ID: 928425041

View in Genome Browser
Species Human (GRCh38)
Location 2:31170888-31170910
Sequence TTTCCCTTTAACCATCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928425041_928425044 -1 Left 928425041 2:31170888-31170910 CCCTTAAGATGGTTAAAGGGAAA No data
Right 928425044 2:31170910-31170932 ACCTGCCAGGAAGCCTCCCCTGG No data
928425041_928425047 9 Left 928425041 2:31170888-31170910 CCCTTAAGATGGTTAAAGGGAAA No data
Right 928425047 2:31170920-31170942 AAGCCTCCCCTGGCCCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928425041 Original CRISPR TTTCCCTTTAACCATCTTAA GGG (reversed) Intergenic