ID: 928427854

View in Genome Browser
Species Human (GRCh38)
Location 2:31193381-31193403
Sequence TGGGCATCCCAGCCCTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 1, 2: 11, 3: 59, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928427850_928427854 3 Left 928427850 2:31193355-31193377 CCCATGGGGAGGGTGAAACGGAG 0: 1
1: 0
2: 2
3: 13
4: 139
Right 928427854 2:31193381-31193403 TGGGCATCCCAGCCCTCTCATGG 0: 1
1: 1
2: 11
3: 59
4: 280
928427845_928427854 17 Left 928427845 2:31193341-31193363 CCTAGTTATCAGGACCCATGGGG 0: 1
1: 0
2: 0
3: 13
4: 89
Right 928427854 2:31193381-31193403 TGGGCATCCCAGCCCTCTCATGG 0: 1
1: 1
2: 11
3: 59
4: 280
928427851_928427854 2 Left 928427851 2:31193356-31193378 CCATGGGGAGGGTGAAACGGAGC 0: 1
1: 0
2: 1
3: 14
4: 213
Right 928427854 2:31193381-31193403 TGGGCATCCCAGCCCTCTCATGG 0: 1
1: 1
2: 11
3: 59
4: 280
928427841_928427854 27 Left 928427841 2:31193331-31193353 CCAGATAACGCCTAGTTATCAGG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 928427854 2:31193381-31193403 TGGGCATCCCAGCCCTCTCATGG 0: 1
1: 1
2: 11
3: 59
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928427854 Original CRISPR TGGGCATCCCAGCCCTCTCA TGG Intronic
900380558 1:2381901-2381923 GGGGCAGCCCAGCCCTGTCCCGG - Intronic
900576340 1:3384279-3384301 TGGGCAGCCCAGCCCAGACAGGG - Intronic
900712199 1:4121559-4121581 TGAGCATCCGAGGCCTCTCTTGG + Intergenic
902331121 1:15731712-15731734 TGGGGCTCCCAGACCTCTCCTGG + Intronic
902891437 1:19447106-19447128 TGCCCATCCCAGCCCTCACTGGG + Intronic
903703451 1:25267691-25267713 TCGGCCGCGCAGCCCTCTCAGGG - Intronic
903712718 1:25338020-25338042 TCGGCCGCGCAGCCCTCTCAGGG - Exonic
903811624 1:26037914-26037936 TGGGCTTCCCAGCCTCCCCAGGG - Intronic
904629234 1:31829009-31829031 GGGGCATCACAGTCCTCTCGAGG + Intergenic
904732819 1:32607403-32607425 TGGGCATCCCTGCACTCTTCAGG - Intronic
905124713 1:35708351-35708373 CGGGGAACCCAGCCCTCTCCCGG + Intergenic
905290899 1:36921060-36921082 TGGCCCTCCCAGCCCTCTGGAGG - Intronic
905408512 1:37753272-37753294 CGTGCATCCCGCCCCTCTCACGG - Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
907985242 1:59524033-59524055 TGGGCATCCCTACGCTCTCAGGG + Intronic
909054735 1:70807371-70807393 TGGGCATCCCTGTGCTCTCAGGG - Intergenic
909907735 1:81220660-81220682 CAGGCATCCCTGCACTCTCAGGG + Intergenic
910655062 1:89610446-89610468 CGGGCATCTCTGCACTCTCAGGG - Intergenic
910856037 1:91696878-91696900 TGGGCAGCCCAGCACTCCAAAGG + Intronic
911434895 1:97844779-97844801 TGGGCAACCCTGCCTTCTCAGGG + Intronic
911475484 1:98367528-98367550 TGGGCATCCCTGTGCTCTCAGGG - Intergenic
911935259 1:103961170-103961192 TGGACATCCCTGCGCTCTCAAGG - Intergenic
915334729 1:155134440-155134462 TGGGCATCCTGGCTCTCTCCTGG - Exonic
915554558 1:156654243-156654265 AGGGAATCCCAGCCTTCTCCAGG - Intronic
916557118 1:165902794-165902816 CGTGCAGCCCAGCCCTCTCGGGG + Intronic
917834864 1:178933537-178933559 TGGCCTTCCCTGGCCTCTCAGGG - Intergenic
917838375 1:178958588-178958610 TGGGCATCCCTGGCCGCTCCTGG - Intergenic
918247755 1:182674946-182674968 TGGGAAGCCCTGCCCTCTCCAGG + Intronic
919205827 1:194420785-194420807 CTGGCATCCCTGCCTTCTCAAGG - Intergenic
919249252 1:195030981-195031003 TAGGCATCCCTGTGCTCTCAGGG - Intergenic
