ID: 928428448

View in Genome Browser
Species Human (GRCh38)
Location 2:31198701-31198723
Sequence CTGGAGTACTTGGGAAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928428443_928428448 7 Left 928428443 2:31198671-31198693 CCAAGAAATTTGAAACAGAGTTA 0: 1
1: 0
2: 1
3: 33
4: 383
Right 928428448 2:31198701-31198723 CTGGAGTACTTGGGAAGAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928428448 Original CRISPR CTGGAGTACTTGGGAAGAGT TGG Intronic
901046506 1:6399332-6399354 TGGGAGTACTGGAGAAGAGTGGG - Intergenic
901475345 1:9485581-9485603 CTGGGGTTCATGGGAAAAGTTGG - Intergenic
903285974 1:22277068-22277090 CTTGACTACCTGGGAAGAGGGGG - Intergenic
903317074 1:22516387-22516409 CTGGAGTTCTGGGGAAAGGTGGG + Intronic
905014431 1:34767612-34767634 CTGAAGCACTTGGAAAGACTAGG - Intronic
905979634 1:42211882-42211904 CTGGAGTACTGGGGGTGAGGAGG + Intronic
907890471 1:58631853-58631875 CTGGAAGAATTTGGAAGAGTAGG + Intergenic
911345381 1:96690702-96690724 CTGGACTTCCTGGGTAGAGTGGG + Intergenic
912445940 1:109736738-109736760 CTGGAGTCCCTGTGAAGACTGGG - Exonic
912867607 1:113271952-113271974 TTTGGGGACTTGGGAAGAGTGGG - Intergenic
913462500 1:119102650-119102672 AAGGAATATTTGGGAAGAGTAGG - Intronic
915045585 1:153011719-153011741 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
915599815 1:156915009-156915031 CTGGAGGCCTTGGGAGCAGTGGG - Exonic
916069951 1:161164094-161164116 CTGGATTGATTGAGAAGAGTTGG + Intronic
916343185 1:163758952-163758974 CTGGAGAACTTGGCAAGCTTAGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917477230 1:175379206-175379228 CTGGAGGAGGTGTGAAGAGTGGG + Intronic
921875509 1:220191342-220191364 CTGAAGTACTCTGGAATAGTGGG + Intronic
923013053 1:230104315-230104337 CTGGGGTATTTGGGTAGAGAAGG + Intronic
923554163 1:234987556-234987578 CTGGCATATTTGGAAAGAGTAGG + Intergenic
923697445 1:236267556-236267578 CTGGACCACTTGTGAAGAGATGG + Intronic
923993904 1:239470288-239470310 CTGGAGTTCTCAGGGAGAGTTGG - Intronic
924577322 1:245292308-245292330 CTGGTGCACTGGGGAAGAGAGGG + Intronic
1063285730 10:4685743-4685765 CTGGACTACTTTGGAAGTGTTGG + Intergenic
1066407014 10:35127474-35127496 CTCGCGAACTTGGGACGAGTTGG + Exonic
1067188682 10:44051829-44051851 CTGGAGAAATGGGGGAGAGTGGG + Intergenic
1069775368 10:70924098-70924120 CTGACGTCCTTGGCAAGAGTGGG - Intergenic
1069809049 10:71145009-71145031 CAGGACTCCTGGGGAAGAGTTGG - Intergenic
1073322680 10:102625212-102625234 CTGGAGTCTGTGGGCAGAGTCGG + Intronic
1073585351 10:104704664-104704686 CTAGAGTACTAGGGAAAAATTGG - Intronic
1073771711 10:106742217-106742239 CTGAAGTACTTGGGACCAGAAGG + Intronic
1073818543 10:107234234-107234256 GTGGAGTAATAGGGAAAAGTAGG - Intergenic
1075567320 10:123514063-123514085 CTGGAGTCCTGGGGAAGGGGAGG + Intergenic
