ID: 928428573

View in Genome Browser
Species Human (GRCh38)
Location 2:31199501-31199523
Sequence CTGGAGAATGGGCTGGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 1, 2: 5, 3: 70, 4: 590}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928428573_928428579 4 Left 928428573 2:31199501-31199523 CCTTCCACCAGCCCATTCTCCAG 0: 1
1: 1
2: 5
3: 70
4: 590
Right 928428579 2:31199528-31199550 TTCTCCTGCAGAGACAAGAGAGG 0: 1
1: 0
2: 2
3: 26
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928428573 Original CRISPR CTGGAGAATGGGCTGGTGGA AGG (reversed) Exonic
900123298 1:1058730-1058752 GGGGAGAATGGGCGGGTCGAGGG + Intergenic
900513961 1:3072675-3072697 CTGGGGAGGGGACTGGTGGACGG - Intronic
900624336 1:3601195-3601217 CTGGAGAGAGTGCTGGTGGCCGG - Intronic
900714915 1:4138056-4138078 CTCCAGAAAGTGCTGGTGGAAGG - Intergenic
901700122 1:11040843-11040865 TGGGAGAATGGGTGGGTGGATGG + Intronic
901830367 1:11888448-11888470 GTGGAGAAAGGGCTGGTGCAAGG - Intergenic
902045667 1:13522314-13522336 CTGCAGGATGGGCCGGGGGAGGG - Intergenic
902079606 1:13812134-13812156 GTGGAGAATGGATTGGTGGTGGG + Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902390499 1:16101742-16101764 CTGGAGGAGGGTCTGGTGGAGGG - Intergenic
902708437 1:18222413-18222435 CTGGAGAGTGGAATGCTGGAGGG + Intronic
902822178 1:18950108-18950130 TGGGAGAAAGGGCTGGGGGATGG + Intronic
902876212 1:19342379-19342401 CTGAAGCATGGGGGGGTGGACGG + Intronic
903165615 1:21518378-21518400 CTGAAAAATGGGCTGGTATAAGG - Intronic
903177677 1:21590425-21590447 CTGGAGAGTGGGGTGTTGGCGGG - Intergenic
903846184 1:26280928-26280950 GTGGGGTATGGGCTGGGGGACGG + Exonic
903878233 1:26490856-26490878 CTGGAGACTGGGGTGGAGGTTGG + Intergenic
904084586 1:27896004-27896026 CAGGAGAAGAGGCTGATGGAGGG - Intronic
904400204 1:30251696-30251718 CTGGTCCATGGGCTGGAGGAAGG + Intergenic
904487893 1:30839847-30839869 TAGGAGGATGGGCGGGTGGATGG + Intergenic
904551389 1:31322148-31322170 CTGGAGAATTGGTTGGTGTAGGG - Intronic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905274383 1:36807544-36807566 CTGGGGCATGGGCAGGGGGATGG + Intronic
905486506 1:38301090-38301112 ATGGAGAAGGGGCAGGTTGAAGG + Intergenic
905731040 1:40299766-40299788 AGGGAGGATGGGCTAGTGGAGGG + Intergenic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906940671 1:50252524-50252546 CTGGATAATGGGGAGGGGGAAGG + Intergenic
907274618 1:53310300-53310322 CTGGAGCATGGGATTGTGGCAGG - Intronic
907326895 1:53644153-53644175 CTGGTGATTGGGATGGTGGTAGG - Intronic
907338414 1:53715877-53715899 GTGGAGAATGGGGCGGTGGCAGG + Intronic
908266795 1:62387203-62387225 CTAGTGAGGGGGCTGGTGGATGG - Intergenic
910203491 1:84724259-84724281 CTGGGGTATGGGCTGGTAGATGG + Intergenic
910478536 1:87634228-87634250 CTGGGGAATGGGTGGGGGGAGGG + Intergenic
910576087 1:88765435-88765457 CTGGAGGATTGGCGGTTGGAGGG - Intronic
910639233 1:89441972-89441994 AGGGAGATTGGGATGGTGGAGGG - Intergenic
910671831 1:89781598-89781620 TTGGAGAATTGGTTGGTGGGAGG - Intronic
911406864 1:97452114-97452136 ATGGAGAATGGGCGGGAGTAGGG - Intronic
911506309 1:98756903-98756925 TTGGAGTTGGGGCTGGTGGAAGG + Intronic
911630525 1:100178832-100178854 CTGGAGGCAGGGATGGTGGAAGG - Intergenic
911664546 1:100538813-100538835 CAGAATAATGGGCTGGGGGAGGG - Intronic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911686056 1:100779110-100779132 CAGGAGAAAGGGGTGGTGAATGG - Intergenic
911696524 1:100895845-100895867 CTGCAGACTGGGCTGGGAGATGG - Exonic
912665822 1:111578679-111578701 CTGGAGAATTGCTTGGTGTACGG - Intronic
912698862 1:111861425-111861447 CCTGAGACTGGGCTGGGGGAGGG - Intronic
913466357 1:119147233-119147255 CTGGGGAAGGGGCTGGCGGAGGG - Intergenic
914838537 1:151228561-151228583 GTGGAAATTGGGCTGGTGAAGGG + Intronic
914952634 1:152130446-152130468 ATTGAGAATGGGTTGATGGAGGG + Intergenic
915102923 1:153513720-153513742 CTGGACAAGGGGCTGGTGGTTGG - Intergenic
915320296 1:155052458-155052480 CTTGTGAATGGGTTGGTGGGTGG + Intronic
915597202 1:156902452-156902474 CTGGAGATTTGGCTGCTGGAGGG + Intronic
916713994 1:167434908-167434930 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916713999 1:167434920-167434942 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714007 1:167434945-167434967 CCGGAGGAAGGGCTGGAGGAGGG - Intronic
916714016 1:167434970-167434992 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714021 1:167434982-167435004 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714029 1:167435007-167435029 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714034 1:167435019-167435041 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714042 1:167435044-167435066 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714047 1:167435056-167435078 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714055 1:167435081-167435103 CTGGAGGTAGGGCTGGAGGAGGG - Intronic
916714068 1:167435118-167435140 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714073 1:167435130-167435152 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714081 1:167435155-167435177 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714086 1:167435167-167435189 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714094 1:167435192-167435214 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714099 1:167435204-167435226 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714107 1:167435229-167435251 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714112 1:167435241-167435263 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714120 1:167435266-167435288 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714132 1:167435303-167435325 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714144 1:167435340-167435362 TTGGAGGAAGGGCTGGAGGAGGG - Intronic
917223920 1:172761572-172761594 CTGCAGAATGAACTGATGGAGGG + Intergenic
