ID: 928420506

View in Genome Browser
Species Human (GRCh38)
Location 2:31134695-31134717
Sequence CACCCTTGGAGAGCTCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 199}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928420506_928420513 -1 Left 928420506 2:31134695-31134717 CCCCTGGGAGCTCTCCAAGGGTG 0: 1
1: 0
2: 3
3: 12
4: 199
Right 928420513 2:31134717-31134739 GAGGATCTAGGGATGAGCCAAGG 0: 1
1: 0
2: 0
3: 19
4: 231
928420506_928420515 8 Left 928420506 2:31134695-31134717 CCCCTGGGAGCTCTCCAAGGGTG 0: 1
1: 0
2: 3
3: 12
4: 199
Right 928420515 2:31134726-31134748 GGGATGAGCCAAGGGAGCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 196
928420506_928420516 9 Left 928420506 2:31134695-31134717 CCCCTGGGAGCTCTCCAAGGGTG 0: 1
1: 0
2: 3
3: 12
4: 199
Right 928420516 2:31134727-31134749 GGATGAGCCAAGGGAGCTCTGGG 0: 1
1: 0
2: 0
3: 15
4: 198
928420506_928420520 19 Left 928420506 2:31134695-31134717 CCCCTGGGAGCTCTCCAAGGGTG 0: 1
1: 0
2: 3
3: 12
4: 199
Right 928420520 2:31134737-31134759 AGGGAGCTCTGGGAAGCGGGTGG 0: 1
1: 1
2: 3
3: 47
4: 464
928420506_928420521 20 Left 928420506 2:31134695-31134717 CCCCTGGGAGCTCTCCAAGGGTG 0: 1
1: 0
2: 3
3: 12
4: 199
Right 928420521 2:31134738-31134760 GGGAGCTCTGGGAAGCGGGTGGG 0: 1
1: 0
2: 3
3: 36
4: 379
928420506_928420519 16 Left 928420506 2:31134695-31134717 CCCCTGGGAGCTCTCCAAGGGTG 0: 1
1: 0
2: 3
3: 12
4: 199
Right 928420519 2:31134734-31134756 CCAAGGGAGCTCTGGGAAGCGGG 0: 1
1: 0
2: 1
3: 52
4: 385
928420506_928420517 15 Left 928420506 2:31134695-31134717 CCCCTGGGAGCTCTCCAAGGGTG 0: 1
1: 0
2: 3
3: 12
4: 199
Right 928420517 2:31134733-31134755 GCCAAGGGAGCTCTGGGAAGCGG 0: 1
1: 0
2: 1
3: 62
4: 439
928420506_928420522 21 Left 928420506 2:31134695-31134717 CCCCTGGGAGCTCTCCAAGGGTG 0: 1
1: 0
2: 3
3: 12
4: 199
Right 928420522 2:31134739-31134761 GGAGCTCTGGGAAGCGGGTGGGG 0: 1
1: 0
2: 2
3: 55
4: 426
928420506_928420514 0 Left 928420506 2:31134695-31134717 CCCCTGGGAGCTCTCCAAGGGTG 0: 1
1: 0
2: 3
3: 12
4: 199
Right 928420514 2:31134718-31134740 AGGATCTAGGGATGAGCCAAGGG 0: 1
1: 0
2: 0
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928420506 Original CRISPR CACCCTTGGAGAGCTCCCAG GGG (reversed) Intronic
901510349 1:9715369-9715391 CACCCATGGTCAGCACCCAGGGG + Intronic
902329229 1:15722918-15722940 CAGCCTTTCAGAGCTCCCTGCGG + Intronic
903462042 1:23526972-23526994 CACCTTTGGACAGTGCCCAGAGG + Intronic
905207682 1:36352162-36352184 CACCCCTGGTGAGGGCCCAGCGG - Intronic
905885138 1:41487722-41487744 CACCCGTGAAGCTCTCCCAGGGG + Intergenic
905934180 1:41810641-41810663 GTACCTTGGAGAGCTCCAAGGGG - Intronic
905985333 1:42275858-42275880 CAGCCTGTAAGAGCTCCCAGTGG + Intronic
906531456 1:46526265-46526287 CACCCTAGGGGAGCTCCCGAGGG - Intergenic
906829539 1:49016791-49016813 CACACTTGGTGGGCTCCAAGTGG - Intronic
908408435 1:63838373-63838395 GCCCCTTGAAGAGCTTCCAGGGG + Intronic