921748319 1:218763512-218763534 TAGACATCCCAGCCCTGTTAGGG - Intergenic
922177068 1:223204979-223205001 AGGGCATCCCAGGCCCCTCTGGG - Intergenic
1063119650 10:3096481-3096503 TCTACATCCCAGTCCTCTCAGGG + Intronic
1065830238 10:29608510-29608532 TGGGCATCCCTGCACTCTCCAGG + Intronic
1066653370 10:37679843-37679865 TGGGCATCCCTGTCCTTTCCTGG + Intergenic
1067416448 10:46106555-46106577 TGGGCAGCCCAGTCCTCCCCGGG - Intergenic
1067436582 10:46283033-46283055 TGGGCAGCCCAGCCCTCCCCGGG - Intergenic
1067534961 10:47102291-47102313 TGTGCATCACATCCCTCTCATGG + Intergenic
1069858944 10:71458244-71458266 TGGCCATCCAAGCCCTTTCTTGG - Intronic
1070696001 10:78563550-78563572 TGGGCCTCCCACCTCCCTCACGG + Intergenic
1070779626 10:79130010-79130032 TGGGCATCCAAGCCCCCAGAGGG + Intronic
1071060984 10:81570744-81570766 CAGGCATCCCTGCACTCTCAGGG - Intergenic
1072782749 10:98261476-98261498 TGCCCATCTCAGCTCTCTCAGGG - Intronic
1073859403 10:107720344-107720366 TGGTCCTCCCTGCCTTCTCAAGG - Intergenic
1075206805 10:120456087-120456109 TGGGGAGCCCAGGCCTCTCTTGG - Intergenic
1075644276 10:124087286-124087308 TGGCGATCCCATCCCTCCCAGGG - Intronic
1075727681 10:124618869-124618891 GGGCCATCCCAGGCCCCTCAGGG + Intronic
1076734934 10:132454605-132454627 AGGTCATCCCAGTCCTCTCAGGG + Intergenic
1076825180 10:132963594-132963616 GGGGCATCCCAGCCCTCACAGGG + Intergenic
1077176361 11:1192939-1192961 TGGGCATCCCAGCTCAGTGACGG - Intronic
1077338062 11:2014230-2014252 TGGGCCTCCCAGCCCTGCAAGGG + Intergenic
1077406861 11:2386609-2386631 TGGTCTTCCCAGCCCTAGCATGG - Intronic
1077446696 11:2595667-2595689 TGGTCATCCAAGACCTCTGATGG + Intronic
1077456991 11:2687290-2687312 TTGAGATCCCAGGCCTCTCAGGG + Intronic
1077485572 11:2837051-2837073 GGGGCATGGCAGCCCTCTCCTGG + Intronic
1077938756 11:6817971-6817993 TGGGCATCCCTGCACTCTTGGGG + Intergenic
1078090591 11:8262430-8262452 TGGGGATCCCAGCCCCCTTGGGG - Intronic
1078345635 11:10545163-10545185 TGGGCATCCTTGTGCTCTCAGGG - Intergenic
1079673881 11:23201908-23201930 TGGTAATCCCAGCCCCCACATGG - Intergenic
1081284106 11:41246449-41246471 GGGGCATCTCTGCACTCTCAGGG - Intronic
1082657815 11:55873381-55873403 TGGGCTTCCGCGCCCTCTCGTGG + Intergenic
1083179733 11:60977411-60977433 TGGGGATCCCAGCCCTACCAGGG - Intronic
1083339860 11:61952022-61952044 GGGGCCTCCCAGCCAGCTCAGGG + Intronic
1083758795 11:64804887-64804909 TGGCCATCCCATCCCACCCAGGG + Intronic
1084767680 11:71323278-71323300 TGGTCACCCCAGCCCACTCTTGG + Intergenic
1085318716 11:75561806-75561828 TGTGCACCCCCTCCCTCTCAGGG - Intergenic
1085334381 11:75679686-75679708 TCAGCATCCCCGCACTCTCAGGG - Intergenic
1085435070 11:76493030-76493052 TGGGCATCCGTGTGCTCTCAGGG + Intronic
1086913906 11:92505470-92505492 TGTGCATCACTGCCCTCTCTGGG + Intronic
1087131301 11:94671626-94671648 TGGGCATCTCTGTGCTCTCAGGG + Intergenic
1087265495 11:96056182-96056204 AGGGCATCCCTGCCCCCACAGGG + Intronic
1088328921 11:108629568-108629590 CGGGCATCCCTGCTCTCTCAGGG - Intergenic
1088756165 11:112887090-112887112 TTGGAATCCCAGCCCTGCCAAGG - Intergenic
1202821046 11_KI270721v1_random:69412-69434 TGGGCCTCCCAGCCCTGCAAGGG + Intergenic
1095749785 12:45697353-45697375 TGGGCATCCCTGCACTCTCAGGG - Intergenic
1096085811 12:48864534-48864556 TCACCATCCCAGCCCTCTAAAGG + Intronic