917418094 1:174832613-174832635 TGGGAGAAGGGGCTGCTGGAGGG - Intronic
917606041 1:176630549-176630571 ATGGAGAATGGGTTGGAGGGGGG + Intronic
918072605 1:181143983-181144005 CTGGGGAATGGGGTGAAGGAGGG - Intergenic
918263747 1:182820799-182820821 CTGGAGGTGGGGCTGGTGGGAGG - Intronic
919230306 1:194764830-194764852 CTGGAGAATAGGCATGGGGATGG - Intergenic
919746669 1:201013330-201013352 CGGGAGAAGAGGCTGCTGGAGGG - Intronic
919757036 1:201072723-201072745 CTGGAGACTGGACTGGAGCAGGG - Intronic
919807865 1:201391419-201391441 ATGGAAGATGGGCTGGTGGGAGG - Intronic
920675199 1:208033512-208033534 GAGGAGAAGGGGTTGGTGGAGGG + Intronic
921931643 1:220759458-220759480 TGGGAGACAGGGCTGGTGGAGGG + Intronic
922012117 1:221599394-221599416 TGGGAGAATGCGCTGGTAGAGGG - Intergenic
922239863 1:223748562-223748584 ACGGAGCATGGGCTGGTGGTGGG + Intronic
922885553 1:229017944-229017966 ATGGAGACTGGGCTGATGCAGGG + Intergenic
923339068 1:232992563-232992585 CAGGACAATGGGATGGTGCAAGG + Intronic
923759866 1:236832217-236832239 CAGCAGACTGGGCTGGTGGGAGG + Intronic
923785087 1:237058787-237058809 CTGGAGAAGGGGCGGGGGGCCGG + Intronic
1062933227 10:1366393-1366415 CTGGTGAATGTGCTTCTGGAAGG + Intronic
1064753497 10:18555140-18555162 ATGGAGAATGGAATGGAGGATGG + Intronic
1064756085 10:18572814-18572836 ATGGAGAATGGAATGGAGGATGG - Intronic
1066466982 10:35660522-35660544 CGGGAGAGTGGGCTGGTGGGAGG + Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067437280 10:46287129-46287151 CTGGTGAAAGGGCAGGAGGAGGG + Exonic
1068340760 10:55699318-55699340 TTGGAGAAGGGCCTAGTGGAAGG + Intergenic
1068474931 10:57512924-57512946 CTGGAAAATGGGCAGATAGACGG - Intergenic
1069688117 10:70332160-70332182 ACTGAGCATGGGCTGGTGGAAGG - Intronic
1069853154 10:71423578-71423600 CTGGAGAATGGGATGAGGGGAGG + Intronic
1070144277 10:73762376-73762398 CTTGAGTATGGGGTGGTGGAAGG + Intronic
1070286502 10:75087504-75087526 GGGAAGAATGGGCTGATGGAAGG + Intergenic
1070668107 10:78359546-78359568 CTTGAGAATGGGTTGTTGAAAGG + Intergenic
1070981556 10:80652538-80652560 CTGGAGAATTGGTTGTTGGTGGG - Intergenic
1070989064 10:80715509-80715531 CAGCAGAATTGGCTGGTGGGTGG - Intergenic
1071513634 10:86282812-86282834 GTGGAGAATGGGTTGGAGGCAGG - Intronic
1072246436 10:93547821-93547843 CAGGTGGATGGGTTGGTGGATGG + Intergenic
1072642559 10:97223135-97223157 TTGGGAAATGGGCTAGTGGAGGG - Exonic
1072919110 10:99560645-99560667 CGAGGGAATAGGCTGGTGGAGGG - Intergenic
1073139809 10:101239633-101239655 CTGGAGAATGGGGGCGGGGAGGG - Intergenic
1074678736 10:115881894-115881916 GTGGAAGATAGGCTGGTGGAGGG - Intronic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075911530 10:126129293-126129315 CTGGAGCATGAGCTCCTGGAGGG - Intronic
1076366359 10:129923022-129923044 CTATAGAATGGGCTGGGTGAGGG + Intronic
1076698368 10:132257738-132257760 CTGCAGAGGGGCCTGGTGGAGGG - Intronic
1076867617 10:133175775-133175797 GTGGAGGATGGGCTGATGGATGG + Intronic
1077345223 11:2045233-2045255 ATGGAGAATGGACTGGTGCATGG - Intergenic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1077537738 11:3132550-3132572 CTGGGGAATGGGGTGGCGGGAGG - Intronic
1077961971 11:7084975-7084997 CTGGAGAATTGGTTGGTGAGGGG + Intergenic
1078106537 11:8361473-8361495 CTGGAGAGTGAGCAGGTGGGTGG - Intergenic
1078137054 11:8660242-8660264 CTGGAGTATGGGATGCTTGAAGG - Intronic
1078153566 11:8779143-8779165 CAGGACAATGGAGTGGTGGAGGG + Intronic
1078325713 11:10379105-10379127 CTGGGGAATGTGGTGGTGGTAGG + Intronic
1078447692 11:11416897-11416919 CAGGAGCAAGGGCTGGGGGAGGG - Intronic
1078507687 11:11964874-11964896 TGGGAGAATGTGCTGGTGGGGGG + Intronic
1079084328 11:17434228-17434250 CTGGAGCAGGGGCTGAGGGATGG - Intronic
1079107122 11:17578710-17578732 CTGGAGTGTGGGCTGGAGGAGGG + Intronic
1079244749 11:18743955-18743977 CTGGAGAGAGGGTGGGTGGAGGG - Intronic
1079313452 11:19387429-19387451 CTGGAGCATGGGCTGGGAGGTGG + Intronic
1079858801 11:25641702-25641724 CTGGAGAATGGGCTGCAGGCAGG - Intergenic
1080313904 11:30926451-30926473 GTGGAAAATGGGCTGGAGGTGGG + Intronic
1080642820 11:34167622-34167644 CTGGAGATTAGGCTGGTAAAAGG + Intronic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1080871095 11:36237681-36237703 TTGCAGAAAGAGCTGGTGGAGGG + Intergenic
1081103049 11:39028958-39028980 CTGGAGCTTGAGCTGGTGCAGGG + Intergenic
1081376362 11:42363297-42363319 CTGGAGAATGGGGTAGAGAAGGG + Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081730438 11:45368425-45368447 CTGTAGAATGGGTGGGTGAATGG - Intergenic
1082955246 11:58863673-58863695 CTGGGGAATGGCCTGGAGGTTGG + Intronic
1084525967 11:69698173-69698195 GTGGGGAAGGGGCTGGTGGGGGG - Intergenic
1084672322 11:70614667-70614689 CTGGAGGATGGGATGAAGGAAGG - Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1086392030 11:86375060-86375082 GTGGAGAAGGGGCTGGAGGGTGG + Exonic
1086959620 11:92969267-92969289 CTGGAGAAGGTGCTGATGGTAGG - Intergenic
1087638325 11:100728035-100728057 TTGGAGAATTGGTTGGTGAAAGG + Intronic
1089386026 11:118068613-118068635 CTGGGGAATGAGCTGGGGCAAGG + Intergenic
1089535134 11:119156409-119156431 CTTGGCACTGGGCTGGTGGATGG - Exonic
1089542785 11:119200379-119200401 CAGGAGAAGGAGGTGGTGGAGGG - Intergenic
1089671182 11:120058031-120058053 CTGAAGATTGGGCTGAAGGAGGG - Intergenic
1089717491 11:120375957-120375979 CTGGAGTATGGGTTGTTGGAAGG + Intronic
1089767610 11:120779325-120779347 CTGGAGAAAGGGCAGCTGGTGGG + Intronic
1089772785 11:120815419-120815441 CTGGAGGCTGGGCTGGACGATGG - Exonic
1089831138 11:121329216-121329238 ACAGAGAATGGGCTGGTGGGAGG - Intergenic
1090275704 11:125417858-125417880 ATGGAAGATGGGGTGGTGGATGG - Intronic
1090381960 11:126333657-126333679 CTGGGGCTTGGGCTGCTGGAGGG + Intronic
1090408144 11:126489687-126489709 CCTGAGAAAGGGGTGGTGGAAGG - Intronic