1076647618 10:131964019-131964041 CCCGAGCACTTGGGAAGTGTGGG + Intergenic
1077700928 11:4441785-4441807 TTTGGGGACTTGGGAAGAGTGGG + Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078507374 11:11962291-11962313 GTGGAGCACTTGGGGAGAGCTGG - Intergenic
1079301953 11:19286171-19286193 CTGGAGAAGTTGGACAGAGTGGG + Intergenic
1079398553 11:20086804-20086826 CTTGAGTACCTGGGATGAGTGGG + Intronic
1083721708 11:64606764-64606786 TTGGAGGGCTTGGGAAGAGAAGG + Exonic
1084649305 11:70479383-70479405 CTGGAGGCCTTGGGAAGGGGAGG + Intronic
1085718547 11:78893725-78893747 AGGGAGTGATTGGGAAGAGTGGG - Intronic
1086245485 11:84746946-84746968 ATGGGGTTCTTGGGAAAAGTTGG - Intronic
1087293342 11:96342167-96342189 CTGGAGAAGTTGGACAGAGTTGG + Exonic
1088196379 11:107278466-107278488 CAGGAATAAGTGGGAAGAGTTGG - Intergenic
1088579796 11:111303607-111303629 CTGAAGGACTTGGAAGGAGTGGG - Intronic
1088626159 11:111732118-111732140 ATGGAGAACTTGGGAAGTGCAGG - Intronic
1090615500 11:128510732-128510754 CTGGATTACTAGGGAAGGGGAGG - Intronic
1091585592 12:1814502-1814524 CTGGACTTCTTGGGTCGAGTGGG - Intronic
1092254518 12:6919011-6919033 CTGGAGCCCTTGGGAATACTGGG + Intronic
1092729265 12:11512967-11512989 GTGGAGAACTTGGGGAGAGTGGG + Intergenic
1093517746 12:20010430-20010452 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
1094399615 12:30047858-30047880 CTTGAGTACTGGGGGAGAGAGGG - Intergenic
1094724373 12:33098215-33098237 TTTGGGGACTTGGGAAGAGTAGG + Intergenic
1096904286 12:54919209-54919231 CTGAAGTGGTTGGGAAGAGGGGG + Intergenic
1097642490 12:62199154-62199176 CTGGAGTACTGGGGATAAGTAGG + Intronic
1099247063 12:80204866-80204888 CTGGAGCACTTGGCAGAAGTTGG + Intergenic
1100721922 12:97368394-97368416 CTGGCATAATTGGGAAGATTGGG + Intergenic
1102012221 12:109625776-109625798 CTGGTGTACTTGGCAAGGGCAGG - Intergenic
1102518831 12:113466763-113466785 CTGGTGTACTTGGCATGAGGTGG - Intronic
1107764563 13:43720430-43720452 CTTGGGCACCTGGGAAGAGTGGG - Intronic
1108515681 13:51200539-51200561 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
1108719968 13:53121014-53121036 TTAGTGTACTTGGGGAGAGTGGG + Intergenic
1108848277 13:54700388-54700410 CTGGACTACCTGGGTTGAGTGGG + Intergenic
1109585691 13:64399901-64399923 GGGGAGTACTTGGGAAGAAATGG - Intergenic
1111250496 13:85595062-85595084 CTGGACTTCCTGGGATGAGTGGG + Intergenic
1111826727 13:93276733-93276755 CGGGAGTACCTGGGATGTGTGGG + Intronic
1112445065 13:99456450-99456472 CAGGAGTACTGGGTAAGAGCTGG - Intergenic
1112553605 13:100446086-100446108 CTGGAGTGCTTTGGCACAGTCGG + Intronic
1112741566 13:102479361-102479383 CAGGAGTATTTGGCCAGAGTTGG + Intergenic
1116626592 14:47272591-47272613 CTGGAGTACTAGGGAAAAAGTGG - Intronic
1118444293 14:65837639-65837661 CAGGAGAAGTTGGGAAGAGTGGG + Intergenic
