ID: 928420145

View in Genome Browser
Species Human (GRCh38)
Location 2:31132052-31132074
Sequence GAATCTCTTTTAGTCAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928420145_928420160 21 Left 928420145 2:31132052-31132074 CCCAGCCTGACTAAAAGAGATTC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 928420160 2:31132096-31132118 GGGCCTCCTGCAGGGACCTGGGG 0: 1
1: 0
2: 2
3: 60
4: 415
928420145_928420161 22 Left 928420145 2:31132052-31132074 CCCAGCCTGACTAAAAGAGATTC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 928420161 2:31132097-31132119 GGCCTCCTGCAGGGACCTGGGGG 0: 1
1: 0
2: 6
3: 43
4: 425
928420145_928420150 -5 Left 928420145 2:31132052-31132074 CCCAGCCTGACTAAAAGAGATTC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 928420150 2:31132070-31132092 GATTCCATCTGCAGGTCCCTGGG 0: 1
1: 0
2: 1
3: 16
4: 155
928420145_928420152 0 Left 928420145 2:31132052-31132074 CCCAGCCTGACTAAAAGAGATTC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 928420152 2:31132075-31132097 CATCTGCAGGTCCCTGGGACAGG 0: 1
1: 0
2: 1
3: 22
4: 282
928420145_928420158 19 Left 928420145 2:31132052-31132074 CCCAGCCTGACTAAAAGAGATTC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 928420158 2:31132094-31132116 CAGGGCCTCCTGCAGGGACCTGG 0: 1
1: 0
2: 5
3: 64
4: 532
928420145_928420156 12 Left 928420145 2:31132052-31132074 CCCAGCCTGACTAAAAGAGATTC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 928420156 2:31132087-31132109 CCTGGGACAGGGCCTCCTGCAGG 0: 1
1: 2
2: 2
3: 52
4: 487
928420145_928420149 -6 Left 928420145 2:31132052-31132074 CCCAGCCTGACTAAAAGAGATTC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 928420149 2:31132069-31132091 AGATTCCATCTGCAGGTCCCTGG 0: 1
1: 0
2: 2
3: 37
4: 258
928420145_928420159 20 Left 928420145 2:31132052-31132074 CCCAGCCTGACTAAAAGAGATTC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 928420159 2:31132095-31132117 AGGGCCTCCTGCAGGGACCTGGG 0: 1
1: 0
2: 6
3: 35
4: 333
928420145_928420153 1 Left 928420145 2:31132052-31132074 CCCAGCCTGACTAAAAGAGATTC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 928420153 2:31132076-31132098 ATCTGCAGGTCCCTGGGACAGGG 0: 1
1: 0
2: 6
3: 55
4: 300
928420145_928420157 13 Left 928420145 2:31132052-31132074 CCCAGCCTGACTAAAAGAGATTC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 928420157 2:31132088-31132110 CTGGGACAGGGCCTCCTGCAGGG 0: 1
1: 0
2: 6
3: 54
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928420145 Original CRISPR GAATCTCTTTTAGTCAGGCT GGG (reversed) Intronic
904630748 1:31840371-31840393 GAATCTGTTTAAGCCAGGCATGG - Intergenic
905320550 1:37113789-37113811 CAATCTGCTGTAGTCAGGCTAGG - Intergenic