1090417336 11:126549588-126549610 CTGGGGAGAGGGCTGGGGGAGGG + Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090957206 11:131524152-131524174 CTGGTGACTGGGCTGGTCTAGGG + Intronic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1091227491 11:133966291-133966313 CGGGACAATGAGCTGATGGAAGG + Intergenic
1091397633 12:163419-163441 CTGGAAAATGGGCGCGTGGGTGG + Intronic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1092194724 12:6542335-6542357 CTGCAGAATGGGCCCGGGGAGGG - Intronic
1092547024 12:9461122-9461144 CTGGATAATCCTCTGGTGGAGGG + Intergenic
1092817118 12:12322132-12322154 CAGGAGAATGGGGAGATGGATGG - Intergenic
1093253116 12:16832731-16832753 ATGGAGAATGGGCCAATGGATGG + Intergenic
1094097663 12:26725891-26725913 ATGGAGAGTTGGCTGGAGGACGG - Intronic
1094505914 12:31060950-31060972 CTGGATAATCCTCTGGTGGAGGG - Intergenic
1095539508 12:43292332-43292354 GTTGTGAATGGGGTGGTGGAGGG + Intergenic
1095690594 12:45084255-45084277 CTGGGGGGTGGGGTGGTGGAGGG - Intergenic
1096143848 12:49264757-49264779 CTGGAGAATGGGCCGGGACAGGG - Intronic
1096826327 12:54280900-54280922 CTGTAGAATGGGCTGGTGCAAGG - Intronic
1097486205 12:60204980-60205002 CTGGAGCATTGGCTGTGGGAAGG + Intergenic
1097711569 12:62923236-62923258 CTCAAGAATGGACTGATGGATGG + Intronic
1098614780 12:72508769-72508791 TTGGAGGAGGGCCTGGTGGAAGG + Intronic
1099528136 12:83741106-83741128 CTGGAGTATGGGCGGGGGGTGGG - Intergenic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1100602138 12:96121004-96121026 GTGGAGACTGGGCTGGGGGTAGG + Intergenic
1100794258 12:98163965-98163987 GTGGAGAATTGGTTGGTGTAAGG - Intergenic
1102143643 12:110637634-110637656 AAGGAGACTGGGCAGGTGGAGGG - Intronic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102407522 12:112686645-112686667 CTGGGGAATTGGCTGGTGGCTGG - Intronic
1102571625 12:113830412-113830434 CTGGAGAGTGGGTCGGTGGGTGG + Intronic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1103099155 12:118157256-118157278 ATGGAGAATGGCCTGGGAGATGG - Intronic
1103131640 12:118474157-118474179 GTGGAGAGTGGGTTGGAGGAGGG - Intergenic
1103150926 12:118637846-118637868 CTGGAAAATGGGCCTGTGGATGG - Intergenic
1103292668 12:119859920-119859942 CTGGAGAATGAGGTGGGTGAGGG - Intronic
1103413062 12:120726150-120726172 CTGGGAACTGGGCTGGTGGCTGG - Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1104399215 12:128461828-128461850 CTGGAGAATGGAGTTCTGGAAGG - Intronic
1104567640 12:129899456-129899478 CTGGTGGATGGACTGGTGGATGG + Intronic
1104803200 12:131568720-131568742 CTGAAGAATGGACAGATGGATGG - Intergenic
1104861715 12:131927597-131927619 CTGGAGCCTGGGCTGGTGGAGGG + Intergenic
1104874973 12:132027330-132027352 CTGTGGAGTGTGCTGGTGGAGGG + Intronic
1104984212 12:132587487-132587509 CTGGAGGGTGGGCAGCTGGAGGG + Intergenic
1105446590 13:20462241-20462263 CAGGAGGATGGCCTGGTGGGAGG + Intronic
1106442107 13:29784675-29784697 ATGGAGAATGGCCAGCTGGAAGG + Intronic
1106873190 13:34043898-34043920 TTGGGGGATGGGGTGGTGGAGGG - Intergenic
1108568846 13:51729520-51729542 GAGAAGAATGGGCTGGAGGAAGG - Intronic
1109142023 13:58725296-58725318 ATGGAGAAGGAGCTGGTGGCAGG + Intergenic
1109483322 13:62985534-62985556 CTGGGGAAGAGGCTTGTGGATGG - Intergenic
1110401380 13:75095903-75095925 CTGGAGGGTGGGCTGGTATAGGG + Intergenic
1110560588 13:76907440-76907462 CTGTAGAAAGGGCTGGTAAATGG - Intergenic
1111707894 13:91774482-91774504 GTGAAGGATGGGCTGGTGCAGGG + Intronic
1113098839 13:106695448-106695470 CTGGAGAATGGGATGATAGAGGG + Intergenic
1113219404 13:108082362-108082384 TTGGAGAAATGGCTGATGGAGGG + Intergenic
1113446240 13:110369824-110369846 CTGGACAGGGGGCTGGTGGGTGG - Intronic
1113499838 13:110764484-110764506 TTGGAGTAGGGCCTGGTGGAAGG + Intergenic
1113571881 13:111363693-111363715 CTGGAGCCTGGGCTGGAGGCAGG - Intergenic
1113976401 13:114231074-114231096 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1113976435 13:114231188-114231210 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1113976469 13:114231302-114231324 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1113976487 13:114231359-114231381 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1113976521 13:114231473-114231495 CTGGAGGTGGGGCTGGTGGGAGG + Intergenic
1114080730 14:19200086-19200108 CTGGACAATGTGCTGTAGGAAGG - Intergenic
1114549878 14:23526554-23526576 CTGGAGATGGGGCTGGAGAAGGG + Exonic
1114553329 14:23546875-23546897 CTAAAGAAGGGGCTGGTGGGCGG - Intronic
1115078121 14:29415635-29415657 CTGCAGAAGTGGGTGGTGGATGG + Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115746561 14:36443821-36443843 CTGGAAAATGGGCTGCTTGCTGG - Intergenic
1116422719 14:44751762-44751784 TTGGAGATGGGGCTGGTGGGAGG + Intergenic
1116755812 14:48946657-48946679 CAGGAGGATGGGCAGGAGGAGGG - Intergenic
1117458762 14:55924091-55924113 CTTCAGAATAGGCTGTTGGATGG - Intergenic
1118087166 14:62431222-62431244 CTGGAGACAGTTCTGGTGGAAGG + Intergenic
1118302658 14:64629033-64629055 CTGGAGACAGGGGTGGGGGAGGG + Intergenic
1118636527 14:67753248-67753270 CTGGAGCAGGGGCTGGAGCAGGG - Intronic
1119431360 14:74570095-74570117 TTGGAGGAGGGGCTGGAGGAAGG + Intronic
1119575628 14:75719017-75719039 GTGGAGAGTGGGATGGTGGTAGG + Intronic
1119771466 14:77222668-77222690 CCTGGGAAAGGGCTGGTGGAGGG - Intronic
1120465240 14:84848325-84848347 CCGGTGAATGGGCTGTTGCATGG + Intergenic
1120570861 14:86115440-86115462 CAGGAGAGGGGTCTGGTGGAAGG + Intergenic
1121083099 14:91124534-91124556 CTGAAGAAAGTGCTGGTGGAAGG + Intronic
1121325432 14:93016920-93016942 CTGGAGATGGGGCAGGAGGAGGG + Intronic
1121486891 14:94323218-94323240 CTGGAGGCTGGGCAGGGGGAGGG + Intronic
1122097912 14:99384809-99384831 CTGGAGCGGGGGCTGGGGGAGGG - Intergenic
1122414417 14:101542030-101542052 CTGGAGGCTGAGCGGGTGGAGGG - Intergenic
1123118999 14:105908420-105908442 GGGGAGAAAGGGCTGGAGGAGGG + Intergenic
1123987002 15:25654935-25654957 CAGGAGAATTGCTTGGTGGAAGG - Intergenic
1124383776 15:29189315-29189337 CTGGAGAATGGTTTGGTGTATGG + Intronic