1118459239 14:65973752-65973774 CTGGTGCACTTGGGAACATTTGG + Intronic
1119462096 14:74814781-74814803 TTGAAGACCTTGGGAAGAGTCGG + Intronic
1121321536 14:92994452-92994474 GTGGAGTACTTGAGGAGTGTTGG - Intronic
1121672184 14:95719541-95719563 TTGGAGCACTTGGGAAGGGTTGG + Intergenic
1124211355 15:27767391-27767413 CTGGATTTCTTGGGTTGAGTGGG + Intronic
1125004886 15:34806524-34806546 CATTAGTACTTGGCAAGAGTAGG - Intergenic
1125073538 15:35585040-35585062 ATGGAGTAGTTGGGAAGACAGGG + Intergenic
1126613588 15:50553905-50553927 ATGGAAAACGTGGGAAGAGTTGG - Intronic
1127027297 15:54821013-54821035 CTGAAGAACTAGGGAAGAGCTGG - Intergenic
1127209799 15:56761813-56761835 CTGGAGACCTAGGGAAGGGTTGG - Intronic
1127301154 15:57655139-57655161 CTGGAGGACTTGGAAAGCGCTGG + Intronic
1127554172 15:60071178-60071200 CTGGACCTCTTGGGAAGGGTGGG + Intergenic
1130733294 15:86521841-86521863 GTGGAGGATTTGGGAGGAGTTGG + Intronic
1130925580 15:88383407-88383429 GTGCAGTAGCTGGGAAGAGTTGG - Intergenic
1131030704 15:89184020-89184042 CTGTAGTGCTTGGTTAGAGTCGG + Intronic
1131782265 15:95872329-95872351 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
1133730575 16:8575097-8575119 CTGGGTTACTTGGGAAGTGGTGG + Intronic
1134370520 16:13619943-13619965 CAGGAGCAATTGGGAAGATTAGG - Intergenic
1135254509 16:20930262-20930284 CTGGAGTCCTGGGGAAGAGATGG - Intergenic
1136774618 16:32865175-32865197 CTGGAGAAGATGGGAAGAGGAGG - Intergenic
1136895994 16:33996339-33996361 CTGGAGAAGATGGGAAGAGGAGG + Intergenic
1137665924 16:50248987-50249009 CTGCAGTATCTGGGAAGAGGAGG - Intronic
1141704323 16:85656320-85656342 CTGCAGCACATGGAAAGAGTTGG - Intronic
1203077045 16_KI270728v1_random:1127311-1127333 CTGGAGAAGATGGGAAGAGGAGG - Intergenic
1142929119 17:3267278-3267300 CTGGACTTCCTGGGTAGAGTGGG + Intergenic
1144623557 17:16833096-16833118 CTGGAGCACTTGGGGCCAGTGGG + Intergenic
1144834225 17:18148524-18148546 CTGGAGTACGGGGGAAGAGGTGG + Exonic
1146437247 17:32861659-32861681 CTAGAGTCTTTGGGCAGAGTGGG - Intronic
1147251589 17:39155690-39155712 CTGGTATATTTGGGAGGAGTGGG + Intergenic
1147254692 17:39174799-39174821 CTGCAGTACTGGGGAAGGGCTGG - Exonic
1147671235 17:42178059-42178081 CTGGAGGACTTGGGAGATGTTGG + Intronic
1148189920 17:45671414-45671436 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
1148984090 17:51606466-51606488 ATGGTGTACTTAGGAAAAGTGGG + Intergenic
1149922782 17:60675039-60675061 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
1151600806 17:75105025-75105047 CTGGGTCACTTGGGAAGAGCAGG - Intronic
1153336073 18:3926162-3926184 CTGAAGTAGTTGGGAAGACCTGG - Intronic
1153352975 18:4102174-4102196 CTGGAGTCCTTTAGAACAGTTGG - Intronic
1153378569 18:4410141-4410163 TTCGGGTACTTGGGAAGAGTGGG + Intronic
1153606289 18:6836597-6836619 ATGGAGGAATTGGGAGGAGTTGG + Intronic
