAATCTGTGAAGG - Intergenic
1041504479 8:58580152-58580174 ACTTATTTAGGAATTTGTGGAGG - Intronic
1041624241 8:60006912-60006934 GCTTTTGTTGCAATTTCTTGTGG - Intergenic
1041655295 8:60343528-60343550 GCTTTTGTTGCAATTTCTTTTGG - Intergenic
1043089258 8:75876735-75876757 GCTTTTTTTGCAATTGCTTTTGG + Intergenic
1043211779 8:77528572-77528594 CCTTTTTTTGCATTTTCTGCAGG + Intergenic
1043253424 8:78104540-78104562 GCTTTTGTTGCAATTTCTTTTGG + Intergenic
1043746863 8:83885062-83885084 GCTTTTTTTTAAAATTGTGAAGG - Intergenic
1044228070 8:89741955-89741977 GTTTTTATTGCATTTTTTGGGGG - Intergenic
1044554541 8:93548631-93548653 GCTTTTCTTGCAATTGCTTGTGG - Intergenic
1045676152 8:104609917-104609939 GCTTTTGTTGCAATTGGTTTTGG + Intronic
1045824367 8:106379424-106379446 GCTTTTATTCCTATTTGTTGTGG + Intronic
1045865333 8:106858721-106858743 ACTTTTTTTTCAAATTGTAGAGG + Intergenic
1046094960 8:109546623-109546645 GATTTTTTTGCAATTTTTTTAGG + Intronic
1046254126 8:111674034-111674056 GCTTTTTTTCCAATGTTTGTTGG + Intergenic
1046432284 8:114143725-114143747 GCTTTTATTGCAATTTCTTTTGG + Intergenic
1047839621 8:128736509-128736531 ACTGTTTTTGAATTTTGTGGTGG + Intergenic
1049522045 8:143096739-143096761 GCTTTTTCTGCATTTTGACGTGG - Intergenic
1050144814 9:2555922-2555944 GCTTTTGTTGCAATTGCTGTTGG - Intergenic
1050178196 9:2891421-2891443 TCGTTTATTGCATTTTGTGGGGG - Intergenic
1050363173 9:4850502-4850524 TTTTTTTTTGGAATTCGTGGTGG + Intronic
1050581605 9:7062856-7062878 TCTTTTTTTCCACTTTGAGGAGG + Intronic
1051182285 9:14424008-14424030 GCTTTTTTGGCAAGGGGTGGGGG + Intergenic
1051335545 9:16062870-16062892 GCTTCCTTTCCAATTTGTAGGGG + Intergenic
1052369759 9:27650689-27650711 GCTTTTGTTGCAATTTCTTTTGG - Intergenic
1052767390 9:32655497-32655519 GCTTTTTTTGCAATTACTTTTGG - Intergenic
1054985716 9:71259908-71259930 GCTTTTTTTGCAATTTCTTTTGG + Intronic
1055225725 9:73992148-73992170 GCTTTTGTTGCAATTGGTTTTGG - Intergenic
1056891343 9:90496192-90496214 GCTTTTGTTGCAATTTCTTTTGG - Intergenic
1058500668 9:105612416-105612438 GCTTTTGTTGCAATTTCTTTTGG + Intronic
1059873490 9:118604431-118604453 GCTTTTGTTGGAAATTGTTGAGG + Intergenic
1062219630 9:135408204-135408226 GGTTTTTTTGCAATGAGTGGGGG - Intergenic
1186290710 X:8094887-8094909 GCATTTTTTATAATTTTTGGGGG + Intergenic
1188724103 X:33560192-33560214 ACTTTTATTTCAATTTCTGGGGG + Intergenic
1189267054 X:39725234-39725256 CCTCTGTTTGCATTTTGTGGTGG + Intergenic
1189482470 X:41403433-41403455 GCTTTTGTTGCAATTGCTGTTGG + Intergenic
1189615317 X:42777677-42777699 GCTTTTTCTCCTGTTTGTGGAGG + Intergenic
1189753124 X:44243219-44243241 TCTTTTTTTGCCATTTATGTTGG - Intronic
1189760057 X:44312857-44312879 ACTTTATTTGCATTTTGTGAGGG - Intronic
1189881586 X:45499181-45499203 GCTTTTGTTGCAATTGCTGTTGG + Intergenic
1190905787 X:54726398-54726420 GCTTTTGTTGCAATTTCTTTTGG - Intergenic
1191578455 X:62733412-62733434 TCTTTTTGTGCAATCTGTGAAGG - Intergenic
1191871458 X:65749333-65749355 GTTTTTTTTGCAATCAGTGTAGG + Intergenic
1192828487 X:74725098-74725120 GCTTTTATTGCAATTTCTTTTGG + Intergenic
1192883099 X:75308598-75308620 GCTTTTTTTCCAATGTTTGCTGG + Intergenic
1192929841 X:75794472-75794494 GCTTTTGTTGCAATTTCTTTGGG + Intergenic
1193274073 X:79565228-79565250 GCTTTTGTTGCAATTTCTTTTGG + Intergenic
1193364706 X:80618199-80618221 GCTTTTTTTGCAATTGCTTTTGG + Intergenic
1193558862 X:82992586-82992608 GCTTTTGTTGCAATTTTTGTTGG + Intergenic
1193663020 X:84280212-84280234 GCTTTTGTTGCAATTTCTTCTGG + Intergenic
1193744456 X:85258935-85258957 GCTTTTGTTGCAATTGGTTTTGG + Intronic
1193959702 X:87910044-87910066 GCTTTTGTTGCAATTGGTGTTGG - Intergenic
1194301343 X:92190089-92190111 GCTTTTTTTGCAATTGCTGTTGG + Intronic
1194572059 X:95564823-95564845 TCTTTCTTTCCAATTTGTGTGGG + Intergenic
1194687672 X:96943494-96943516 GTTTATTTTGCATTTTGTTGAGG + Intronic
1195047022 X:101063563-101063585 GCTATTTTTTCTATTTTTGGTGG + Intergenic
1196523952 X:116708743-116708765 GCTTTTTTTGCAATTGCTTTTGG + Intergenic
1197146827 X:123181240-123181262 GCTTTGTTGGCAACTTCTGGTGG + Intergenic
1197479890 X:126969561-126969583 GCTTTTTTTGCAATTGCTTTTGG - Intergenic
1198006817 X:132503366-132503388 GCTTCCTTTGCCATTTATGGGGG + Intergenic
1198424844 X:136507076-136507098 GCTTTTATTGCATGTTTTGGGGG + Intronic
1198790082 X:140335702-140335724 GCTTTTTTTGCAATTGCTTTTGG - Intergenic
1198811579 X:140541342-140541364 GCTATTTTTAAAATTTGTCGTGG + Intergenic
1199390162 X:147269588-147269610 GTCTTTTTTGCAATTTATTGGGG - Intergenic
1199940369 X:152620394-152620416 GCTATATTTGCAATGTGTGTGGG + Intergenic
1201184647 Y:11388663-11388685 GGTATTTCTGCAATTTCTGGGGG - Intergenic
1201563050 Y:15337979-15338001 GCTTTTTTTTCAATGTTTGTTGG + Intergenic
1201863443 Y:18624595-18624617 GCTTTTGATGCATTTTGTGTAGG + Intergenic
1201869879 Y:18695783-18695805 GCTTTTGATGCATTTTGTGTAGG - Intergenic
1202332413 Y:23768734-23768756 GCTTTATTTGCATTATGTGTTGG - Intergenic
1202538356 Y:25901329-25901351 GCTTTATTTGCATTATGTGTTGG + Intergenic