1125421858 15:39512004-39512026 ATCGAGGATGAGCTGGTGGAGGG - Intergenic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1127774216 15:62253000-62253022 CTGGGGACTGGGCTGGGGGAAGG - Intergenic
1128160778 15:65421903-65421925 CTGGAGAAAGGGCTGGGGAGGGG - Intronic
1128185319 15:65639659-65639681 GTGGAGCATGAGCTGGTAGATGG - Exonic
1128325261 15:66719906-66719928 CTGGGGAGGGGGGTGGTGGAGGG + Intronic
1129088060 15:73118259-73118281 GTGGAGACTGGACTGGAGGAGGG - Intronic
1129525054 15:76208531-76208553 CTGTGGGATGGGCTGGAGGAAGG - Intronic
1129590436 15:76910050-76910072 CTGGAGGATAGGGTGGTTGAGGG - Intergenic
1129697578 15:77749377-77749399 CTGGAGATGGGGCTGGTGGGAGG - Intronic
1129977780 15:79836830-79836852 ATGGAGGATGGCCTGGAGGATGG + Intronic
1129977783 15:79836842-79836864 CTGGAGGATGGCCTGGAGTATGG + Intronic
1130042423 15:80415982-80416004 GTGGAGAGTGGGCAGGGGGAAGG - Intronic
1130175942 15:81570919-81570941 CTGAAGAATGGGTTGCAGGAGGG - Intergenic
1130803441 15:87292010-87292032 TTGGAGAATTGGCCGCTGGATGG - Intergenic
1131248715 15:90817420-90817442 CTGGAAGATGAGCTGGAGGAAGG - Intergenic
1132153789 15:99480904-99480926 AGGGAGAAGGGGCTGCTGGAAGG - Intergenic
1133916341 16:10112892-10112914 GTGGAGGATGAGGTGGTGGAGGG + Intronic
1134224697 16:12381286-12381308 ATGGATAATGGGTGGGTGGATGG - Intronic
1134663818 16:16003851-16003873 TTGGTGAATGGGTAGGTGGATGG + Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135407862 16:22210964-22210986 ATGGAAAATGGGCTGCTGGACGG + Intronic
1135597859 16:23756925-23756947 GTGGAGAATGGTGTGGAGGATGG + Intronic
1136071337 16:27789300-27789322 ATGGATAATGGGCAGATGGAGGG + Exonic
1136071350 16:27789368-27789390 ATGGATAATGGGCAGATGGAGGG + Exonic
1136123465 16:28157876-28157898 CAGGAGAATGGTCAGGTGAAAGG - Intronic
1136376864 16:29871086-29871108 CTGGAGAGAGGGCTGGGGAAAGG - Intergenic
1136543556 16:30942558-30942580 CTGGAGAATGGGCTGGGCAAGGG + Intronic
1137893561 16:52186959-52186981 CTGGAGAATCGGCTTCAGGATGG - Intergenic
1138277998 16:55750207-55750229 CTGGGGAATTGTCTGGTGGTGGG + Intergenic
1138283992 16:55794053-55794075 CTGGGGAATTGTCTGGTGGTGGG + Intergenic
1138285010 16:55802934-55802956 CTGGGGAATTGTCTGGTGGTGGG - Exonic
1138454061 16:57111024-57111046 TTGGAGTGTGGGCTGGTGGCAGG + Intronic
1138866029 16:60820819-60820841 CTGAAGAATGGGGTGATAGATGG - Intergenic
1139666506 16:68460627-68460649 CAGTGGAATGGGCTGATGGAAGG - Intergenic
1140170414 16:72598736-72598758 CTGGAGAATGGGAGGAGGGAGGG + Intergenic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140484164 16:75280876-75280898 ATGGAGAATTGGTTGGTGGTGGG - Intergenic
1140516003 16:75542388-75542410 CTGGACCATGGGATGCTGGAGGG + Intronic
1140545664 16:75806216-75806238 CTGGAGAATCGGTTGGTGTGGGG + Intergenic
1140728521 16:77835431-77835453 CTGGACCATGGGATGATGGATGG - Intronic
1140913830 16:79477292-79477314 CTGGAGCATGGGTTTGAGGATGG + Intergenic
1140955517 16:79861449-79861471 CTGAAGACTGGACTGGTGGGAGG - Intergenic
1141159086 16:81617288-81617310 CTGGAGAATGGCCTGGAGCTGGG + Intronic
1141212727 16:81996225-81996247 GTGGAGAATGGACTGAAGGAAGG + Exonic
1141612037 16:85187304-85187326 CGGGAGCCTTGGCTGGTGGAAGG + Intergenic
1141629081 16:85277080-85277102 CTGGGGAAGGAGCTGGGGGAGGG + Intergenic
1141641892 16:85346396-85346418 ATGGATGATGGGCGGGTGGATGG + Intergenic
1141641992 16:85346833-85346855 ATGGATGATGGGCAGGTGGATGG + Intergenic
1142010898 16:87713560-87713582 GTGGAGCATGGGCGGGGGGATGG - Intronic
1142128638 16:88422334-88422356 TGGGTGAATGGGCAGGTGGATGG + Intergenic
1142140409 16:88470257-88470279 CTGGGGACAGGGCTGCTGGACGG + Intronic
1142198675 16:88750833-88750855 GTGGATAGTGGGCTGGAGGATGG - Intronic
1142601099 17:1053335-1053357 TTCGAGAAGGGGCTGGGGGAGGG + Intronic
1143090941 17:4448873-4448895 CTGGAGAATGTGATGCTGGATGG + Intronic
1143390610 17:6557070-6557092 CTGGAGCGGGGGCTGATGGAGGG - Intergenic
1143686760 17:8523628-8523650 CTGCAGAATGGCCTGGGGAAGGG + Intronic
1144085714 17:11806929-11806951 CTGGAGGAGAGGCTGATGGAGGG + Intronic
1144201172 17:12943890-12943912 CTGGAGGAGGGGGTGGGGGATGG - Intronic
1144914768 17:18715322-18715344 CTTGAGCAGGGGGTGGTGGATGG - Intronic
1145018114 17:19411947-19411969 CTGTAGCATGGGGTTGTGGAGGG + Intronic
1145304605 17:21666428-21666450 TTGGACTATGGGCTGCTGGATGG + Intergenic
1145752850 17:27367626-27367648 CTGGGGCCTGGGCTGGTGAAAGG + Intergenic
1146568673 17:33934914-33934936 GTGGAGAATGGGGTGGCAGAGGG - Intronic
1146584213 17:34068440-34068462 CTGCAGAATGGGCTGTTGGAAGG - Intronic
1146909535 17:36639661-36639683 CTGGAGGATTGGGTGGTGGGTGG + Intergenic
1147187236 17:38719601-38719623 CTGGAGGAGGGGCTGGGGGCAGG + Intronic
1147249234 17:39143354-39143376 CTGGGGAGTGGGCTGGGGGAAGG - Intronic
1147381125 17:40056875-40056897 CTAGAGAAAGGGCTGCTGGTGGG - Intronic
1148336666 17:46846684-46846706 CTGGATAAAGGGCTGGAGAATGG + Intronic
1148343899 17:46890717-46890739 TTGGAGCTTGGGCTGTTGGAAGG - Intergenic
1148382391 17:47209488-47209510 CTGGGGCAGGGGCTGGTGCAGGG - Exonic
1148512688 17:48186222-48186244 TTGGAGAGTGGGCTGGGGGTTGG + Intronic
1148803835 17:50253358-50253380 ATGGAGAAATGGCTGGTTGACGG + Intergenic
1149549817 17:57531993-57532015 GTGGAGGATGGTCTGTTGGAAGG + Intronic
1149626629 17:58084256-58084278 CTGGAGGATGGGATAGTGGAGGG + Intronic
1151013722 17:70531015-70531037 CTGGAGGGTGGGGGGGTGGAGGG + Intergenic
1151230265 17:72679690-72679712 GTGGAGGATGGCCTGGTGGGAGG + Intronic
1151829370 17:76540580-76540602 CAGGAGTCTGGGCTGGGGGAGGG + Intronic
1152262415 17:79274221-79274243 CTGGAGACTGGGATGGGGGTTGG + Intronic
1152665729 17:81568155-81568177 GTGGAGAGTGGGCTGCGGGAGGG + Intronic
1153299111 18:3577169-3577191 CTGGTGCATGGGCTGTTGAAAGG - Intronic
1153544013 18:6186999-6187021 ATGGAGACGGGGCAGGTGGAGGG + Intronic
1153893305 18:9537806-9537828 CAGCAGCATGGGCTTGTGGAAGG - Exonic