908209233 1:61882739-61882761 GAAACTCCATTAGCCAGGCTTGG - Intronic
908358381 1:63344283-63344305 TAATCTATTTTAGTCAGCTTTGG - Intergenic
910958824 1:92738853-92738875 GAATCTCTTTTCCTCAACCTAGG + Intronic
911119729 1:94283577-94283599 GAATTTCTTTTAGTCATTCTAGG + Intergenic
914924699 1:151874138-151874160 GAATCTTTTTTGGTCAGTGTAGG - Exonic
924043400 1:240005751-240005773 GAATCACGTTTGGTCAGGCATGG + Intergenic
1063033487 10:2260388-2260410 GAGTCTCTTGTAGTCAGCATAGG - Intergenic
1063080050 10:2759312-2759334 GAATCTCTTTCACCCAAGCTAGG + Intergenic
1063606129 10:7524383-7524405 GAGTCTCTGTTGCTCAGGCTGGG - Intergenic
1066392921 10:34993291-34993313 GAATCTCTTCTATTTTGGCTGGG + Intergenic
1066479516 10:35782030-35782052 GAATCTGTTTTGGGGAGGCTTGG + Intergenic
1067394476 10:45901301-45901323 GGATCTCTATTAGTCAGCTTGGG - Intergenic
1067862799 10:49870432-49870454 GGATCTCTATTAGTCAGCTTGGG - Intronic
1068774765 10:60857665-60857687 GAAGCTCTTAGAGTCAGGTTTGG - Intergenic
1068933142 10:62611927-62611949 TTATCTCTTCTAGTAAGGCTTGG - Intronic
1072065097 10:91860612-91860634 GAATCTCTTTTAATTGGTCTGGG + Intronic
1072931309 10:99665410-99665432 GAATCTTTTTTGGTCAGAATTGG + Intronic
1073133824 10:101208197-101208219 GAATTTCTGTTAGCCAGGCGCGG - Intergenic
1073373527 10:103012348-103012370 GAATTTCTTATTGCCAGGCTGGG + Intronic
1078239513 11:9517946-9517968 GAATATCTTTTCCTCAGTCTGGG - Intronic
1078493311 11:11789743-11789765 AAATCTCTTTCAATCAGACTGGG + Intergenic
1079152954 11:17917800-17917822 GAATCTGATTTAGTCAGTCTGGG - Intronic
1079710140 11:23672511-23672533 GACTCTCTCTTAGTCAGTTTAGG - Intergenic
1080243914 11:30158240-30158262 GAATCAGGTTTAGCCAGGCTAGG - Intergenic
1081526272 11:43929933-43929955 CAGTCTCTCTTGGTCAGGCTGGG - Intronic
1081791590 11:45791147-45791169 GAATCTCTATTATTCTGCCTAGG + Intergenic
1083175088 11:60944644-60944666 GTCTCTCTCTGAGTCAGGCTTGG - Intronic
1083584258 11:63845264-63845286 GATTCTCTTTTAGCCATGGTGGG + Intronic
1085110832 11:73886378-73886400 AAATGTATTTTAGTCAGGCCAGG + Intronic
1085222798 11:74889372-74889394 GGAGCTCTTTTAGGCAGGCCTGG - Intronic
1090422509 11:126585254-126585276 GAGTCTCTGTTAGCCAGGCTGGG + Intronic
1092730239 12:11525160-11525182 GAATATCTTTAAGTCATGCAGGG + Intergenic
1093571978 12:20676896-20676918 AAATCTCTTTTTGTTAGACTTGG + Intronic
1093576592 12:20737852-20737874 GAATCTATTTTAGTCAGTCCAGG + Intronic
1093968782 12:25355388-25355410 GAAACTCTTGTAGTCAGGTGTGG - Intergenic
1095443049 12:42256921-42256943 AAATGTGTTTTAGTCAGGCGTGG + Intronic
1104844394 12:131839502-131839524 GAGTCTCTTTCACCCAGGCTGGG + Intronic
1105533540 13:21242802-21242824 GATTCCATTTTATTCAGGCTCGG - Intergenic