1097450812 12:59734462-59734484 TGGACATCCCTGCACTCTCTGGG - Intronic
1097500175 12:60392087-60392109 CAGGCATCTCTGCCCTCTCAGGG + Intergenic
1099376105 12:81897748-81897770 TGGAGATCCCTTCCCTCTCAAGG + Intergenic
1103213764 12:119186187-119186209 AGGGCTTCCCAACCCCCTCAGGG - Intronic
1104736064 12:131136615-131136637 TGGCCCTCCCAGCCCTCCCTGGG + Intronic
1105494900 13:20921877-20921899 TGGACAACCCAGCCCTGTCCTGG - Intergenic
1107119539 13:36781468-36781490 TGGGCATCCAGGCTTTCTCATGG + Intergenic
1107841035 13:44458617-44458639 TGGGCATCCCTGTGCTCTCGGGG + Intronic
1109478776 13:62919820-62919842 TGGACATCCCTGTGCTCTCAGGG - Intergenic
1109683622 13:65784518-65784540 TGAGCATCCCTGCACTCTCAGGG - Intergenic
1110160619 13:72373909-72373931 TGGGCTCCTGAGCCCTCTCAGGG + Intergenic
1110308997 13:74024519-74024541 TGTGCATGCCTGCCCTCTCTCGG - Intronic
1110345318 13:74440569-74440591 AGAGCATCCTAGCCCTCTCTTGG - Intergenic
1110730892 13:78877318-78877340 TGAGCATTCCTGCACTCTCAGGG - Intergenic
1110777896 13:79432086-79432108 TGGGCATCTCTGCACTCTCGGGG + Intergenic
1111119154 13:83823608-83823630 TGGGCATCCCTCCACTCTCGGGG + Intergenic
1111354537 13:87080580-87080602 TGGGCATCCCTGCGCTCTCAGGG - Intergenic
1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG + Intergenic
1114665907 14:24376970-24376992 CGGGCATCCCTGGTCTCTCAGGG + Exonic
1116019201 14:39441054-39441076 TGGGCATCCCTGTGCTCTCTGGG + Intergenic
1116151351 14:41145711-41145733 TGGGCATCCCTGTGTTCTCAGGG - Intergenic
1116317075 14:43410731-43410753 TGGGCATCCCTGTACTCTCAGGG - Intergenic
1116961549 14:50973052-50973074 TGGGCATCCCTGCGCTCTTGGGG + Intergenic
1117930780 14:60838737-60838759 TGGGCATCCCTGCACTCTCGGGG + Intronic
1118038394 14:61892468-61892490 TCCTCACCCCAGCCCTCTCATGG + Intergenic
1119257275 14:73209117-73209139 TGGGCATCCCTGTGCTCTCAGGG - Intronic
1119759764 14:77141921-77141943 AGGGCGCCCCAGCCCGCTCAAGG - Intronic
1122120488 14:99550850-99550872 TGGGCACCCCAGGCCTGTTATGG - Intronic
1122381945 14:101314032-101314054 TGGGCACACCAGTCCTCTCGGGG - Intergenic
1123456055 15:20427323-20427345 CGTGCATCTCACCCCTCTCACGG + Intergenic
1123635515 15:22303514-22303536 CGTGCATCTCACCCCTCTCATGG - Intergenic
1124115806 15:26842485-26842507 AGGGCATGCCAGCCCACTCCTGG + Intronic
1124612379 15:31216766-31216788 TGGGCATCCCAGGCCCCTTGGGG + Intergenic
1124820753 15:33043929-33043951 TGGGCATCTCTGCACTCTCAGGG + Intronic
1124890416 15:33727013-33727035 TGAGCATGCCAACCCTCTGAGGG + Intronic
1126093606 15:45072448-45072470 TGGGCATCCCGGCTCACCCACGG - Intronic
1126143585 15:45456501-45456523 TGGAAATTCCAGCCCTCACAGGG - Intergenic
1127722819 15:61719521-61719543 TCAGCATCCCAGCACACTCAAGG + Intergenic
1127813241 15:62582598-62582620 TGGGCATCAAAGCCCTCTTAGGG + Intronic
1128684260 15:69671988-69672010 TGGTGATCCCACCCCTCTCCAGG - Intergenic
1128917096 15:71572980-71573002 GGGGCATCAAAGGCCTCTCAGGG - Intronic
1130625361 15:85508478-85508500 GGGGAATTCCAGCCCTCTGACGG + Intronic
1130872617 15:87983304-87983326 AGGGCATCCCACCCCAGTCAGGG + Intronic
1132908935 16:2298654-2298676 TGGGGTTCCGTGCCCTCTCATGG - Intronic
1133244833 16:4441330-4441352 TGGGCATCCCAGGTCTACCAAGG - Intronic
1134098242 16:11433815-11433837 TGGGCTTCCCCGCCCTCTCTGGG - Intronic