1154148277 18:11884799-11884821 CTGGAGCCTGGGCTGGTCGGGGG - Exonic
1155671433 18:28376647-28376669 CTGCATAATGGGCTGGAGGGTGG - Intergenic
1156020477 18:32594460-32594482 CTTGACAATGGGATGGAGGATGG + Intergenic
1156451683 18:37270047-37270069 CTGGAGAATGGGCTGCTATCAGG - Intronic
1156480821 18:37435306-37435328 CTGGGGAATGGGCTGCAGGCTGG - Intronic
1156779800 18:40837714-40837736 CAGGACAACTGGCTGGTGGAGGG - Intergenic
1156883153 18:42104438-42104460 CTGGAGAATGAATTGGAGGAAGG - Intergenic
1157078264 18:44492526-44492548 GTGGAGAATGGGCTGGAGGGTGG + Intergenic
1157091588 18:44643242-44643264 CTGGGGAAGGTGCTGATGGAAGG + Intergenic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157299918 18:46472151-46472173 CGGGTGAATGGGTGGGTGGATGG - Intergenic
1157322727 18:46646895-46646917 CTGGAGGATGGCCTGGGGGAAGG - Intronic
1157381384 18:47221489-47221511 CTGGAGAGTGGTTTGGTGGCTGG - Intronic
1157518152 18:48325791-48325813 GTGAAGAAAGGGCTTGTGGAGGG + Intronic
1157620028 18:49011596-49011618 CTGGAAAATGCGCCAGTGGAGGG + Intergenic
1157723662 18:49945725-49945747 GAGCAGAATGGGCTGGTGGAGGG + Intronic
1158140028 18:54245723-54245745 CTGGAGAAGGGGTTGGAGGCAGG - Intergenic
1158395673 18:57077103-57077125 CTGGAGAGTGAGCTGCTGCAGGG + Intergenic
1158655354 18:59325831-59325853 ATGGAGAATGGATTGGAGGAAGG - Intergenic
1159687260 18:71438163-71438185 ATGGAGAATGGACTGGAGGGTGG + Intergenic
1160297281 18:77650255-77650277 ATGGAGGATGGGTGGGTGGAAGG - Intergenic
1160319247 18:77875062-77875084 GTGGAGGCTGGGCGGGTGGATGG - Intergenic
1160429584 18:78802224-78802246 CAGGAGAAAGGGATGGGGGAGGG + Intergenic
1160542271 18:79630587-79630609 CTGTAGAATGGAGTGGTCGATGG - Intergenic
1160563889 18:79775052-79775074 CTGGGGAGAGGGTTGGTGGAAGG + Intergenic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1161329173 19:3678267-3678289 ATGGAGAATGGAGGGGTGGAGGG + Intronic
1161679616 19:5673415-5673437 TGGGTGAATGCGCTGGTGGATGG - Intergenic
1161772501 19:6238721-6238743 CTGGAGAAGGCCCTGGCGGAGGG - Intronic
1161850524 19:6735862-6735884 CGGGAGAAGGGGCTGGAGGGAGG - Intronic
1162028541 19:7907636-7907658 CTGGAGCATGGGGGGATGGAAGG - Intronic
1162138505 19:8571037-8571059 CAGGAGGAAGGGCTGGAGGAGGG + Intronic
1162145970 19:8612076-8612098 CTGGAGTAGGGGGTGGAGGAGGG + Intergenic
1162180891 19:8867927-8867949 CAGGTGAATGGGCAGGAGGATGG + Intronic
1162470691 19:10870942-10870964 CTGGGGAATGGGCGGGGGAAAGG - Intergenic
1162508879 19:11105152-11105174 CTATAGAATGGGCTGGTGTTGGG + Intronic
1162573966 19:11487882-11487904 GTGGGCAATGGGCTGGTGGCTGG - Exonic
1163242652 19:16073755-16073777 CTGGAGGATGGGGTGGAGGCTGG - Intronic
1163273289 19:16266971-16266993 CTGGAGGAAGGGATGCTGGAAGG + Intergenic
1164518074 19:28953437-28953459 CTGAAGAACTGCCTGGTGGATGG + Intergenic
1164706505 19:30324021-30324043 ATGGAGGATGGGTGGGTGGATGG - Intronic
1164840073 19:31386673-31386695 CTGGCCACTTGGCTGGTGGATGG - Intergenic
1165080899 19:33305459-33305481 CTGGAGAGTGGGGTGAGGGAGGG + Intergenic
1165352726 19:35284927-35284949 CTGGAACATGGGCTGTGGGAAGG - Exonic
1165485648 19:36093973-36093995 CAGGCAAATGGGCTGGTGGTGGG - Intronic
1166617842 19:44267109-44267131 GTGGAGAATGGACTGGAGGGAGG - Intronic
1167148289 19:47695146-47695168 AGGGAGAATGGGCTGGGGCAGGG + Intronic
1168078257 19:53992035-53992057 CTGGAAAAGGGGCCGGTGGCCGG - Intergenic
1168561034 19:57383513-57383535 CAGAAGAATGGGATGGTGGGGGG - Intronic
925260198 2:2522054-2522076 ATGGGGGATGGGCAGGTGGATGG - Intergenic
926722476 2:15971460-15971482 CTGCAGAGGGGGCTGGTGGGGGG + Intergenic
927274488 2:21250960-21250982 CTGGAGAGTGAGCTGGAGGAAGG + Intergenic
927921067 2:26971951-26971973 CTGCAAGATGGGCAGGTGGAGGG - Intronic
927927401 2:27023589-27023611 CTGGAGAGTCGGGAGGTGGAGGG - Intronic
928015843 2:27656363-27656385 CTGGAGGATGGGTTGGTGGGGGG - Intronic
928325992 2:30319965-30319987 CTGGAAATGGGGCTGGTAGATGG - Intronic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
929542240 2:42831280-42831302 CTGGGGAAGGGGCTGGTGGTGGG + Intergenic
929556410 2:42928327-42928349 AAGCAGAATGGGCTGGGGGAGGG - Intergenic
929576540 2:43056090-43056112 CTGCATCATGGGCTGGTGAAGGG + Intergenic
931196092 2:60053615-60053637 GAGGAGAAAGTGCTGGTGGAGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933599734 2:84317282-84317304 CTGGAGAAAGGACTGGTGAAGGG + Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
935831445 2:107004963-107004985 CTGAAGGATGGGCTGAGGGAGGG + Intergenic
936327617 2:111519301-111519323 CTAGAGAAACTGCTGGTGGAGGG - Intergenic
936703141 2:115038120-115038142 CTGGATATTTGCCTGGTGGAGGG + Intronic
937127138 2:119482104-119482126 CTGGAGACTGGTCAGGTGGGTGG - Intronic
937299544 2:120830672-120830694 CTGGAGAATGTGCAGGTGGCTGG + Intronic
938748442 2:134304347-134304369 CTGGATACTGGGATGGTGAATGG + Intronic
939129679 2:138219764-138219786 GCAGAGAATGGGCTGATGGAGGG + Intergenic
941080880 2:161059275-161059297 CTGGAGGTTGGGATGGTAGATGG - Intergenic
941616494 2:167726367-167726389 CTGGACAAGGGGCAGGTGGGCGG - Intergenic
942224541 2:173803837-173803859 TTGGAGGAGGGGCTGGTGGGAGG + Intergenic
942333279 2:174851635-174851657 CTGGAAAATGGGATGGGGAACGG + Intronic
944143259 2:196479690-196479712 CTGGAGAGGTTGCTGGTGGAGGG - Intronic
946009666 2:216554614-216554636 CTAGGAGATGGGCTGGTGGAGGG + Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
947206779 2:227667986-227668008 ATGGAGAAAGGGCAGGTGGCAGG - Intergenic
947590275 2:231381342-231381364 GTGGAGGATGGGGTGGAGGATGG - Intergenic
948722725 2:239911738-239911760 CTGGGGGATGGGCTGGGGGAAGG - Intronic
948892049 2:240912205-240912227 GTGGAGAATTGGCTGGTGTCAGG - Intergenic
948922430 2:241071973-241071995 CTGGAGACTGCGCTGGCGGTGGG - Intronic
1169153501 20:3308973-3308995 CTGGAGATGGGGCTTTTGGAAGG - Intronic
1169258637 20:4119153-4119175 ATGGAGAATGGGTTGGAGAAGGG + Intergenic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1170214412 20:13876576-13876598 CTGCAGAGTAGCCTGGTGGAGGG - Intronic