908463305 1:64367169-64367191 CTCTCTTGGAGAGCCCTCAGGGG + Intergenic
911184090 1:94886297-94886319 CAGCCTGGGAGAGCTTCCAGAGG + Intronic
914922065 1:151853868-151853890 GAGCCTTGGAGAGCTGCCTGGGG + Intergenic
915299158 1:154942145-154942167 CAAACTTGGGGAGCTCCCAGCGG + Intergenic
916802979 1:168231762-168231784 CACACAAGCAGAGCTCCCAGAGG - Intronic
920556768 1:206909807-206909829 GCGCCCTGGAGAGCTCCCAGAGG - Exonic
921478994 1:215642454-215642476 CACCACTGGAGAGCACCCATAGG - Intronic
922481823 1:225944673-225944695 CAGCCTTAGTGAGCTCCCAGTGG - Intergenic
922595247 1:226808459-226808481 CAACCTTGGAGAAAGCCCAGTGG + Intergenic
922894914 1:229092437-229092459 TCCCCTTGGAGGGCTCTCAGAGG - Intergenic
1065355368 10:24835206-24835228 CACCCATGTCAAGCTCCCAGGGG - Intergenic
1069429519 10:68321744-68321766 CAACCTGGAAGAGCTCCCAATGG + Intronic
1073541022 10:104316179-104316201 AACCCATCGAGAGCTCCCTGCGG + Intronic
1073783573 10:106864985-106865007 CTCCCTGAGACAGCTCCCAGAGG + Intronic
1075262030 10:120971357-120971379 CAAGCTTGGAAAGCACCCAGCGG - Intergenic
1075605467 10:123802197-123802219 CACCCTTGGCGAACTTCAAGAGG - Intronic
1076527947 10:131124184-131124206 CAGCCTTGGAGACCTGTCAGAGG - Intronic
1077319770 11:1935970-1935992 CACCCTTGGGGCTCTCCCAGAGG + Intronic
1078574295 11:12485514-12485536 CAACCTGAGGGAGCTCCCAGTGG + Intronic
1079124562 11:17709457-17709479 CACCCTGGGGGAGCACCAAGAGG - Intergenic
1081856523 11:46307734-46307756 CAGCCTAGGGTAGCTCCCAGGGG + Intronic
1081858022 11:46316210-46316232 CCCCCTAGGAGAGCTCCAGGAGG + Intronic
1083132076 11:60633950-60633972 CACCCTTGCCAAGCTCCCATGGG - Intergenic
1083591285 11:63896684-63896706 AACCCTTGAAGGGATCCCAGGGG - Intronic
1084805121 11:71573467-71573489 CATCCTTGGAAAGCTCTTAGGGG + Intergenic
1085198212 11:74684812-74684834 CACCCTTTGAGAGCTCCCTGTGG + Intergenic
1085790113 11:79490172-79490194 CCCCCTTGGAGAGCAGTCAGTGG - Intergenic
1088543414 11:110936645-110936667 CTCCCTGGGAGAACTGCCAGTGG + Intergenic
1091218515 11:133917862-133917884 CACCCTTGGGGACCTCTCTGGGG - Intronic
1091951062 12:4593418-4593440 CATCCTGGGTGAGCTCCCACAGG + Intronic
1092491379 12:8949057-8949079 CACCCTGGGAGAGCTTTGAGGGG - Intronic
1092945536 12:13450729-13450751 CATCCATGGAGAGCTCCCAAAGG - Intergenic
1097235742 12:57538266-57538288 CAGCCTTGGAGAGGCTCCAGAGG - Intronic
1097610961 12:61819626-61819648 CACCCTTGAACACCTGCCAGAGG - Intronic
1103566270 12:121817407-121817429 CCCGCTTGGCGAGCTCACAGGGG - Exonic
1104189036 12:126460006-126460028 CAGCCTTTGAGAGCAGCCAGTGG - Intergenic
1104675947 12:130712513-130712535 TTCCCCTGGAGACCTCCCAGCGG - Intronic
1104893663 12:132151789-132151811 GGGCCTTGGAGAGCTCCCTGTGG + Exonic
1107467300 13:40663137-40663159 GGCCCTTGGGCAGCTCCCAGTGG - Intronic
1107560153 13:41551066-41551088 GACCCTGGGAGAGCGACCAGAGG - Intergenic