1134254481 16:12600376-12600398 CGGGCATCCCTGTGCTCTCAGGG + Intergenic
1136716293 16:32286424-32286446 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1136834679 16:33492702-33492724 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1137670555 16:50275902-50275924 TGGGTAGCCCAGCCCATTCATGG + Intronic
1137801528 16:51266372-51266394 TGGGCTCCCCAGCCCTCACTTGG - Intergenic
1139015402 16:62683947-62683969 TGGGTATCCCTGCACTTTCATGG + Intergenic
1139150874 16:64380992-64381014 TGGGCATCCCTGCACTCTTGGGG + Intergenic
1139286520 16:65819881-65819903 TAGGCATCCCAGCCTCCACAAGG + Intergenic
1139463730 16:67142696-67142718 CTGGCATCCCTGCACTCTCAGGG - Intronic
1139682853 16:68578993-68579015 TAGGCATCACAGCTCTCTCTTGG - Intergenic
1141172080 16:81697850-81697872 CGGCCACCCCAGGCCTCTCAGGG + Intronic
1141422643 16:83926574-83926596 TGGGCAGCCCACCCAGCTCAAGG - Exonic
1141429890 16:83966036-83966058 TGGTCATCTCTGTCCTCTCAGGG - Exonic
1203010124 16_KI270728v1_random:231330-231352 GGGGCATCCCTGCCCTCCCAGGG - Intergenic
1203144848 16_KI270728v1_random:1792990-1793012 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1143314658 17:6023181-6023203 TTGGCAGCTCAGCCCTCTCTGGG + Intronic
1143731581 17:8885442-8885464 TGGGTAACCCCGCCCTCCCATGG + Intronic
1143731702 17:8885721-8885743 TGGGTAACCCCGCCCTCCCATGG + Intronic
1143731717 17:8885754-8885776 TGGGTAACCCCGCCCTCCCATGG + Intronic
1143731732 17:8885787-8885809 TGGGTAACCCCGCCCTCCCATGG + Intronic
1143731801 17:8885951-8885973 TAGGTAACCCCGCCCTCTCATGG + Intronic
1143852930 17:9826140-9826162 TGGGCATCCCTGCCCCCTGGGGG + Exonic
1145900000 17:28484438-28484460 TGGCCATACCAGCCCTCTGTGGG - Intronic
1146372794 17:32275763-32275785 GAGGCAGCTCAGCCCTCTCATGG - Intronic
1149772192 17:59331321-59331343 TGGGAATCCCAGCCCTGCCCTGG + Intergenic
1150449936 17:65258328-65258350 TGGATGACCCAGCCCTCTCAAGG + Intergenic
1151099322 17:71538422-71538444 TGAGAATCCCAGACTTCTCAAGG - Intergenic
1151459074 17:74244014-74244036 TGGGCATCCCTGGCCGCTGATGG + Exonic
1151577094 17:74958351-74958373 TGGACATCCCAGTCTTCACAGGG - Exonic
1151718385 17:75842952-75842974 TGGGAAGCCCAGCCCCCTCAGGG - Intronic
1153472987 18:5467930-5467952 TGGGCATCCCTGCACTCTCAGGG + Intronic
1153723886 18:7936302-7936324 TGGGCATCTTTGCACTCTCAGGG + Intronic
1154357631 18:13633768-13633790 AGGGCATCCCTGTGCTCTCAGGG - Intronic
1155215657 18:23641297-23641319 TGGGCATCCCTGTGCTCTCTGGG + Intronic
1159696301 18:71560830-71560852 TGGGCATCCTTGCCCTTTCCTGG - Intergenic
1159704970 18:71675101-71675123 TGGGAATCCCTGCATTCTCAAGG - Intergenic
1160667851 19:341477-341499 TGGGGATCCCAGGCTGCTCAGGG - Intronic
1160901139 19:1429308-1429330 TGGCAATGCCAGCCCTCTCAGGG - Intronic
1161246650 19:3256284-3256306 TGCTCATCCCTGACCTCTCAGGG + Intronic
1161301245 19:3544130-3544152 TGGGCATCTCAGCCCTGCCCTGG - Intronic
1162574367 19:11490283-11490305 TGGGCTTCCATGCCCTCTCCGGG + Intronic
1163251007 19:16126292-16126314 TTGGCAGCACAGCCCTCTCAGGG - Intronic
1163593167 19:18205381-18205403 TGGGCGTCCCAGTACTCCCAGGG - Intergenic
1163613386 19:18312200-18312222 TGGGCATCCCGGACATCCCAGGG + Intronic
1164466339 19:28490463-28490485 TGTGCATAACAGCCCTCTCTGGG + Intergenic