1171396337 20:24836223-24836245 GTGGAGGGTGGGCAGGTGGAGGG - Intergenic
1171522116 20:25783867-25783889 TTGGACTATGGGCTGCTGGATGG + Intronic
1171529867 20:25845812-25845834 TTGGACTATGGGCTGCTGGATGG + Intronic
1171554711 20:26072016-26072038 TTGGACTATGGGCTGCTGGATGG - Intergenic
1172287178 20:33749032-33749054 CTGGGGCATGGGCTGGTCCAGGG - Exonic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG + Intronic
1174054427 20:47788223-47788245 CTGGGGCCTGGGGTGGTGGAGGG + Intergenic
1175743049 20:61434189-61434211 CTGGATAATGGCCCAGTGGAGGG + Intronic
1176520400 21:7819871-7819893 GTGGAGATTGGAGTGGTGGATGG - Intronic
1176655924 21:9588859-9588881 TTGGACTATGGGCTGCTGGATGG + Intergenic
1177196820 21:17912094-17912116 CTGGAGACTGGGGTGGGGGCTGG - Intronic
1178581856 21:33844863-33844885 CTAGAGAATGGGATGGAGGGAGG - Intronic
1178654423 21:34449883-34449905 GTGGAGATTGGAGTGGTGGATGG - Intergenic
1179027017 21:37687186-37687208 CTGGAAAATTGGCTGCTGGAAGG + Intronic
1179035286 21:37754107-37754129 CTGGAGAATGAGCTGGCAGGTGG - Intronic
1179106319 21:38403804-38403826 CTGGAGGCTGTGCTTGTGGAAGG - Intronic
1179167487 21:38946042-38946064 CTGAGGACTGGGCTCGTGGACGG - Intergenic
1179678454 21:43000908-43000930 TTGGAGAATGGACTGGAAGAGGG + Intronic
1180136851 21:45867535-45867557 AAGGAGAACTGGCTGGTGGAAGG - Intronic
1180716978 22:17878392-17878414 GTGGAGACTGGGCTGGAGGTGGG - Intronic
1180927871 22:19568543-19568565 AAGGAGAGTGGGCTGGGGGATGG + Intergenic
1181042637 22:20199502-20199524 CAGGTGGATGGGCAGGTGGATGG - Intergenic
1181062204 22:20286895-20286917 CTAGAGAATGTGCTGTTGGTAGG + Intergenic
1181536687 22:23549968-23549990 TGGGAGAATGGGTGGGTGGATGG - Intergenic
1181822689 22:25487860-25487882 TGGGTGGATGGGCTGGTGGATGG + Intergenic
1181845308 22:25702970-25702992 GTGGAGAATCTGCTGGTGCACGG + Intronic
1181875334 22:25936054-25936076 CTGGACACTGGGCTCCTGGAGGG - Intronic
1182060661 22:27394849-27394871 CTGGATACTGGGTAGGTGGATGG + Intergenic
1182099703 22:27649254-27649276 CGGGTGAGTGGGCGGGTGGATGG + Intergenic
1182752045 22:32649587-32649609 CGGAAGAATGGGGTGGTGGGAGG + Intronic
1182893521 22:33839380-33839402 TTGGAGATGGGGCTGGTGGAAGG - Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183057344 22:35315110-35315132 GTGGAGAATGGGTGGGAGGAGGG + Intronic
1183235475 22:36613840-36613862 TTGGGAAATGGGCTGGAGGAAGG - Intronic
1183315275 22:37133640-37133662 GTGGAGCGTGGCCTGGTGGAGGG - Intronic
1184259594 22:43307034-43307056 GTGGAGGATGGGCGGGTGGCAGG - Intronic
1184846599 22:47091476-47091498 CTGGGGAGTGGCCTCGTGGAGGG + Intronic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
1185229255 22:49670858-49670880 CTGGAGCACTGGCTGGTTGAGGG + Intergenic
1185380361 22:50505016-50505038 CTGGGGGATGGGCTGGGGGCAGG - Intronic
1185411155 22:50683754-50683776 GTGGAGAGGGGGGTGGTGGAGGG + Intergenic
1185411169 22:50683782-50683804 GTGGAGAGGGGGGTGGTGGAGGG + Intergenic
950203393 3:11060574-11060596 ATGGAGAATGGCTTGGAGGAAGG + Intergenic
950830866 3:15874783-15874805 GTTGATAATGGGCTGGTGCAGGG + Intergenic
952210149 3:31222273-31222295 CTGGAGAATATGGTGGCGGATGG - Intergenic
953390777 3:42532484-42532506 CTGGAGCAGGGGATGGTGGTGGG - Intronic
953404197 3:42652567-42652589 CTGCAGAAAGGGCTGGAGGTTGG - Intergenic
953553646 3:43924700-43924722 CTGGAGAATTGTTTGGTGTAGGG - Intergenic
954036878 3:47855592-47855614 CTGTGGCATGGGGTGGTGGAAGG - Intronic
954706650 3:52484576-52484598 CTGGGCAATGGGCTGGTGCTCGG - Exonic
954869717 3:53758519-53758541 CTGGACAGTGGGCTCCTGGAAGG - Intronic
955866253 3:63387807-63387829 CGGGAGAATTGGGTGGCGGAGGG + Intronic
955867444 3:63400023-63400045 CTGCAGAATGGGCTGGGGACTGG - Intronic
958474091 3:94558458-94558480 CTGGAGAAGAGGGTGGTAGAAGG + Intergenic
959369261 3:105503544-105503566 CTGGAGAAGGGACTCGGGGAAGG - Intronic
960541561 3:118867456-118867478 TTGGGAAATGGGGTGGTGGAGGG + Intergenic
961672152 3:128541220-128541242 ATGGATAATGGGCTGGGTGAGGG + Intergenic
961990959 3:131190341-131190363 TTGGAGGTTGGGCTGGTGGGAGG + Intronic
962031610 3:131606740-131606762 CTGCAGAATTGGCTGCTGGCTGG + Intronic
962929345 3:140022675-140022697 GTGGAGAATGGGATGGAGGTGGG + Intronic
963907066 3:150781544-150781566 ATGGAGAATGGGTTGGAGGTGGG + Intergenic
964846473 3:161049616-161049638 CTGTAGAATGGGATAGGGGATGG + Intronic
965236237 3:166127263-166127285 TTGGAGGTTGGGCTGGTGGAAGG - Intergenic
966348135 3:179001332-179001354 TCGGAGAATTGGCTGCTGGATGG - Intergenic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967636284 3:191805897-191805919 TTGGAGGATGGCCTGGTGGGAGG - Intergenic
967913452 3:194560434-194560456 CTGGAGAATGGGCAGGTGGGTGG - Intergenic
967913863 3:194563692-194563714 CTGGAGAATGAGCAGGTGCGTGG - Intergenic
967963388 3:194942443-194942465 CTGGGCAGTGAGCTGGTGGAGGG - Intergenic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968808249 4:2788601-2788623 CAGGAGGCTGGGCTGGTGGCAGG - Intergenic
968914037 4:3489420-3489442 CTGGTGAGTGGGCAGGTGGCAGG + Intronic
969240873 4:5896458-5896480 TTGGAGGATGGGTTGGGGGATGG - Intergenic
969599374 4:8166921-8166943 ATGGTGAATGGGTGGGTGGATGG - Intergenic
970027341 4:11637338-11637360 GTGGGGAAGGTGCTGGTGGAAGG - Intergenic
970547660 4:17146146-17146168 TTTGAGAATGAGCTGGTTGAAGG + Intergenic
970824111 4:20252766-20252788 CTGGAGAATGGCTCGGTGGCAGG - Intergenic
971225950 4:24751757-24751779 CTGGAGAATGAGTTGGTGTTAGG - Intergenic
971294868 4:25379089-25379111 CTGGAAAGAGGGGTGGTGGATGG + Intronic
972199454 4:36696609-36696631 GTGGAAAATGGACTGGAGGAAGG - Intergenic
973083201 4:46021676-46021698 CTGGAGAATTGTCTGGTGTGTGG - Intergenic
973545241 4:51974293-51974315 CTGGGGAATGGGATGGTTGTAGG - Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976334473 4:83869725-83869747 GTGAAGAATGGACTGGTGGGAGG - Intergenic