1112191092 13:97178515-97178537 CACCCTTGGAGAAATCACATGGG - Intergenic
1112436168 13:99392704-99392726 CCCGCCTGGAGAGCTCCCATGGG + Intergenic
1119845827 14:77828968-77828990 CAACCTGAAAGAGCTCCCAGTGG - Intronic
1121036059 14:90704583-90704605 CAGCCTGGGAAGGCTCCCAGCGG + Intronic
1122287708 14:100661704-100661726 TAACCTTGGAGGGCTCTCAGAGG + Intergenic
1202859396 14_GL000225v1_random:72201-72223 CACCCCTGGAGGCCTCCAAGTGG - Intergenic
1126523863 15:49628193-49628215 TACCCCTGAAGAGCTTCCAGTGG - Intronic
1135143088 16:19938233-19938255 CTCCCTTGGACAGTCCCCAGTGG - Intergenic
1135488667 16:22888043-22888065 CTGCCTTCCAGAGCTCCCAGTGG + Intronic
1136033352 16:27519447-27519469 CAGCCTAGGACAGCTCCCTGGGG - Intronic
1138880935 16:61014454-61014476 CACCTCTGGAGCCCTCCCAGAGG - Intergenic
1139318996 16:66097710-66097732 CACCCTTGGTGTGAGCCCAGAGG + Intergenic
1140857188 16:78988541-78988563 CTCCCCAGGAGAGGTCCCAGCGG + Intronic
1144600235 17:16606438-16606460 CACCCTTGGAATGCACTCAGTGG - Intergenic
1144620080 17:16813001-16813023 AACCCTTGGTGAGAGCCCAGTGG + Intergenic
1144892606 17:18502698-18502720 AACCCTTGGTGAGAGCCCAGTGG - Intergenic
1145139608 17:20441589-20441611 AACCCTTGGTGAGAGCCCAGTGG + Intergenic
1145217269 17:21061535-21061557 CGGCTTTGGAGGGCTCCCAGGGG + Intergenic
1145935009 17:28710136-28710158 CACCCTGGCTGAGGTCCCAGCGG - Intronic
1148475975 17:47928984-47929006 TTCCCTTGGAGAGCTCGGAGAGG + Intergenic
1149523097 17:57333316-57333338 CCCCCCTGGAAAGTTCCCAGTGG + Intronic
1156158355 18:34330469-34330491 TACTCTTTGATAGCTCCCAGGGG - Intergenic
1158395735 18:57077358-57077380 GACCATTGGAAAGCCCCCAGAGG + Intergenic
1161416508 19:4150134-4150156 CACCCTGGGTGAGCTCCCCTGGG + Intergenic
1161494577 19:4580452-4580474 CAAACTCGGAGAGCGCCCAGAGG + Intergenic
1161663496 19:5561149-5561171 CCACCTTGGAAAGCTCCCATGGG - Intergenic
1163762769 19:19146304-19146326 CACCCCTCGAGGGCTGCCAGGGG + Exonic
1166386945 19:42387582-42387604 CAGCCAAGGAGAGGTCCCAGAGG + Intronic
1166390397 19:42406176-42406198 CACACTTGGAGAGCACACTGAGG + Exonic
1166719741 19:44990174-44990196 CACCCCTGGAGCCCTCCCATAGG - Intronic
1166942394 19:46374773-46374795 CACCCATGCAGCTCTCCCAGTGG + Intronic
927155477 2:20218981-20219003 GACCCTTGAGGGGCTCCCAGTGG + Intronic
928420506 2:31134695-31134717 CACCCTTGGAGAGCTCCCAGGGG - Intronic
928752756 2:34489791-34489813 CAGCCGTTGAGAACTCCCAGTGG + Intergenic
935080477 2:99788341-99788363 CACCCCTGAAGACCTCCCAGTGG + Intronic
935320211 2:101879708-101879730 CACCCTGGGACTGCCCCCAGAGG + Intronic
935486614 2:103663898-103663920 CACCCTTCCAGAGCACCAAGTGG - Intergenic
935896020 2:107738398-107738420 CACCCTTCTAGTGCTACCAGGGG - Intergenic
936473767 2:112822193-112822215 AATCCTTGCAGAGCCCCCAGAGG - Intergenic
937677702 2:124609884-124609906 TACACCTGGAGAGGTCCCAGTGG - Exonic
937764051 2:125639279-125639301 GCCTCTTGGTGAGCTCCCAGAGG - Intergenic