1109269950 13:60244272-60244294 AAATATCTATTAGTCAGGGTGGG - Intergenic
1109348094 13:61141772-61141794 GGATCATTTTTAGTCAGCCTTGG + Intergenic
1111827836 13:93290624-93290646 GAAATGCATTTAGTCAGGCTGGG - Intronic
1112432647 13:99364945-99364967 GAATTTCTTTTATTCAGGAGTGG + Intronic
1114509658 14:23247888-23247910 GCAGCTCTTTTAGTCTGTCTGGG + Intronic
1116156551 14:41213509-41213531 GGAGCTCTTTTAGGCAGGCCTGG + Intergenic
1116166338 14:41338567-41338589 GGAGCTCTTTTAGGCAGGCCTGG - Intergenic
1116463314 14:45202904-45202926 GAGTCTCTGTTACCCAGGCTAGG + Intergenic
1118352775 14:64985546-64985568 GAATTTCTTTTATTCTAGCTGGG + Intronic
1120290674 14:82566312-82566334 CAATCTGTTTTAGGCAGGGTTGG + Intergenic
1124415158 15:29467599-29467621 GAATCTCTTTGACACAGCCTTGG - Intronic
1124611223 15:31210335-31210357 GTATCTCTTTTAGTGATGGTAGG - Intergenic
1128844079 15:70874049-70874071 GAATGTCATTTAGTCCAGCTAGG + Intronic
1130939500 15:88495927-88495949 GCCTCTCCTTCAGTCAGGCTGGG - Intergenic
1133665713 16:7965907-7965929 GAATCTCTTGTGGTAAGGCCTGG - Intergenic
1135860429 16:26051150-26051172 GAAACTCTCTAAGTCAGACTTGG + Intronic
1135885945 16:26307982-26308004 GAATATCTTGGAGTGAGGCTTGG - Intergenic
1146241994 17:31238442-31238464 GAAACTCTTTGAGTCTGGCCTGG + Intronic
1146426989 17:32749779-32749801 GAAACTCTATCAGTCAGGGTAGG - Intronic
1149507322 17:57205115-57205137 GATTCTCAATTACTCAGGCTTGG + Intergenic
1149720811 17:58842137-58842159 GAATTTGTTTTTCTCAGGCTGGG - Intronic
1151905929 17:77049177-77049199 GAATCTTGGTTAGTCAGACTTGG - Intergenic
1156098084 18:33560975-33560997 GAATCTCTTTTTATCTGCCTAGG + Intergenic
1158902278 18:61975103-61975125 GAATCCCATTTAGTCATGATTGG - Intergenic
1163454408 19:17397946-17397968 AAAACTCTTTTAACCAGGCTTGG + Intergenic
1163919486 19:20275558-20275580 GAATCTCTCTTTTTGAGGCTGGG + Intergenic
1164840916 19:31391442-31391464 GAATTCCTTCTACTCAGGCTGGG + Intergenic
1165428609 19:35759038-35759060 GAATATCTATTAGTGGGGCTGGG - Intronic
1165871162 19:38974415-38974437 GACTCTCTTTTTGTAAGGCTTGG - Intronic
928420145 2:31132052-31132074 GAATCTCTTTTAGTCAGGCTGGG - Intronic
929796519 2:45063730-45063752 GGAGCTCTTTTAGGCAGGCCTGG + Intergenic
930108978 2:47662093-47662115 GTATTTCTTTTAGTAAGGCAGGG - Intergenic
932218413 2:69982181-69982203 AAATCTCTTCTATTAAGGCTAGG + Intergenic
932247848 2:70211513-70211535 GAATATCTTTGTGTCAGGCTTGG - Exonic
932984724 2:76711552-76711574 GAATGTTTTCCAGTCAGGCTGGG + Intergenic
933390545 2:81661093-81661115 GAATCTCGCTTAGTCAGTTTAGG - Intergenic
934510787 2:94940326-94940348 GGATCTCTATTAGTCAGCTTGGG - Intergenic
936631074 2:114203386-114203408 GCAGCTGTATTAGTCAGGCTAGG - Intergenic
