ID: 928429293

View in Genome Browser
Species Human (GRCh38)
Location 2:31204661-31204683
Sequence GAGGGTGCCACAACCAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 1, 2: 7, 3: 64, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928429293 Original CRISPR GAGGGTGCCACAACCAGGGA GGG Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
902390161 1:16099071-16099093 GAGGGGGGCGCACCCAGGGAGGG - Intergenic
903325737 1:22567562-22567584 GAGGCTGGCAGAACTAGGGAGGG - Intronic
903470773 1:23585859-23585881 CAGGGTGACACAGCCAGAGAAGG - Intronic
903941818 1:26937193-26937215 GAGGGTGGCACACCCAGAGAGGG - Intronic
903960385 1:27053334-27053356 GTGGGTGCCAGAATCTGGGAAGG - Intergenic
904671721 1:32171042-32171064 GAGGGTGCTCCCTCCAGGGAAGG - Exonic
904927858 1:34062613-34062635 GAGGGTGGGACAGCCAGGCAAGG + Intronic
905991626 1:42342265-42342287 GAGGCTGCCACATACAGTGATGG - Intergenic
906210604 1:44010573-44010595 AAGGGTGCCTAAGCCAGGGATGG + Intronic
906764922 1:48420207-48420229 GAGGGTGGCTCATCCAGGGTGGG + Intronic
910690388 1:89959679-89959701 GGGGGTGGCACATCCAGAGAGGG - Intergenic
910881353 1:91924863-91924885 GAGGGTGGCGCACCCAGGGAGGG - Intergenic
911120726 1:94293753-94293775 GAGGGTGGCACACCCATGGAGGG - Intergenic
911723116 1:101212765-101212787 GAGGGTGGCATACCCAAGGAGGG + Intergenic
911747229 1:101453251-101453273 GGGGGTGGCACGCCCAGGGAGGG - Intergenic
911890955 1:103371258-103371280 GAGGGTGGCACACCCAGGGAGGG + Intergenic
913127289 1:115804381-115804403 GAGGCTGACACACCCAGAGAGGG + Intergenic
916027920 1:160851072-160851094 GAGGGTGGCACGCCCTGGGAAGG - Intronic
916812316 1:168316416-168316438 GAGGCTGGCTCATCCAGGGAAGG - Intergenic
917217566 1:172693483-172693505 GATGTTGCCACTACTAGGGATGG + Intergenic
917464836 1:175267037-175267059 GAGGGTGGCACACCAAGAGACGG - Intergenic
918302571 1:183217264-183217286 GTGGGTGACAGAAGCAGGGATGG + Intronic
919625762 1:199908715-199908737 GAGGGTGGTGCACCCAGGGAGGG + Intergenic
920038308 1:203080053-203080075 GATGGTGCCCCAAACATGGATGG + Intergenic
920045489 1:203129608-203129630 GAGGGTGGCACAACAGGGGCAGG + Intronic
920720144 1:208379701-208379723 GAGGGTGGCACACCCAGGGAGGG + Intergenic
920950553 1:210568238-210568260 GAGGGTGGTACACCCGGGGAGGG + Intronic
921951503 1:220934886-220934908 GAGGCAGTCACAGCCAGGGAAGG - Intergenic
922006375 1:221534688-221534710 GAGGGTGGCTCACCCAGAGAGGG - Intergenic
922599442 1:226838481-226838503 GAGGTTGGCACATTCAGGGAGGG - Intergenic
922774246 1:228207626-228207648 CCGGGGGCCACAGCCAGGGACGG - Intronic
923351863 1:233115146-233115168 GAGACTACTACAACCAGGGAAGG + Intronic
924814852 1:247432612-247432634 GAGGCAGACACAAACAGGGAAGG + Intronic
1066196575 10:33106175-33106197 GAGGGTGCCTGAACCTCGGATGG - Intergenic