937982428 2:127623417-127623439 CACCCAGGGAGAGCACCCTGAGG + Intronic
938135210 2:128750969-128750991 CACCCTGGGATGCCTCCCAGAGG - Intergenic
939296582 2:140273581-140273603 CACCCTTGGTGAGCTCTCAGCGG + Intronic
943135516 2:183906126-183906148 CAACCTTGGATAGATCCCAAAGG - Intergenic
945673832 2:212832523-212832545 CATCCCTGGCGAGGTCCCAGAGG - Intergenic
946347415 2:219122238-219122260 CACCTTTCAAGAGCTCCCTGGGG + Intronic
947385204 2:229584548-229584570 GACACTTGGACAGTTCCCAGAGG - Intronic
947410012 2:229827597-229827619 CACCCCTGAAGACCTTCCAGTGG - Intronic
948272269 2:236683717-236683739 CACCTTAGGACTGCTCCCAGAGG - Intergenic
1168806643 20:675675-675697 CAGCACTGGACAGCTCCCAGCGG + Exonic
1172625557 20:36344705-36344727 GAACCTTGGACAGCTCCCAGTGG + Intronic
1173916732 20:46713607-46713629 GAGCCTTGGAGGGCTCCTAGTGG + Intronic
1175419147 20:58820404-58820426 CACCCTTGGAGAGCTCCCTCGGG - Intergenic
1176426988 21:6553933-6553955 CACACTTGGAGGGCTGTCAGAGG + Intergenic
1176657963 21:9604900-9604922 CAACCTGAAAGAGCTCCCAGTGG + Intergenic
1178840678 21:36135506-36135528 CACCCTCGGAGCGCTCCAGGGGG - Intronic
1179072566 21:38085457-38085479 CAGCCTGTAAGAGCTCCCAGCGG - Intronic
1179592324 21:42416977-42416999 CTCCCTTGGAGGGCTCCAGGGGG - Intronic
1179702479 21:43162255-43162277 CACACTTGGAGGGCTGTCAGAGG + Exonic
1180190755 21:46161405-46161427 CCTCCTTGGAGAGCTCGCACAGG + Exonic
1182087280 22:27569841-27569863 CAACCTTGGAGGGCTCCATGAGG - Intergenic
1182101826 22:27662959-27662981 CTCCCTGGGAGAGATGCCAGAGG + Intergenic
1182225581 22:28795636-28795658 CAGCCTGGAGGAGCTCCCAGAGG - Exonic
1182826865 22:33273279-33273301 TACCCTTGGACAGGTCCCAAAGG + Exonic
1183212969 22:36462310-36462332 CACCCTTGGAGAATGCCCACTGG - Intergenic
1183490588 22:38113528-38113550 CAGTCTTGGCCAGCTCCCAGGGG + Exonic
1184099655 22:42335412-42335434 CACCCTCGAGGAGCTCACAGTGG - Intronic
1184650294 22:45916518-45916540 GACCCCTGGAGAGGTCCCTGTGG - Intergenic
1185069905 22:48650474-48650496 CATCCTTGCTGAGGTCCCAGCGG - Intronic
949849557 3:8409260-8409282 TGCCCCTGGAGACCTCCCAGTGG + Intergenic
949882035 3:8669223-8669245 CAACCTAAAAGAGCTCCCAGTGG + Intronic
950347758 3:12313709-12313731 CAGCCTGAAAGAGCTCCCAGTGG + Intronic
950427353 3:12931658-12931680 CACCCTTCCAGCGCCCCCAGGGG - Intronic
950442875 3:13020017-13020039 CACCCTTGGACAGGGCACAGCGG + Intronic
952207472 3:31194352-31194374 CCCCCTTGGAGAGATGTCAGGGG - Intergenic
952349678 3:32522203-32522225 GAACCTGGGAGAGCTCCTAGAGG - Intergenic
953096314 3:39780023-39780045 CACCCGCGGTGGGCTCCCAGCGG + Intergenic
954796178 3:53162163-53162185 CACCCTGGGAGGGGTCTCAGAGG - Intronic
956442526 3:69294472-69294494 CAGTCTTGGAGAATTCCCAGGGG + Intronic
957277739 3:78110449-78110471 GAACCTGGTAGAGCTCCCAGAGG - Intergenic
958768297 3:98396713-98396735 CACCCATGCTGAGCTCCCATGGG - Intergenic
959991543 3:112637484-112637506 CAACATTGGAGTGCTCCAAGAGG - Intronic