1154952487 18:21223821-21223843 CAGGAATACTTGGGAAATGTGGG + Intergenic
1155576756 18:27256022-27256044 CTAGAGGAGTTGGGAAGAATGGG - Intergenic
1156459640 18:37314562-37314584 CTGCAGGACTTGGGGAGGGTAGG + Intronic
1156743344 18:40359600-40359622 CTGCAGGACTTGGCAAGAGGTGG - Intergenic
1159530316 18:69647634-69647656 GGGGAGTGCTTGGGCAGAGTGGG - Intronic
1160562284 18:79766209-79766231 CTCGAGATCTTTGGAAGAGTCGG + Intergenic
1161119900 19:2519780-2519802 CTGGAGACCCAGGGAAGAGTTGG - Intronic
1162140649 19:8583731-8583753 CTGTAGTCCTTGGGGAGACTTGG + Intronic
1164429321 19:28173083-28173105 CTGGAATGATTGGGAAGAGAGGG - Intergenic
1165071740 19:33259777-33259799 CTGGAGTTCTTGGGAGGTGGAGG - Intergenic
1166656879 19:44618661-44618683 CTGGAGTGATGGGGATGAGTGGG + Intronic
1166690105 19:44817377-44817399 CAGGAGGAATGGGGAAGAGTGGG + Intronic
1167703750 19:51066106-51066128 CTGGAGTACTTGGTATGGTTAGG - Intergenic
1168503836 19:56916265-56916287 CTGGGGAACTTGACAAGAGTAGG + Intergenic
1168571838 19:57477045-57477067 CTGGAGCATTTGGGAAAACTGGG - Intronic
925100518 2:1240655-1240677 ATGGAGGACTTGAGAAGAGCAGG + Intronic
925292141 2:2755109-2755131 CTGGGGGACTTTGGAAGAGAAGG + Intergenic
927808654 2:26169922-26169944 CTGGAGCTCCTGGGAAGAGGAGG + Intergenic
928428448 2:31198701-31198723 CTGGAGTACTTGGGAAGAGTTGG + Intronic
930762695 2:55052553-55052575 TTGGAGGGGTTGGGAAGAGTAGG + Intronic
934060801 2:88291039-88291061 CTGGACTTCTTGGGTGGAGTGGG + Intergenic
935712692 2:105913274-105913296 CTGGAGTCACTGGGAAGAGCTGG + Intergenic
936438736 2:112531550-112531572 CGGGGGTACAGGGGAAGAGTGGG - Exonic
937068729 2:119044586-119044608 TTTGGGGACTTGGGAAGAGTGGG - Intergenic
937100914 2:119267665-119267687 CTGGAGGACATGGGAAGAGATGG + Intergenic
938617460 2:133013929-133013951 TGGCAGTGCTTGGGAAGAGTTGG - Intronic
943436144 2:187867795-187867817 CTGTAGAACTTGGGAGGAGCTGG - Intergenic
943436358 2:187869312-187869334 CTGGAGACCTGGGGAAGAGCGGG - Intergenic
946461541 2:219873130-219873152 GAGGAGTAGATGGGAAGAGTGGG + Intergenic
947003098 2:225480231-225480253 CAGGTGTTATTGGGAAGAGTGGG + Intronic
948286601 2:236790737-236790759 CTGGAGGACTTGGCAAGGGCAGG + Intergenic
1168774270 20:434983-435005 CTGGAAAGCTTGGCAAGAGTAGG + Intergenic
1169392920 20:5204773-5204795 ATGGAAAACTTGGGAAGAGAAGG - Intergenic
1172934169 20:38607684-38607706 CTGGTCAATTTGGGAAGAGTCGG - Intronic
1174153519 20:48502361-48502383 CTGGAGATCCTGGGAAGAGCCGG - Intergenic
1174153594 20:48502817-48502839 CTGGAGATCCTGGGAAGAGCCGG - Intergenic
1178565155 21:33677233-33677255 CTGCAGTTCTTGGGAGAAGTAGG - Intronic
1180216291 21:46325242-46325264 CTGGGGTGCTGGGGAAGAGCGGG + Intronic
1181937010 22:26446205-26446227 CTTGAGTACATGGGAACAGAGGG - Intronic