1067125939 10:43515429-43515451 GATGTTGCCACTACCAGGGATGG + Intergenic
1067358454 10:45553892-45553914 GAGGGAACCACAATCAGAGATGG + Intronic
1071866501 10:89740389-89740411 GAGGGTGGTACACCCAGAGAGGG - Intronic
1071928291 10:90436698-90436720 GAGGGTGACATGCCCAGGGAGGG + Intergenic
1073326780 10:102647846-102647868 GAGGGTGAGGCCACCAGGGAGGG - Intronic
1073441591 10:103555621-103555643 GAGGGCGCCACTGTCAGGGAAGG - Intronic
1074543247 10:114383794-114383816 GGGGGAGACATAACCAGGGAGGG + Intronic
1075668746 10:124248744-124248766 GAGGTGGCCACAAGCAGGGAAGG + Intergenic
1076053770 10:127354994-127355016 GAGGGAGGCAACACCAGGGAGGG - Intronic
1076136876 10:128051235-128051257 GAGGGGGCCACTCCCAGGGAGGG + Intronic
1076469802 10:130710453-130710475 GAGTTTGCCACAGGCAGGGATGG + Intergenic
1077898606 11:6473171-6473193 GAGGAGGTCAGAACCAGGGAGGG + Intronic
1078937746 11:15966370-15966392 GAGGGTGGCACATTCAGGGCTGG + Intergenic
1079835297 11:25326569-25326591 GAGGGTGGTACACCCAGGGAGGG + Intergenic
1080060207 11:27948953-27948975 GATGGTGCCAGTAGCAGGGATGG - Intergenic
1080720705 11:34845738-34845760 CAGGGTTACACAACTAGGGAAGG + Intergenic
1080826189 11:35851388-35851410 AAGAGTGCCCCAACCATGGAGGG + Intergenic
1081749482 11:45499592-45499614 GAGGGTGGTGCACCCAGGGAGGG + Intergenic
1083201073 11:61121438-61121460 GAGGGTGCCAGAAGGAGGGAAGG + Intronic
1083421730 11:62556990-62557012 GAAGGTCCCACAACCACAGAAGG + Intergenic
1083670119 11:64295152-64295174 GAGGGTGTCACATCTAGGCAAGG + Intronic
1083810855 11:65105940-65105962 GAGGGTGGCACGCCCGGGGAGGG - Intronic
1084482118 11:69428039-69428061 GAGAGAGACACAAACAGGGAGGG + Intergenic
1084516048 11:69638468-69638490 AAGGTTCCCACAGCCAGGGACGG + Intergenic
1084714639 11:70865943-70865965 GAGGGTGGGACTGCCAGGGAGGG - Intronic
1085355452 11:75832532-75832554 GAGGCTGGCACACCCAGAGAGGG - Intronic
1085857884 11:80196442-80196464 GAGGGTGGTGCACCCAGGGATGG + Intergenic
1086337927 11:85817705-85817727 CACGGTGCCACATCCAGAGAGGG + Intergenic
1087587652 11:100142158-100142180 GAAAGTCCCAGAACCAGGGAAGG - Intronic
1088205070 11:107382995-107383017 GAGGGTGGCACTCCCAGGGATGG + Intronic
1088921806 11:114264885-114264907 GAGAGTGGCACACCCAGGGAGGG - Intronic
1089338562 11:117742435-117742457 GAGGGTCCCACAGCCAGCCATGG - Intronic
1090289413 11:125528763-125528785 GAGGGTGCCATACCCAGAGAGGG + Intergenic
1090417571 11:126551151-126551173 GAGGGTGGCGCACTCAGGGAGGG - Intronic
1090981738 11:131728475-131728497 GAGGGTGGATCACCCAGGGAGGG - Intronic
1091360660 11:134976543-134976565 GAGGGTGCCCGGGCCAGGGATGG - Intergenic
1091546288 12:1503349-1503371 GAGGGCGCCACACCCAGGGCAGG + Intergenic
1092463536 12:8707444-8707466 GAGGGTGACGCACCCAGGAAGGG - Intronic