976353481 4:84086965-84086987 CTGGAGCATGGGCTTTTGGCAGG + Intergenic
977289713 4:95151319-95151341 CTGGTGGATGGACTGATGGATGG - Intronic
978214063 4:106176322-106176344 AAGAAGAATGGGCTGGGGGATGG - Intronic
979428178 4:120593840-120593862 TTGGAGGAGGGGCTGGTGGGAGG - Intergenic
980870325 4:138603826-138603848 AAGGAGAATGTTCTGGTGGAAGG - Intergenic
980992925 4:139753938-139753960 CTGGAGACTGGGGTGGAGGGAGG + Intronic
981261957 4:142731124-142731146 CAGGGGAATGGGGTGGGGGAAGG - Intronic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986470282 5:8066939-8066961 TTGGAGAAGGTGCTGGTGGTGGG + Intergenic
986536387 5:8792434-8792456 TTGGAGATGGGGCTGATGGAAGG + Intergenic
986583230 5:9287107-9287129 CTGGAGGAAGTGCAGGTGGACGG - Intronic
988864939 5:35324440-35324462 CTGGTGCATGGGTTGGTGCATGG - Intergenic
989471957 5:41830283-41830305 CTTCAGAAAGGGTTGGTGGAAGG + Intronic
990557870 5:56952638-56952660 TGGGAGAAGAGGCTGGTGGATGG + Intronic
991931359 5:71756069-71756091 CTCAAGAAGTGGCTGGTGGATGG - Intergenic
992412265 5:76517776-76517798 CTGGAAAATGAGCTGTTGTAAGG + Intronic
994729638 5:103476723-103476745 CTGGGGAAGGGGGTGGTGGGGGG - Intergenic
996396056 5:123015201-123015223 CTGTTGAATGGGTGGGTGGATGG + Intronic
996994401 5:129677759-129677781 GTGGAAAATGGGCTGGTGTAGGG - Intronic
997085881 5:130797964-130797986 TTGGATAATGGGTTAGTGGAAGG - Intergenic
997358774 5:133281146-133281168 AAGGAGGTTGGGCTGGTGGAAGG - Intronic
998041158 5:138951751-138951773 CTGGAGGCTGGGCAGGAGGAAGG + Intronic
998416882 5:141952544-141952566 CTGGAGAATGGAGTAGGGGATGG + Intronic
998523148 5:142818423-142818445 CAGGAGACAGGGCTGCTGGAGGG + Intronic
999187518 5:149723364-149723386 CTGGAGACTGGGGGGGTTGAGGG - Intergenic
999279367 5:150354869-150354891 CAGGAGAGTGGGCTTATGGAAGG - Intergenic
1001562341 5:172677827-172677849 CTGGTGAGGGGGCTGATGGAGGG - Intronic
1001641908 5:173250291-173250313 CTTGAGTTTGGGCTGGTGGGTGG + Intergenic
1001817366 5:174681199-174681221 AAGGAGAATGGGTTGCTGGAAGG - Intergenic
1002212974 5:177609310-177609332 CTAGAGAAGGGGCTGTTTGAGGG - Intronic
1002613033 5:180433764-180433786 CTGGAGAAACGCCTGGAGGAAGG - Intergenic
1003315340 6:5006533-5006555 GTGGAGAATGGACTGTGGGAGGG - Intergenic
1003482387 6:6545917-6545939 CTGGAGAAGGAGCTTGGGGATGG - Intergenic
1004458403 6:15813106-15813128 ATGGATGATGGGCAGGTGGACGG + Intergenic
1004685878 6:17943142-17943164 CTTGAGAATGGTCTGCTGAATGG + Intronic
1004791959 6:19036437-19036459 CTAGAGAAAGGGCTTTTGGAAGG + Intergenic
1004924237 6:20402990-20403012 ATGGAGAAGGGGGTGGGGGAGGG + Intronic
1005399371 6:25415851-25415873 ATGGAGAAGGGGCTGGGGAATGG + Intronic
1005440304 6:25860403-25860425 CTGCAGACTGTACTGGTGGATGG - Intronic
1006399668 6:33809863-33809885 CTCCAGAGTGGGCTGGTTGAAGG - Intergenic
1006437326 6:34032839-34032861 CTGGGGAGTGGGCTGCTGGCAGG + Intronic
1006511136 6:34521813-34521835 CTGTAAAATGGGCTGTTGCAAGG - Intronic
1007712982 6:43836360-43836382 CTGGAGAGTGGGGAGGAGGAAGG + Intergenic
1007767763 6:44171052-44171074 AGGGACAATGGGCTGGAGGAGGG + Intronic
1010023911 6:71193699-71193721 CTGGAGAATCGGTTGTTGTATGG + Intergenic
1010327174 6:74577851-74577873 CAGGTGAATGGCCTGGAGGAAGG + Intergenic
1013206172 6:107947861-107947883 GTGGAGAATGGTTTGGTGGGTGG - Intronic
1013301420 6:108808474-108808496 CTGGAGAAGGGGGTGGTGCATGG - Intergenic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1015506649 6:133995311-133995333 CTGGAGAATGTGCCGGAGAAGGG + Intronic
1015731008 6:136348321-136348343 AGGTAGAATGGGCAGGTGGAGGG - Intronic
1016423213 6:143906925-143906947 CTGGAGAATGGGGGGAAGGAGGG - Intronic
1016437663 6:144054199-144054221 CTGAAGAATGGACTGTTGTAGGG - Intronic
1016572792 6:145533538-145533560 CTGGAGCATGGGGTAGGGGATGG - Intronic
1017006080 6:150028875-150028897 CTGGAGAAAGAGCAGGTGGGTGG + Intergenic
1018207115 6:161446095-161446117 CTGGAGCATGGGGTGGTGGTGGG + Intronic
1019033997 6:169039493-169039515 CTGGAGACTTGGAGGGTGGAAGG + Intergenic
1019897438 7:3993682-3993704 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
1021526862 7:21597694-21597716 TGGGAGAGTGGCCTGGTGGAAGG - Intronic
1021777968 7:24072469-24072491 CTGGCAGATGGGCTGGGGGAAGG + Intergenic
1021892379 7:25198481-25198503 CTGGAGAGTGGGCTGTGGGTGGG - Intergenic
1021975265 7:26006340-26006362 ATGAAGGATGGGCTGATGGATGG + Intergenic
1022113956 7:27246930-27246952 CATGACAAGGGGCTGGTGGATGG + Intronic
1022864906 7:34407191-34407213 CTTGAGATGGGGCTGTTGGAGGG + Intergenic
1023526174 7:41106268-41106290 CTGGAGAAGGGGCGGTGGGAGGG - Intergenic
1024655569 7:51448706-51448728 GTGGAGAATGGATTGGAGGAAGG - Intergenic
1025302112 7:57826375-57826397 TTGGACTATGGGCTGCTGGATGG - Intergenic
1025761865 7:64403198-64403220 CTGGAGAATGGGCATGGGAATGG + Intergenic
1025917706 7:65879007-65879029 CGGGAGAACTGTCTGGTGGAAGG - Intronic
1026903639 7:74050469-74050491 CGGAAGAATGGGCAGATGGATGG - Intronic
1027220956 7:76213629-76213651 CTGTAGGATGGGCTGAAGGATGG + Intronic
1027525058 7:79258432-79258454 GTGGAGAATGGCCTGGTTGAAGG - Intronic
1027528608 7:79301794-79301816 CTGGAATAGGGCCTGGTGGAAGG + Intronic
1027752972 7:82174571-82174593 CTAAAGAATGGTCTTGTGGAAGG - Intronic
1028242995 7:88443919-88443941 CTGGAGAATTGGTTGGTGTGAGG + Intergenic
1028456156 7:91040151-91040173 CTGCAGACAGGGCAGGTGGAAGG - Intronic
1028766506 7:94565602-94565624 TGGGAGAATGTCCTGGTGGAGGG - Intergenic
1032542503 7:132715036-132715058 CAGGAGAAAGGGCTGGGGGTGGG - Intronic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1033153547 7:138937133-138937155 CTGGGGCATGGGCTGGTTGTAGG - Intronic
1033809482 7:144994340-144994362 GTGGAGAATGAGCTGGTAGATGG - Intergenic
1034699523 7:153084097-153084119 CTGGAGATGGGGCTGGTGGGAGG - Intergenic
1034759427 7:153657462-153657484 CAGGTGTATGGGCTGGTGCAAGG + Intergenic
1035367481 7:158358345-158358367 CAGAAGGATGGGCTGGAGGAGGG + Intronic