1182934816 22:34210875-34210897 CTGGAGACCTTGGGAAGTGGAGG - Intergenic
1183359991 22:37378525-37378547 CTGGACTGTTTGGGAAGAGCTGG - Intronic
1184227848 22:43140457-43140479 CTCGAGTACTTGGGAGGATGAGG - Intronic
1184897615 22:47420689-47420711 CAGGAGTAATTGTGGAGAGTGGG - Intergenic
952042117 3:29273534-29273556 CTGGAGACCTGGGGAAGAGTTGG + Intergenic
952554714 3:34519382-34519404 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
952555414 3:34524563-34524585 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
954306193 3:49726704-49726726 CTGGGGAACAAGGGAAGAGTGGG + Exonic
954624931 3:52017204-52017226 CAGGAGTTCTTGGGTAGAGGCGG + Intergenic
954909132 3:54088174-54088196 CTGTCGTGCTTGGGAAGAATGGG - Intergenic
959613067 3:108316578-108316600 CTGGTGTACCTTGGAAGAGAAGG + Intronic
960411198 3:117327177-117327199 CTGGAGTAGTAGGGCAGAGGAGG - Intergenic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
964198624 3:154092320-154092342 ATGGAGAACCTGGGAAGAATGGG + Intergenic
968380978 4:95546-95568 CTGGAGTCCTTGGTCAGAGGAGG - Intergenic
970194791 4:13543192-13543214 CTGGAGTTCTTCGGAAGGGCGGG - Intronic
972669712 4:41203704-41203726 CTGGAGTACTGGGGAGAATTGGG - Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973290749 4:48468080-48468102 CTGGAGAGGTTGGGAGGAGTGGG - Intergenic
974127924 4:57718339-57718361 CTGGACTTCCTGGGTAGAGTGGG - Intergenic
974868695 4:67611734-67611756 CTGTAGTAATTAGGGAGAGTGGG - Intergenic
975052920 4:69888371-69888393 CTTGAGTGTTTGGGAAGAGAAGG - Intergenic
975855838 4:78623222-78623244 CTGGAGCCCCAGGGAAGAGTTGG - Intergenic
978346084 4:107771533-107771555 CTGGATTATATGGTAAGAGTAGG - Intergenic
979995919 4:127430804-127430826 TTTGGGGACTTGGGAAGAGTGGG + Intergenic
980111160 4:128638532-128638554 CTGAAGTACTGGGGGTGAGTTGG - Intergenic
981159732 4:141483676-141483698 CTGGACTTCTTGGGTTGAGTGGG + Intergenic
983499791 4:168485779-168485801 CTGAAGGACTAGGCAAGAGTGGG + Intronic
983667848 4:170202183-170202205 CTGGAGTCCTTGGGCAGGCTGGG - Intergenic
984026811 4:174552432-174552454 CTGGACTTCTTGGGTCGAGTAGG - Intergenic
985280308 4:188280000-188280022 GTAGAGTACTTGGGAAGTCTGGG + Intergenic
985506987 5:287089-287111 CTGGAGATCTGGGGAAGAGCTGG + Intronic
986744473 5:10731547-10731569 CTGGAGTAGTGGGGATGAGCAGG - Intronic
987786261 5:22503018-22503040 CTGTAGTAGTTGGAAAGAGTAGG - Intronic
988065270 5:26224144-26224166 CTGGAGATCCAGGGAAGAGTGGG - Intergenic
988065325 5:26224557-26224579 CTGGAGATCTGGGGAAGAGCTGG - Intergenic
988065594 5:26226584-26226606 CTGGAGACCTGGGGAGGAGTGGG - Intergenic
989591023 5:43113122-43113144 CTGGACTTCTTGGGTTGAGTGGG - Intronic
990519683 5:56566861-56566883 CAGGTGTTCTTGGGAAGAGCAGG - Intronic
991554084 5:67875963-67875985 CGAGAGTACAAGGGAAGAGTAGG - Intergenic