960125845 3:113997624-113997646 CAACCTTAAAGAGCTCCCAGTGG + Intronic
961382994 3:126508168-126508190 CACGCCTGGACAGCTCCCACAGG + Intronic
961503110 3:127351198-127351220 CCTCCCTGGAGAGCCCCCAGGGG + Intergenic
964366610 3:155957285-155957307 CAACCTAAAAGAGCTCCCAGTGG - Intergenic
967273759 3:187753027-187753049 GCCACTTGAAGAGCTCCCAGTGG + Intergenic
967434868 3:189431923-189431945 CACCCATGCTGAGCTCCCATGGG - Intergenic
968845130 4:3036757-3036779 CAGCCTTGGAGACCACTCAGTGG + Intronic
969906313 4:10399537-10399559 TGCCCTTGGAGACCTTCCAGTGG - Intergenic
979035538 4:115711962-115711984 CAGTCCTGGAGAGCTCCCATTGG - Intergenic
980410671 4:132414248-132414270 CTCCCCTGGAGGGATCCCAGAGG + Intergenic
981542488 4:145860313-145860335 CAGCCTTACAGAGCTCCCTGTGG - Intronic
984232817 4:177119938-177119960 AACCCTTGGAAAATTCCCAGTGG + Intergenic
985417447 4:189751177-189751199 CAACCTGAAAGAGCTCCCAGTGG - Intergenic
986916087 5:12622986-12623008 CACCCCTGCAGAGCTCACATGGG + Intergenic
989104054 5:37844239-37844261 AGTCCTTGGCGAGCTCCCAGTGG + Intergenic
991191201 5:63876070-63876092 CGCCCATGAATAGCTCCCAGTGG - Intergenic
993894239 5:93512149-93512171 TGCCCTTGAAGAGCTCCCAGTGG + Intergenic
994638104 5:102367736-102367758 CACCCCTGAAGACCTTCCAGTGG + Intergenic
996258468 5:121435848-121435870 CATCCTTTGATAGGTCCCAGTGG - Intergenic
997407434 5:133662706-133662728 CAGCCCTGGGGAGCTCCCAGGGG - Intergenic
999829823 5:155307801-155307823 CAGCCGTGGAGACCTCCCTGAGG - Intergenic
1000210649 5:159104081-159104103 GACCCGTGGAAAGGTCCCAGCGG + Intergenic
1000585702 5:163095756-163095778 CACTCTTGGAGACCATCCAGTGG + Intergenic
1005799859 6:29409993-29410015 CTCCCTAGCAGAGCTCCCAGAGG + Intronic
1006114226 6:31766657-31766679 CATCCTTCGAGGGGTCCCAGAGG - Exonic
1007555829 6:42765354-42765376 CTCTCTGGGAGAGATCCCAGTGG + Intronic
1007759995 6:44127922-44127944 CACCCTTTGGGATCTCCCCGGGG - Intronic
1008044429 6:46837338-46837360 CAACCTGGAAGAGCTCCCAAAGG - Intronic
1008627886 6:53335550-53335572 CACCTTTGCAGACCTCTCAGAGG + Intronic
1009177390 6:60477169-60477191 CAACCTGAAAGAGCTCCCAGTGG - Intergenic
1010178487 6:73056616-73056638 CACACTTGGAGAGGACCAAGAGG - Intronic
1012511331 6:100005309-100005331 CAACCTGAAAGAGCTCCCAGTGG + Intergenic
1014551044 6:122789695-122789717 CGCCCTTGGAGCGCCCCCACCGG - Intronic
1016844422 6:148556797-148556819 CACCCTTGGTGATCTCTCTGTGG + Intergenic
1017862994 6:158416334-158416356 CACCCCTGAAGACCTTCCAGTGG + Intronic
1018692357 6:166357605-166357627 CACCATTAAAGGGCTCCCAGTGG + Intergenic
1021769611 7:23985184-23985206 CACCCATGCCGAGCTCCCATGGG - Intergenic
1021839649 7:24712418-24712440 CACCCATGCATAGCTCCCTGAGG + Intronic
1023527923 7:41124261-41124283 CAACCCTGAAGACCTCCCAGTGG + Intergenic
1024132360 7:46367179-46367201 CAACCTGAAAGAGCTCCCAGTGG - Intergenic
1024193993 7:47040912-47040934 CACCAGTCGAGAGTTCCCAGAGG - Intergenic