1093145915 12:15566904-15566926 GAGGGTACCATCACCTGGGAGGG + Intronic
1093254535 12:16850592-16850614 GAGGGTGGCACACCAAGAGAGGG - Intergenic
1093923897 12:24889979-24890001 AAGGGTGGCACACCCCGGGAGGG + Intronic
1094414756 12:30204763-30204785 GAGGGTGGCACAACCCGAGAAGG - Intergenic
1094608656 12:31972065-31972087 GAGGGTGGCGTACCCAGGGAGGG + Intronic
1095043716 12:37474594-37474616 GAGGGTGGCTCACCCAGGGATGG - Intergenic
1095257713 12:40059622-40059644 GAGGGTGGCACATTCAGGAAGGG - Intronic
1097787083 12:63772760-63772782 GAGGGTGGCACCCCCAGAGAGGG - Intergenic
1098470464 12:70837639-70837661 GAGGGTGGCATACCCAGAGAGGG - Intronic
1099016262 12:77347602-77347624 GATGGTGGCACATCCATGGAGGG - Intergenic
1101772846 12:107767456-107767478 GAGGGTGGCACGCCCAGGGAGGG - Intergenic
1101957980 12:109227495-109227517 GAGTGGGACACACCCAGGGACGG + Intronic
1102195822 12:111024413-111024435 CAGGCTGCCCCACCCAGGGAAGG + Intergenic
1102561377 12:113764680-113764702 TAGGGTCACTCAACCAGGGAGGG - Intergenic
1104607526 12:130200920-130200942 GTGGCTGCCCCAACCAGGTACGG + Intergenic
1104721167 12:131045934-131045956 GAGGGAGCACCAACCAGGGCGGG - Intronic
1104881173 12:132071597-132071619 GAGATGGCAACAACCAGGGAAGG - Intronic
1104972018 12:132535003-132535025 GAGGGTGGCACAGGCAGTGAAGG + Intronic
1105923188 13:24983876-24983898 GAGGGTGGCGCACCCAGGGAGGG + Intergenic
1107427829 13:40312013-40312035 GAGTGTGCGACAACCAAGGGTGG + Intergenic
1107555075 13:41510419-41510441 GAGGGTGGCGCATCCAGAGAGGG - Intergenic
1108278759 13:48839888-48839910 GAGGGTGGCACACCTGGGGAGGG + Intergenic
1108545710 13:51491131-51491153 AAGGATGCCACACCCTGGGATGG - Intergenic
1111139290 13:84093279-84093301 GTGGTTACCAGAACCAGGGAAGG + Intergenic
1111315553 13:86553989-86554011 GATGGTGCAACAACGAGGGTTGG - Intergenic
1111851357 13:93579842-93579864 GAGGGAGCCACACACAGTGAGGG - Intronic
1112059100 13:95719226-95719248 GAGGGTGGTACACCCAGAGAGGG - Intronic
1113544981 13:111141469-111141491 GAAGGGGGCACACCCAGGGAGGG - Intronic
1114648820 14:24270378-24270400 GAGGGTGGCAAAATCAGGGTTGG + Exonic
1115375059 14:32665494-32665516 GAGGGTGACACGCCCAGGAAGGG - Intronic
1116164843 14:41322470-41322492 GAAGGTGACACAACCAGGGAGGG + Intergenic
1116531795 14:45980795-45980817 GATGTTGCCACCACTAGGGATGG + Intergenic
1116571679 14:46525330-46525352 GAGGGGGCAAAAACCAGAGAGGG + Intergenic
1117006386 14:51425215-51425237 GAGGGAGCCAAGACCAGGGCAGG - Intergenic
1118141914 14:63093210-63093232 GAGGGTATCACACCCAGGGAGGG + Intronic
1119549942 14:75501537-75501559 GAGGGAGCCAAGACCAGGCAGGG - Intergenic
1119556164 14:75554568-75554590 GAGGATGACACACCCAAGGAGGG - Intergenic
1121595844 14:95161606-95161628 GAGGGTGGTGCACCCAGGGAAGG + Intergenic
1202942250 14_KI270725v1_random:162190-162212 TAGGGTGGCCCACCCAGGGATGG - Intergenic