994219771 5:97182411-97182433 GTGAAGTCCTTGGAAAGAGTTGG - Intronic
994993372 5:107027642-107027664 CTGGAGTAGTTGTGATGACTTGG + Intergenic
995476442 5:112553027-112553049 CTGGAGTAGAAGGGAAGAGGAGG + Intergenic
996022157 5:118603284-118603306 CAGGAGTACAAGGGAAGAGAGGG - Intergenic
996275318 5:121659841-121659863 GTGTTGTACTTGGAAAGAGTTGG + Intergenic
997809640 5:136954528-136954550 TTTGAGGACTTGGGAAAAGTAGG + Intergenic
997832256 5:137160116-137160138 TTTGGGGACTTGGGAAGAGTGGG - Intronic
1001916721 5:175567694-175567716 CTGGCCTATTGGGGAAGAGTAGG - Intergenic
1002643474 5:180641416-180641438 CTGGGGTGCTTGGGAAGACGGGG + Intronic
1004342496 6:14819658-14819680 CTGGAGTAGAAGGGAAAAGTGGG - Intergenic
1004550142 6:16638944-16638966 CTGGACTTCTTGGGTCGAGTGGG + Intronic
1007112458 6:39320792-39320814 CTGGAGGGCGTGGGAAGGGTTGG - Intronic
1008110527 6:47487896-47487918 TTGGAGTAATTGGGTAGAGAGGG + Intronic
1008704302 6:54138812-54138834 CTGAATTACTTGAGAATAGTTGG - Intronic
1009465707 6:63966349-63966371 TGTGAGGACTTGGGAAGAGTGGG + Intronic
1010344691 6:74798317-74798339 CTGGAGTTCTGGGGAGGACTAGG + Intergenic
1010354458 6:74915147-74915169 CTTGAATACTTGGTAAGAGCTGG - Intergenic
1010569286 6:77458510-77458532 CAGGGGTACTTGGGAGAAGTTGG - Intergenic
1017009623 6:150054457-150054479 CTGGAGAACCGGGGACGAGTTGG - Intergenic
1017127810 6:151081925-151081947 CTGGAGGAGATGGGAAGAGGAGG - Intronic
1017261805 6:152396138-152396160 GTGGAGTCCCTGGGAAGAGAAGG + Intronic
1017776999 6:157688376-157688398 ATGGAGTCCCTGGGAAGAGGAGG + Intergenic
1019526059 7:1481034-1481056 CTGAAGTCCTTGGGAAGTGCTGG - Intronic
1019565506 7:1676823-1676845 TCGGAGCTCTTGGGAAGAGTTGG + Intergenic
1019602924 7:1894286-1894308 GAGGAGGACTTGGGAAGAGTCGG + Intronic
1019823570 7:3264627-3264649 ATGGAGTACCTGGGAAGGGAGGG + Intergenic
1020632151 7:10652266-10652288 CTGCAGGACTTAGGAAGACTAGG + Intergenic
1020706059 7:11545669-11545691 CTGGGGTCCATGGCAAGAGTGGG - Intronic
1021500240 7:21324650-21324672 CTGGAGAACTTGGGGATACTTGG + Intergenic
1021577167 7:22115317-22115339 CTGTAGAACTTGGGAAGGGCAGG + Intergenic
1023701811 7:42899455-42899477 TTTGGGGACTTGGGAAGAGTGGG + Intergenic
1026959428 7:74399008-74399030 CGGGAGAACTTGGGAAGCCTTGG + Intronic
1028646094 7:93098239-93098261 CTGGTGTTCTTTGGAAAAGTGGG + Intergenic
1029206618 7:98872902-98872924 CTGAAGGACTTGGGAGGAATTGG + Intergenic
1030309477 7:108054965-108054987 CTGAAGAACTTGGGAAGGTTTGG + Intronic
1030661761 7:112226583-112226605 CTTGAGTACTCTGGAACAGTAGG - Intronic
1031118054 7:117689708-117689730 CTGGTGTATTTGGGAAGAACAGG + Intronic
1031838563 7:126708800-126708822 CTGGAATACTTGGGAAACGAAGG + Intronic
1031852863 7:126886786-126886808 CTGTAGTACTTGGGAATTGAGGG - Intronic
1032237711 7:130139772-130139794 CTCCAGGACTTGGGAAGAGAAGG + Intergenic