937819200 2:126288720-126288742 GAATTTATTTTAATCAGACTAGG - Intergenic
938961243 2:136343526-136343548 GAATCTCTTGTGGTGATGCTGGG + Intergenic
942927069 2:181446613-181446635 GAATCACTTTAACCCAGGCTTGG + Intergenic
943153319 2:184141599-184141621 GACTCACTTTTGGTCAGTCTAGG + Intergenic
946551800 2:220809513-220809535 CAACCTCTTTTAGTTAGGCGTGG + Intergenic
946977132 2:225165573-225165595 GAAACTCTTTTTGTCAGATTTGG + Intergenic
1172987730 20:39006385-39006407 GACTTTCTTATAGTCAGCCTGGG + Intronic
1173326714 20:42040339-42040361 GAGTCTTTTTCAGTCAGGGTGGG + Intergenic
1174735935 20:52965879-52965901 GAATCTAATTTAGTAAGTCTAGG + Intergenic
1174800938 20:53562699-53562721 GAAAATCTTTTAGTCAGGGATGG - Intergenic
1178565255 21:33678049-33678071 GGATCTTTTATAGTAAGGCTTGG - Intronic
1183552546 22:38499309-38499331 TAAACTCTTTGAGCCAGGCTTGG - Intronic
1184124824 22:42479679-42479701 GAATCTCTCTTCCTCAGGGTGGG + Intergenic
950632438 3:14291762-14291784 GACTCACTTTTAGTCAGTCTTGG - Intergenic
951328985 3:21342992-21343014 TAATTTCTTTTACTCAGGCAAGG - Intergenic
951441553 3:22729249-22729271 GCATTTCTTTTACTCAGGCTTGG - Intergenic
956764952 3:72477030-72477052 GATTTTGTTTCAGTCAGGCTGGG + Intergenic
959315044 3:104793292-104793314 GAATCTCTTAAAGTCGGGCACGG - Intergenic
959871218 3:111330648-111330670 GATTCTCCTTTAGTAAGTCTGGG + Intronic
961245815 3:125452430-125452452 AAAACTTTTTTAGCCAGGCTTGG + Intronic
964664630 3:159158868-159158890 GAATCTGTTTTAATCAGGTATGG + Intronic
966082214 3:176017955-176017977 GGAGCTCTTTTAGCCAGGCCTGG - Intergenic
967154676 3:186681566-186681588 GAACCTATTTCAGTCAGGCAGGG + Intergenic
967156277 3:186695404-186695426 GAAGCTATTTCAGTCAGGCAGGG + Intergenic
967158101 3:186711819-186711841 GAAGCTATTTCAGTCAGGCAGGG + Intergenic
969275544 4:6133495-6133517 GAATCTGCTTGCGTCAGGCTGGG - Intronic
970701374 4:18744006-18744028 GAGTCTATTTTATTCAGGTTTGG + Intergenic
971697699 4:29928180-29928202 GTACCTCTTTCGGTCAGGCTTGG - Intergenic
972387145 4:38578167-38578189 GAATCTCCTTTAGTCAGTTGAGG - Intergenic
972454342 4:39238638-39238660 AAATTTCTTTTGGTCAGCCTAGG - Intronic
972497398 4:39646803-39646825 GAATAACTTTTGGCCAGGCTTGG + Intergenic
973144535 4:46808306-46808328 GGGTCTTTTTTAGTTAGGCTGGG + Intronic
973783373 4:54311938-54311960 AAAGAGCTTTTAGTCAGGCTAGG + Intergenic
976737761 4:88328146-88328168 GAATCTGATTTAGTAAGTCTGGG - Intergenic
979266922 4:118714615-118714637 GAGTCTCTGTTACCCAGGCTGGG + Exonic
980139459 4:128897491-128897513 GGAGCTCTTTTAGGCAGGCCTGG - Intronic
988464653 5:31476796-31476818 GAGTGTCTTTTTGCCAGGCTGGG - Intronic
989953741 5:50332043-50332065 GGAGCTCTTTTAGGCAGGCCTGG - Intergenic
992030993 5:72721436-72721458 GAATCTGATTTAGTTAGCCTGGG + Intergenic