1167647082 19:50711724-50711746 AGGACAGCCCATCCCTCTCAGGG + Intronic
925237175 2:2289996-2290018 TGGGGATCCCAGCCCTGCTATGG - Intronic
925515209 2:4674328-4674350 TGGGCATCTCTGCACTCTCGGGG + Intergenic
925732116 2:6926612-6926634 TGGGAATCCCAGTCCTGTCCTGG + Intronic
926800940 2:16660076-16660098 TCTGCATCCCAGCTCTCTCTTGG + Intronic
927175034 2:20399761-20399783 TGGGCATCTGAGACTTCTCAGGG + Intergenic
927679626 2:25131296-25131318 TGGGCTGCGCAGCCCTCTCCTGG - Intronic
928182795 2:29081160-29081182 CGGGCATCCCTGTACTCTCAGGG - Intergenic
928427854 2:31193381-31193403 TGGGCATCCCAGCCCTCTCATGG + Intronic
929757431 2:44779075-44779097 TGGGCCTCCCGGAGCTCTCAAGG - Intergenic
929847247 2:45542366-45542388 TGGGCATCCCTGCACTCTCAGGG - Intronic
933606615 2:84390204-84390226 TGGGCATCCCTGCACTCTTGGGG - Intergenic
935199486 2:100844026-100844048 TGGGCAGCCCGGCCCTATCAGGG - Intronic
936463481 2:112727706-112727728 TGGGCAACCCTGGCCTCTCTGGG - Intronic
937167693 2:119836648-119836670 TGGGCATCCCTGTGCTCTCGCGG + Intronic
937323156 2:120972963-120972985 TGGTCCCCCAAGCCCTCTCATGG + Intronic
937370929 2:121296678-121296700 GGGGCATCCCTGTACTCTCAGGG - Intergenic
937906931 2:127056981-127057003 TGGGCATTCCACGCCTCTTAGGG + Intronic
939801775 2:146720287-146720309 TGGGCATCCCTGTGCTCTCAGGG + Intergenic
940422922 2:153499856-153499878 CAGGCATCCCTGCACTCTCAGGG - Intergenic
940582715 2:155601404-155601426 TGGGCATCCCTGTCCTCTCAGGG - Intergenic
940711288 2:157165683-157165705 TGGGCATCCCTGCAATTTCAGGG - Intergenic
940957044 2:159739136-159739158 TGGGTATCCCTGTGCTCTCAGGG - Intronic
941130956 2:161650557-161650579 TGGGCATCCCGGCACTCTCGGGG + Intronic
946487377 2:220113945-220113967 TGGGCATGGCAGCACACTCAGGG - Intergenic
947801831 2:232933567-232933589 TTGGAATCCCATCCCTCTGAGGG + Intronic
948699369 2:239750662-239750684 TGGGCATCCAGGGCCTCTCCAGG - Intergenic
948795303 2:240399511-240399533 TGGCCTTCTCAGCCCCCTCAGGG - Intergenic
1168765984 20:381720-381742 AGGGCACCCCAGCCCTGTCCCGG - Intronic
1169309249 20:4521375-4521397 TGGGCATCCCTCCACTCTCAGGG + Intergenic
1171285914 20:23938010-23938032 TGGGCATCCCTGTGCTCTCAGGG + Intergenic
1171391310 20:24803255-24803277 TGGACATCCCAGCATTCCCATGG - Intergenic
1171465544 20:25325317-25325339 CGGGCCTCCCAGGCCTCTCAGGG - Intronic
1172092657 20:32445109-32445131 TGGGCCTCCCAGGCCCCTCCAGG - Exonic
1173093640 20:40002189-40002211 TGAGCCTCCCAGACCTCCCATGG - Intergenic
1175863328 20:62161658-62161680 GGGGCACCCCACCCCTCACAGGG + Intronic
1176231847 20:64036921-64036943 TCGGCTTCCTAGCCCTGTCAGGG - Intronic
1177410320 21:20721380-20721402 TGGGCTTCTCAGCCTCCTCATGG - Intergenic
1178947279 21:36959111-36959133 TGGGCATCCCTGCACTCTCAGGG + Intronic
1180057947 21:45368701-45368723 TGGACGTCCCAGCCAACTCAGGG - Intergenic
1180535023 22:16388678-16388700 TGGGCACCCAAGCCCTCCCTCGG + Intergenic
1182394944 22:30028516-30028538 TGGGCATCCCTCCCATCACATGG + Intronic
1183316762 22:37141333-37141355 CAGGCATCCCTGCACTCTCAGGG + Intronic
1183614723 22:38937036-38937058 AGGGTGTCCCAGCCCTCTCCAGG + Intergenic
1184156266 22:42669546-42669568 TGGGCCTTCCAGCCCAGTCAAGG - Intergenic
1184679775 22:46064273-46064295 AGAGCATCCCAGGCCTCTGAAGG + Intronic