1034993100 7:155560358-155560380 CTGGAGGAGTGGGGAAGAGGAGG + Intergenic
1038467828 8:27782078-27782100 CTGGAGTACTGGATTAGAGTTGG - Intronic
1040780288 8:51099033-51099055 CTGGAGTACATGTGCAGAATGGG - Intergenic
1040999029 8:53431465-53431487 CTGGAGTGCTTGGGAAAATGTGG - Intergenic
1042482790 8:69322958-69322980 CTGGAGACCTGGGGAGGAGTGGG + Intergenic
1042483100 8:69325148-69325170 CTGGAGATCCGGGGAAGAGTTGG + Intergenic
1042483234 8:69326007-69326029 CTGGAGATCCAGGGAAGAGTTGG + Intergenic
1042844009 8:73152160-73152182 CTCTAGCACTTGGGAAGAATTGG - Intergenic
1043197633 8:77317851-77317873 CTGGAGTAACTGGGGAGAGAAGG - Intergenic
1043833966 8:85024455-85024477 ATGGAGTACTTGAGAAAAATAGG + Intergenic
1044600495 8:93999067-93999089 CTGGACTTCCTGGGTAGAGTGGG + Intergenic
1045660619 8:104433792-104433814 CGTGACTACTTGGGAAGAGAGGG + Intronic
1045706353 8:104927344-104927366 CTGGGGAACTTGGGAAAAGAAGG + Intronic
1045894424 8:107196957-107196979 CTGGAGTACTTAGCTAGATTTGG - Intergenic
1046471700 8:114683411-114683433 CTGGGGGAATTTGGAAGAGTAGG - Intergenic
1047293290 8:123549141-123549163 CTGAAGTACTTGAGATGAGTGGG - Intergenic
1047869616 8:129068226-129068248 CTGGAGGACTTGAGGAGAGTAGG + Intergenic
1048481695 8:134801909-134801931 CAGCAGTACTTGGGAACTGTGGG + Intergenic
1049594306 8:143476423-143476445 GTGGAGTATTTGGCAGGAGTGGG - Intronic
1049996665 9:1041736-1041758 CTGGAGCACTTGTGAAGTTTTGG - Intergenic
1052567601 9:30176731-30176753 ATGGAGTAGTTGAGAACAGTAGG + Intergenic
1052967123 9:34348579-34348601 ATGGAGAACTTGGGAAGAACTGG - Intergenic
1053278292 9:36799656-36799678 CTGGAGTCCTTGAGGACAGTGGG + Intergenic
1054749522 9:68890304-68890326 CTGGACTATTTAGGAACAGTGGG - Intronic
1055345209 9:75328122-75328144 CTGGAGGAGTTGGGATCAGTTGG + Intergenic
1057337994 9:94172266-94172288 CTTGCGTACTGGGAAAGAGTGGG - Intergenic
1057860510 9:98637126-98637148 CTGGAGCACTTGGGCACAGGAGG - Intronic
1058613402 9:106799866-106799888 CTGGAGAAATTGGTAAGCGTCGG + Intergenic
1060817075 9:126640629-126640651 CTGGCCTCCTTGGGAAGGGTAGG + Intronic
1061596652 9:131634826-131634848 CTGGTGAAGTTGGGAAGAGGTGG + Intronic
1185697571 X:2206726-2206748 CTGGAGTATTTGGGAGGAGGTGG - Intergenic
1188281984 X:28281437-28281459 CTGGACAACTGGGGATGAGTGGG - Intergenic
1189679109 X:43496485-43496507 CTGGAGGACTGGAAAAGAGTGGG + Intergenic
1193591039 X:83389248-83389270 TTTGAGGACTTGGGAAGTGTGGG + Intergenic
1193726171 X:85041706-85041728 CTGGAGGCCTTGGGAATAGAGGG + Intronic
1196160476 X:112477184-112477206 CTGGAGGAACTGGGAAGAGTTGG + Intergenic
1198130240 X:133686877-133686899 CTGGACTGCTGGGGAAGAGATGG + Intronic
1199687830 X:150280239-150280261 CTGGAGGGCTGGGTAAGAGTAGG - Intergenic
1200569082 Y:4805230-4805252 CTGGACTTCCTGGGTAGAGTGGG + Intergenic