993536104 5:89088115-89088137 GAATCTGATTCAGTCAGACTGGG + Intergenic
994280907 5:97901327-97901349 GGAGCTCTTTTAGGCAGGCCTGG + Intergenic
997094912 5:130899499-130899521 GACGCTCTTTTAGGCAGGCCTGG - Intergenic
1005732080 6:28707627-28707649 GAAGCTATTTTAGCCAGGCACGG + Intergenic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1010042512 6:71402358-71402380 AAAACTCTATTAGTCATGCTGGG - Intergenic
1011567545 6:88693231-88693253 GAATCTTTTTTTCTCAGTCTAGG - Intronic
1013898568 6:115123207-115123229 GGAGCTCTTTAAGTCAGGCCTGG - Intergenic
1014339047 6:120179702-120179724 GAAGCTATTTTAATCAGGTTAGG + Intergenic
1014711049 6:124806457-124806479 GGAGCTCTTTTAGGCAGGCCTGG - Intronic
1015341655 6:132107845-132107867 GAATCTCATTTAGTGTGTCTGGG + Intergenic
1016012836 6:139156840-139156862 GAATCTCTGTTACCCATGCTAGG + Intronic
1016108748 6:140194814-140194836 GAGTCTCTTGTATTCAGGGTAGG - Intergenic
1022874597 7:34515287-34515309 GGAGCTCTTTTAGGCAGGCCTGG - Intergenic
1029971490 7:104793950-104793972 GAATCACTCTTAGAGAGGCTCGG + Intronic
1031431968 7:121683041-121683063 TAATGTCTTTAAGTCTGGCTAGG + Intergenic
1033233707 7:139621635-139621657 AAATCCCTTTTAGTCTGGGTGGG + Intronic
1038428506 8:27481130-27481152 GAATTTGTTTTAATCAGGTTTGG + Intergenic
1040944579 8:52870547-52870569 GAATCTCTTGAACTCAGGCAGGG - Intergenic
1042275658 8:67002861-67002883 GAAATATTTTTAGTCAGGCTTGG + Intronic
1043026449 8:75076271-75076293 GAATCACCTTTTGTCAAGCTAGG + Intergenic
1044261575 8:90130722-90130744 GAATATATATTAGTCACGCTAGG + Intergenic
1044513961 8:93116974-93116996 GAATCTCTGAGTGTCAGGCTGGG + Intergenic
1045948205 8:107821387-107821409 GAAGCTTTTTTAGTCATCCTGGG - Intergenic
1048730157 8:137430831-137430853 GACTCGCTTATAGACAGGCTGGG - Intergenic
1052339492 9:27351339-27351361 TAATCTCTGTAGGTCAGGCTGGG + Intronic
1053654599 9:40204031-40204053 GGATCTCTATTAGTCAGCTTGGG + Intergenic
1053726425 9:41006475-41006497 GAAGCTCTTTTAGGCAGGCCTGG + Intergenic
1053904990 9:42833238-42833260 GGATCTCTATTAGTCAGCTTGGG + Intergenic
1054366714 9:64350248-64350270 GGATCTCTATTAGTCAGCTTGGG + Intergenic
1054529996 9:66172279-66172301 GGATCTCTATTAGTCAGCTTGGG - Intergenic
1054674343 9:67839990-67840012 GGATCTCTATTAGTCAGCTTGGG + Intergenic
1186541773 X:10408581-10408603 GAATAGCTTTTAGTCTGGTTTGG + Intergenic
1194538820 X:95144632-95144654 GAACCTGTTTAAGTTAGGCTAGG + Intergenic
1194659675 X:96615888-96615910 GAATTTTTTTTAATCAGTCTGGG - Intergenic
1197641745 X:128975506-128975528 GAATCTGTTTTTATAAGGCTGGG + Intergenic
1198259403 X:134952407-134952429 AAATCTCTTTTGGCCAGGCTCGG + Intergenic
1198915461 X:141666292-141666314 GACTCTGATTTAGTCAGCCTGGG + Intronic