1185182566 22:49371825-49371847 TGGGCATCCCAGCGCCCCCAAGG - Intergenic
1185203213 22:49521218-49521240 TGGGCTCCCCAGTCCTCACAAGG - Intronic
949331621 3:2929941-2929963 TGGGGATCCCTGCCCTGGCATGG - Intronic
949636611 3:5989289-5989311 TGAATATCCCAGACCTCTCAGGG + Intergenic
950377496 3:12583867-12583889 TCCGCATCTCAGCCCTCTCAGGG - Exonic
951698830 3:25473768-25473790 TGGGCTTCTCCTCCCTCTCAGGG + Intronic
952451459 3:33437726-33437748 TAGGCACTCCAACCCTCTCAGGG + Intronic
952959181 3:38579165-38579187 TGGGCATCCCTGTCCTGACAGGG - Intronic
954442485 3:50529461-50529483 GGGTCATCCCAGCTGTCTCAAGG + Intergenic
954647488 3:52140482-52140504 TGGGCTTCCCAGCACCATCAAGG + Intronic
955786589 3:62547198-62547220 TGTGGATCCCAGCCGTCCCATGG - Intronic
957156394 3:76550622-76550644 CAGGCATCCCTGCACTCTCAGGG + Intronic
957636254 3:82790317-82790339 TGGGCATCTCTGCACTCTCAGGG + Intergenic
957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG + Intergenic
958086642 3:88817333-88817355 TGAACATCCCAGCCATTTCAGGG - Intergenic
959235999 3:103722388-103722410 TGGGCTTCTGAGCCTTCTCAGGG + Intergenic
959476665 3:106820989-106821011 TGGGCATCCCTGTGCTCTCGGGG + Intergenic
962763929 3:138543516-138543538 TGGGCATCCCTGCGCTCTTATGG - Intronic
963424620 3:145110855-145110877 TGGTCATCCCAGAACTCTGATGG - Intergenic
964373248 3:156023621-156023643 TTGGCAGCCCAGTCATCTCAGGG + Intergenic
964927366 3:161975368-161975390 TGGGCATCCCTGCACTTTCAGGG - Intergenic
965367668 3:167820389-167820411 TGGGCATCTCTGCACTCTCCAGG + Intronic
967710712 3:192704377-192704399 TGGTCATCCAAGACTTCTCATGG - Intronic
969179134 4:5423974-5423996 TGGGCATCCCTGTGCTCTCAGGG + Intronic
969576806 4:8040789-8040811 GCTGCATCCCAGCCCTCCCAGGG - Intronic
973534622 4:51868187-51868209 CAGGCATCCCTGCACTCTCAAGG - Intronic
973760434 4:54109877-54109899 AGGGCGTCCCAGCCCACTGAGGG - Intronic
976647254 4:87399511-87399533 CGGGCATCTCTGCACTCTCAGGG + Intergenic
976734610 4:88296923-88296945 TGGGCATCCCTGTGCTCTTAGGG - Intergenic
978149457 4:105415567-105415589 TGGGCATCCCTGCACTCTCGGGG - Intronic
980450049 4:132958842-132958864 TAGGCATCTCTGCACTCTCAGGG + Intergenic
980480830 4:133385286-133385308 CGGGCATCCCTGCACTCTCAGGG + Intergenic
980744883 4:137000727-137000749 TGGGCATCTCTGCACTCTCAAGG + Intergenic
983885516 4:172975929-172975951 TGTGCATCCCTGCACTCTTAGGG - Intronic
984325092 4:178241623-178241645 CAGGCATCCCTGCACTCTCAGGG + Intergenic
984951973 4:185014751-185014773 TGGGCATCCCAGTCTCCTCGTGG + Intergenic
987365332 5:17143451-17143473 TAGGAACCCCAGCCCTCTAATGG - Intronic
987537622 5:19208636-19208658 TGGGCATCCCTGCCCTCTTGGGG + Intergenic
988109947 5:26807465-26807487 TAGGCATACCTGCCCTCTCAGGG + Intergenic
988218540 5:28310989-28311011 TGGGCATCCCTGCATTCTCAGGG + Intergenic
988482141 5:31639556-31639578 CGGGAATCCCAGCCCTGGCAGGG + Intronic
989537522 5:42581845-42581867 TGGGCATCCCCGTGCTCTCGGGG + Intronic
989730555 5:44642273-44642295 TGGGCATCCCTGCACTCTCAGGG - Intergenic
989821589 5:45800143-45800165 TGGGCATCCCTGTTCTCTCAGGG + Intergenic
990399946 5:55428213-55428235 GGGGCATCCCAGAATTCTCACGG - Intronic
990849644 5:60188323-60188345 TGGGCAACCCATCCCTCCTAGGG - Intronic
990956871 5:61350126-61350148 TGGATAACCCAGCCCTCTCAGGG - Intronic