1024256793 7:47545576-47545598 CTCCCTTGGGGGGCTCCCATGGG + Intronic
1029734809 7:102459618-102459640 CAGACTGGGAGAGCTTCCAGGGG + Exonic
1031091232 7:117357402-117357424 TACCCTTGAAGACCTTCCAGTGG + Intergenic
1032329706 7:130966435-130966457 CCCACTTTGAGAGCCCCCAGTGG - Intergenic
1034029178 7:147741105-147741127 AACCCTTGGAAAGCTTCCAATGG - Intronic
1035763597 8:2087517-2087539 CACCCTAGGAGACCCCACAGAGG - Intronic
1035834428 8:2733607-2733629 CACCCTTGCAGAGCGCGCTGGGG - Intergenic
1037478878 8:19286091-19286113 CACCCATGCTGAGCTCCCATGGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038269676 8:26065010-26065032 CCTGATTGGAGAGCTCCCAGTGG + Intergenic
1040593832 8:48819304-48819326 CACCCCTGCAGACATCCCAGCGG - Intergenic
1040929098 8:52714944-52714966 CACCCTTGCAGAGTTAACAGGGG - Intronic
1041942007 8:63399037-63399059 CTACCTTGCAGAGCTTCCAGTGG + Intergenic
1043510235 8:80943954-80943976 GAACCAGGGAGAGCTCCCAGTGG + Intergenic
1049244783 8:141556471-141556493 CATCCCTGGCCAGCTCCCAGAGG - Intergenic
1049604619 8:143523545-143523567 CCAGCTTGGTGAGCTCCCAGAGG + Intronic
1051749521 9:20326675-20326697 CACCATCAGAGAGCTCACAGGGG - Intergenic
1051924199 9:22303935-22303957 CACCCATGGAGACAACCCAGCGG - Intergenic
1052378371 9:27742397-27742419 CACCCCTAAGGAGCTCCCAGGGG - Intergenic
1053653166 9:40189597-40189619 CAACCTGGAAGAGCTCCCAAAGG + Intergenic
1053903569 9:42818900-42818922 CAACCTGGAAGAGCTCCCAAAGG + Intergenic
1054531418 9:66186626-66186648 CAACCTGGAAGAGCTCCCAAAGG - Intergenic
1056317482 9:85404683-85404705 TGCCCTTGGAGACCTTCCAGTGG + Intergenic
1057746315 9:97754630-97754652 CAACCTGAAAGAGCTCCCAGTGG - Intergenic
1057853187 9:98581066-98581088 CACCATCGGTGAGCTCCCCGAGG - Intronic
1057912944 9:99034241-99034263 TTCGCTTGGAGAGCTGCCAGTGG - Intronic
1059355370 9:113695383-113695405 CATCCCTGCAGAGCTCCCAGAGG - Intergenic
1060281187 9:122216699-122216721 CACCTTTGGACAGCTCTCATTGG - Intronic
1060521744 9:124297981-124298003 TACCCATGGAGAGCCCCAAGAGG + Intronic
1062163141 9:135090755-135090777 CTACCTTGGAGAGCGCCCATAGG + Intronic
1062317471 9:135975290-135975312 CAACCTGAAAGAGCTCCCAGTGG - Intergenic
1203635692 Un_KI270750v1:108475-108497 CAACCTGAAAGAGCTCCCAGTGG + Intergenic
1186161174 X:6778635-6778657 CCCTCTTGGAGAGCTGCCTGCGG - Intergenic
1190691409 X:52916199-52916221 TTCCCATGGAGAACTCCCAGGGG - Intergenic
1190694574 X:52939593-52939615 TTCCCATGGAGAACTCCCAGGGG + Intronic
1192682750 X:73268581-73268603 CACCCATGTCGAGCTCCCATGGG - Intergenic
1193922958 X:87451567-87451589 CACCCCTGGAGAACTTCCATGGG - Intergenic
1194520119 X:94908744-94908766 CTCCCTGAGACAGCTCCCAGAGG + Intergenic
1194556743 X:95369025-95369047 CACCTATGCAGAGCTCCCATGGG - Intergenic
1195247319 X:103006113-103006135 CACACTGGTAGAGCTCCTAGAGG - Intergenic
1199077178 X:143537053-143537075 CACCCATGCAAAGCTCCCATGGG - Intergenic