1035559757 8:595449-595471 CTGGAGTTTGTGCTGGTGGCAGG - Intergenic
1035679337 8:1476722-1476744 CTGCAGAACGGGCTAGTGGGTGG - Intergenic
1035679349 8:1476774-1476796 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1035679362 8:1476826-1476848 CTGCAGAAGGGGCTGGTGGGTGG - Intergenic
1036059615 8:5301375-5301397 TTGGAGAAAGAGGTGGTGGAGGG + Intergenic
1036642056 8:10590917-10590939 GGGGAGAAGGGGCTGGTGTAAGG - Intergenic
1037033908 8:14142699-14142721 CTGGAGATGGGCCTGGTGGGAGG + Intronic
1037683101 8:21115146-21115168 CCGGAGAATGGGGTGGGAGAAGG - Intergenic
1038284697 8:26196501-26196523 CTGGAGATGGGGCGGGAGGAGGG - Intergenic
1038612521 8:29069355-29069377 CTGGCGGCTGGGCTGGTGCAGGG - Exonic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1039844178 8:41314093-41314115 CTGGAAACTAGGCTGGTGGGGGG - Intergenic
1040533301 8:48283342-48283364 CTGGTGACTGGGGTGGTGTAGGG + Intergenic
1041248710 8:55914068-55914090 ATGGAGAATGGAGAGGTGGAGGG + Intronic
1041450719 8:58004030-58004052 CTGGGGGATGGGGTGGGGGAGGG + Intronic
1041483933 8:58353410-58353432 TTGGAGAGCGGGCTGGTGAAAGG - Intergenic
1042146990 8:65740339-65740361 GTGGAGAATGAGGGGGTGGATGG - Intronic
1043510731 8:80947751-80947773 GTGGAGATTGGGCTGGTGGTGGG + Intergenic
1044492367 8:92834608-92834630 GTGGAGAAGGGACAGGTGGAGGG - Intergenic
1044946724 8:97396490-97396512 ATGGAGACTGGGTGGGTGGAGGG + Intergenic
1045482574 8:102603914-102603936 CTGGAGGATGGGTTGGAGGTTGG - Intergenic
1045493920 8:102692142-102692164 TTGGAGAATGGGCTGATTAAAGG - Intergenic
1047473426 8:125201912-125201934 CGGGGGAATGGGGTGGGGGACGG - Intronic
1047974189 8:130113059-130113081 GTGGAGAATGGACTGGAGGAAGG - Intronic
1049008357 8:139871957-139871979 CTGGTGGATAAGCTGGTGGATGG + Intronic
1049008502 8:139872549-139872571 CGGATGGATGGGCTGGTGGATGG + Intronic
1049249099 8:141578646-141578668 CTTCAGAATGGGCTGGTGGAAGG - Intergenic
1049420411 8:142513935-142513957 CTACAGAATGGACTGGTGGGAGG + Intronic
1049532062 8:143159824-143159846 CTGGAGAAGGGGCTGGGGGTGGG - Intronic
1051484503 9:17593413-17593435 CTGCAGAATGGGTTGCTGGTAGG + Intronic
1051845586 9:21448191-21448213 CTGAAGAAAAAGCTGGTGGAAGG - Intergenic
1052175582 9:25458746-25458768 CTGTAGAATGGACTGCTGAAGGG - Intergenic
1053423330 9:37995120-37995142 CTCGAGAACAGGCTGGGGGAAGG + Intronic
1055364167 9:75526182-75526204 CTGGAGCTTGGGCTTTTGGAAGG - Intergenic
1056220776 9:84449127-84449149 CTGGAGAATTGGTTGGTGTCTGG - Intergenic
1056935766 9:90913921-90913943 CTGGGGAATGGGCAGGTGAAAGG + Intergenic
1057303581 9:93900038-93900060 CTGGTGTCTGGGCTGATGGAGGG - Intergenic
1058823417 9:108753740-108753762 ATGGAGACTGGGATGATGGATGG - Intergenic
1059252207 9:112895734-112895756 ATGGATAATGGGTGGGTGGATGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1060554601 9:124501752-124501774 CTGGAGAAAGGACTCCTGGATGG - Intronic
1060972744 9:127748150-127748172 CTGGAGAATGGTCTGGGGAGAGG + Intronic
1061238036 9:129353268-129353290 CTGATGAAGGGGCTGGTGGGAGG + Intergenic
1061322050 9:129836928-129836950 CTGGTGGATGGGCTGCTTGATGG - Intronic
1061892005 9:133627166-133627188 TTGGAGGAGGGACTGGTGGAAGG - Intergenic
1061897496 9:133656033-133656055 TTGGAGAAATGACTGGTGGACGG + Intronic
1061932171 9:133838824-133838846 TTGGTGAGTGGGTTGGTGGATGG + Intronic
1061934913 9:133852104-133852126 CTGAAGAATGGATGGGTGGATGG + Intronic
1061940252 9:133880155-133880177 GTGGGCAAGGGGCTGGTGGAGGG - Intronic
1062247725 9:135578060-135578082 CAGGTGAATGGGTGGGTGGATGG - Intergenic
1062247794 9:135578406-135578428 CAGGTGAATGGGTGGGTGGATGG - Intergenic
1062247863 9:135578752-135578774 CAGGTGAATGGGTGGGTGGATGG - Intergenic
1062354885 9:136157228-136157250 ATGGATTATGGGCTGGAGGAAGG + Intergenic
1203633641 Un_KI270750v1:92320-92342 TTGGACTATGGGCTGCTGGATGG + Intergenic
1185811122 X:3111622-3111644 CTGCAGACTGGGGTGGGGGATGG + Intronic
1186662982 X:11687791-11687813 CTAGAGAATGGGGTTGAGGAGGG + Intergenic
1186812893 X:13207628-13207650 CTGGAAAGTGGGGGGGTGGATGG - Intergenic
1186904823 X:14099949-14099971 TTGGAGAATGGGCTGGGTGTTGG + Intergenic
1187433304 X:19244126-19244148 CTGGGGAATGGGTTGATGGGAGG + Intergenic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1189374441 X:40455723-40455745 CTGGAGGTTGGCCTGGTGGGAGG - Intergenic
1190304113 X:49072770-49072792 CTGGAGATAGGGCTGGTGGGAGG - Intronic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1190358610 X:49628173-49628195 CTGGAGACTGGGCTCGTCTAAGG - Intergenic
1190392798 X:49948740-49948762 AAGGAGAATGGGGTGGTAGATGG + Intronic
1190873670 X:54445110-54445132 CTGGAGGCTGGGCTGAAGGAAGG - Exonic
1191741516 X:64440216-64440238 GTGGAGAATAGGCTGGTGGTGGG - Intergenic
1192175293 X:68881242-68881264 ATGGAGAACAGGCTGGGGGAGGG + Intergenic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1192317652 X:70065557-70065579 CTGGGGCATGGACTGGTGAAGGG + Intergenic
1192554909 X:72081596-72081618 GTGGAGAATGGGCTGGAGAGTGG - Intergenic
1193526650 X:82598611-82598633 CTGGTGAGTGGGATGGGGGAAGG - Intergenic
1193765342 X:85521895-85521917 CTGGGGAAGGGTCTGGTGGGAGG + Intergenic
1194445873 X:93986702-93986724 CTGGAGCAGGGGATGCTGGATGG + Intergenic
1194756046 X:97741210-97741232 CTGGAGAAGGGGCTGGGAGTGGG + Intergenic
1195070358 X:101273249-101273271 CTGGAGAATGGGTTGGAAGAAGG - Intronic
1198823388 X:140673502-140673524 CTGGAAAATGTCCTAGTGGAGGG - Intergenic
1199744373 X:150762557-150762579 CTGGTGAATGGGCATCTGGAGGG - Exonic
1200074930 X:153546170-153546192 CTGGGGGTGGGGCTGGTGGAGGG + Intronic
1200242998 X:154507541-154507563 TTGGAGAACGGGCTTGTGGGAGG - Intronic
1200594863 Y:5125975-5125997 CTGACGAATGAGATGGTGGAGGG + Intronic
1200746768 Y:6910479-6910501 CTGGAGCTGGGGCTGGTGGGAGG + Intergenic
1201067800 Y:10115740-10115762 ATGGAGATGGGCCTGGTGGAAGG + Intergenic
1201413999 Y:13729636-13729658 CTGGGGGATGGGCAGGGGGAAGG - Intergenic