991359409 5:65803620-65803642 TGGGCATCCCTGTACTCTTAGGG - Intronic
993211941 5:84962420-84962442 TGGGCCTCCCTGCACTCTCAGGG - Intergenic
993703445 5:91144096-91144118 TGGGCATCTCTGCACTCTCAAGG - Intronic
994068005 5:95565008-95565030 TGGGAATCTCAGCTATCTCAAGG + Intronic
994753322 5:103764755-103764777 CAAGCATCCCTGCCCTCTCAGGG - Intergenic
995871477 5:116748147-116748169 TGGGCCTCCCCTCCCTCCCAAGG + Intergenic
996176661 5:120368167-120368189 TGGGCATCCCTGTGCTCTCTGGG + Intergenic
998349182 5:141489890-141489912 GGGGGACCCCAGCCCGCTCAGGG + Exonic
998612044 5:143699855-143699877 TAGGCATGGCAGCCCTCCCAGGG + Intergenic
999125858 5:149245258-149245280 TGCGCATCACCTCCCTCTCATGG - Intronic
999367497 5:151032738-151032760 TAGGCATCCCAGCTCTCCCCTGG - Intronic
1003137023 6:3441590-3441612 TGGGCTTCCCTGCCCACTGACGG + Intronic
1003448253 6:6205067-6205089 TGGGCATCCCAGCTCAGTAAAGG + Intronic
1003551761 6:7107494-7107516 CGGGCAGCCCGGCCCTCCCATGG + Intergenic
1004304343 6:14487072-14487094 CGGGCATCCCTGTGCTCTCAAGG + Intergenic
1005421779 6:25658503-25658525 TGTGCATCCTAGCCATATCAAGG - Intronic
1006731410 6:36239064-36239086 TGTGCAGCCCAGGCCTCTCTTGG + Intergenic
1007369550 6:41417359-41417381 TGGCCATCCCACCCCTCTCCAGG + Intergenic
1007518078 6:42429332-42429354 AGGGCTTCCCAGACCTCGCAGGG - Intronic
1007702827 6:43774415-43774437 TGGGGTTCCCTGTCCTCTCAGGG + Intronic
1008351840 6:50500183-50500205 TTGGTATCCCTGCCCTCACATGG + Intergenic
1011822711 6:91271890-91271912 TGGGCATCCCTACACTTTCAGGG - Intergenic
1012122288 6:95384043-95384065 TGGGCATCTCTACACTCTCAGGG + Intergenic
1012133055 6:95519979-95520001 TGGGCATCCCCGCACTCTCGGGG - Intergenic
1014391576 6:120872009-120872031 TGAGCATTCCTGCACTCTCAGGG + Intergenic
1016841880 6:148533369-148533391 TGGCAATCCCGGCCCTGTCATGG - Intronic
1017587854 6:155946969-155946991 TGGACATTCCTGCACTCTCAGGG + Intergenic
1017715898 6:157212934-157212956 TGGGCATGACACCCATCTCAGGG + Intergenic
1018130900 6:160731807-160731829 TGGGCAGCCCAGTCCTGGCATGG - Exonic
1019179676 6:170178393-170178415 AGGGCAGCCCAGGCCTCTCTGGG + Intergenic
1019350309 7:551356-551378 TGGGCGTCCCCTCCCTCGCACGG - Intronic
1019634138 7:2066612-2066634 TGGCCACCCCGGCCCGCTCAGGG - Intronic
1021343219 7:19489527-19489549 TGGACATTCCTGCACTCTCAAGG - Intergenic
1021677566 7:23097010-23097032 TGGGCATCCCTGTGCTCTCAGGG + Intergenic
1021827765 7:24572601-24572623 TGGGCTTCCCAGACCTCAAAAGG - Intergenic
1027452360 7:78346838-78346860 TGTATATGCCAGCCCTCTCATGG - Intronic
1027682089 7:81233627-81233649 CGGGCATCCCTGTGCTCTCAGGG - Intergenic
1027729160 7:81847842-81847864 TGGGAAACCCATGCCTCTCAAGG - Intergenic
1027924745 7:84446966-84446988 CAGGCATCCCCGCACTCTCAAGG + Intronic
1028527503 7:91801766-91801788 TGGGCATCTCTGCACTCTCGGGG - Intronic
1029735880 7:102465445-102465467 GGGGCATCCTAGCCCCCTCTAGG - Intronic
1031248571 7:119350363-119350385 CGGGCATCCCTGCACTCTTAGGG + Intergenic
1031859005 7:126957458-126957480 TGGGCATCCCTGCTCTCTCAGGG + Intronic
1031922070 7:127609384-127609406 CAGGCATCCCTGCACTCTCAGGG - Intergenic
1032658417 7:133955963-133955985 TGGGCATCTCTGGACTCTCAGGG - Intronic
1033549496 7:142433867-142433889 GGGACATCCCTGTCCTCTCATGG - Intergenic
1034210500 7:149358583-149358605 TAGGCATCTCTGCACTCTCAGGG - Intergenic
1034252285 7:149701927-149701949 TAGGCATCCCTGCAGTCTCAGGG - Intergenic
1034449922 7:151131821-151131843 TGGGCATCCCAGGGCTGTCGTGG + Intronic
1034823069 7:154234892-154234914 CGGGGATCCCAGGCCTCCCAGGG - Intronic
1034998287 7:155592125-155592147 TTGGCCTCCCAGTTCTCTCATGG + Intergenic
1037724685 8:21473408-21473430 TGGACTTCCCAGACCTTTCAGGG + Intergenic
1041274311 8:56142068-56142090 TGGGCATCCCTGTACTCTCTGGG + Intergenic
1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG + Intronic
1042856522 8:73273269-73273291 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1043737838 8:83769223-83769245 CAGGCATCCCTGCACTCTCAGGG - Intergenic
1044525089 8:93242206-93242228 TGGGCATCCCTGTGCTCTCAGGG - Intergenic
1046665239 8:116995175-116995197 ATGGCATCACAGCCATCTCAGGG - Intronic
1046674770 8:117095071-117095093 TGGGCATCTCTGCACTCTTAGGG - Intronic
1046954566 8:120049710-120049732 TGGGCCTCCCAGCCCTCCAGTGG + Exonic
1047514768 8:125544636-125544658 TGGGCAGCCCAGGCCTCCCATGG + Intergenic
1048946199 8:139449941-139449963 TGGGTATTACAGCACTCTCATGG + Intergenic
1049022930 8:139970265-139970287 TGGGCGTCACAGCCCTCTGCTGG + Intronic
1049140393 8:140949450-140949472 TGGGCATCCCTGCGTTCTTAGGG + Intronic
1050589796 9:7149395-7149417 CGGGCATCCCTGTGCTCTCAGGG - Intergenic
1050941882 9:11471234-11471256 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1052708031 9:32016510-32016532 CAGGCATCCCTGCACTCTCAGGG - Intergenic
1052767676 9:32658259-32658281 TTGGTATCACAGCCATCTCATGG - Intergenic
1055463330 9:76539865-76539887 TGGGAATCCCAGCCCTTTTGAGG - Intergenic
1057955849 9:99407222-99407244 AGGGCATCCCAGGCCTTTCCAGG - Intergenic
1059277567 9:113109012-113109034 TGGGCATCGGTGCCCTCTCTGGG - Intergenic
1059278684 9:113115539-113115561 TGGGCATCGGTGCCCTCTCTGGG + Intergenic
1059343348 9:113612097-113612119 TGGGCATTCCAGGCCCCTCTTGG - Intergenic
1059811364 9:117858968-117858990 TCAGCATCCCTGCCCTATCATGG - Intergenic
1060927563 9:127465635-127465657 TGGCCAGCCCAGCCCTCACACGG - Intronic
1062065245 9:134523244-134523266 TGGGCATACCATTCATCTCAGGG + Intergenic
1062715366 9:138007583-138007605 TGGGCATCACAGTCCCCTGAGGG + Intronic
1186435983 X:9543509-9543531 GGGGCATCCCAGCCCACCCATGG + Intronic
1188434786 X:30148157-30148179 CGGGCATCCCTGCGCTCTCGGGG + Intergenic
1188727872 X:33607405-33607427 TGGGCAGCCCTGTACTCTCAGGG - Intergenic
1190360656 X:49645351-49645373 TGGGCATATCTGCACTCTCAGGG - Intergenic
1190488456 X:50955736-50955758 TAGCCATCCCAGCCCTCTTTTGG - Intergenic
1191008087 X:55732202-55732224 TGGGCCTCGGAGCCTTCTCAGGG - Intronic
1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG + Intergenic
1192319725 X:70080172-70080194 TGTACATCCCACCCCTTTCAAGG + Intergenic
1193417371 X:81240989-81241011 CAGGCATCCTTGCCCTCTCAGGG + Intronic
1194655688 X:96570531-96570553 TGGGCATCCCAGCACTGTCCAGG + Intergenic
1195709302 X:107761251-107761273 TGGGCTTCTCTGCCCTCACAAGG - Intronic
1197028390 X:121783083-121783105 TGGTGATGCCAGCCCTCTCTTGG + Intergenic
1197689564 X:129483281-129483303 TGGGAATCTTATCCCTCTCAGGG - Intronic
1198189383 X:134287672-134287694 TGGGCATCCCTGTGCTCTCAGGG + Intergenic
1200071197 X:153530331-153530353 TGGGCACCCCTCCCCACTCAGGG - Intronic