1124370119 15:29099747-29099769 GAGGGTGCCACACCTGGGGTGGG + Intronic
1125826631 15:42682043-42682065 CAGGCAGCCACAAGCAGGGAAGG + Intronic
1125956871 15:43796559-43796581 GAGGGTGCCCAAGACAGGGAAGG - Exonic
1126107951 15:45159280-45159302 GAGGGTGACAAAACCAGGCTTGG + Intronic
1126312528 15:47334174-47334196 GAGGGTGGTGCACCCAGGGAGGG + Intronic
1128176634 15:65562024-65562046 GAGGGTGGCACACCTGGGGAGGG - Intronic
1128987896 15:72234617-72234639 GAGGATGCCACTCCCAGGGAGGG + Intergenic
1129202800 15:74015024-74015046 GCTGGTGCCACACCCAGGAATGG - Intronic
1130758761 15:86795420-86795442 GAGGGTCCCATTACCTGGGATGG + Intronic
1132325395 15:100964445-100964467 GAGGGTGTCACCTCCCGGGAAGG + Intronic
1133019160 16:2959252-2959274 GAGGCTTCCACAACCAAGGAAGG + Intergenic
1133101999 16:3485479-3485501 GAGGTTTCCAGAAGCAGGGAGGG - Exonic
1133221946 16:4322648-4322670 GAGGGTGCCCCGACCAAGGTGGG - Intronic
1133247715 16:4460320-4460342 GGGGGTGCCAGAGCCAGGGTGGG + Intergenic
1133436923 16:5787712-5787734 GAGGGTGACACCACCAGCCAAGG + Intergenic
1135082988 16:19452293-19452315 GAGGGTGGCTCACCCAGGGAGGG - Intronic
1137510501 16:49095509-49095531 GATGGTGACAGAAGCAGGGAGGG + Intergenic
1137759516 16:50928857-50928879 GGGGCTGCCATAACAAGGGATGG + Intergenic
1138116794 16:54367347-54367369 GAGGGTGCCAGGTCCAGGTAGGG + Intergenic
1138278584 16:55755227-55755249 GAGAGTGCCACAGCCAGGCCTGG + Intergenic
1138289970 16:55838394-55838416 GAGAGTGCCACAGCCAGGCCTGG - Intergenic
1139178033 16:64713476-64713498 GAGGGTGATGCACCCAGGGAGGG - Intergenic
1139439740 16:66960186-66960208 GAGGCTCCCACCCCCAGGGAGGG - Intergenic
1139557236 16:67719923-67719945 GAGGGTCAGACAAGCAGGGACGG - Intergenic
1139957091 16:70698271-70698293 GAGGGTGGCACCACCATGCAGGG + Intronic
1141664849 16:85460772-85460794 GAACGTCCCATAACCAGGGACGG + Intergenic
1141671158 16:85492342-85492364 GAGGGGGACTCAAACAGGGATGG - Intergenic
1141832745 16:86518747-86518769 CAGGGTGGGACAACAAGGGACGG + Intergenic
1142668054 17:1473658-1473680 CAGGGTGCCAGATGCAGGGAGGG - Intronic
1144569150 17:16384838-16384860 GAGGATGGCACACCCAGGCAAGG + Intergenic
1144888743 17:18481472-18481494 CAGGCTGCCACAAACAGGCAAGG + Intronic
1145143464 17:20462826-20462848 CAGGCTGCCACAAACAGGCAAGG - Intronic
1146209538 17:30931313-30931335 TTGGGTGCCACAACTGGGGAGGG + Intronic
1146318204 17:31825842-31825864 GATGGTGCCTGCACCAGGGATGG - Intergenic
1146860113 17:36289925-36289947 GAGGGTGGTGCACCCAGGGAGGG + Intronic
1147090439 17:38094016-38094038 GAGGGTGGTGCACCCAGGGAGGG + Intergenic
1147106774 17:38226510-38226532 GAGGGTGGTGCACCCAGGGAGGG - Intergenic
1148091479 17:45024869-45024891 TAGGGTCCCACAGCCAGGGAGGG + Intronic
1148422750 17:47562027-47562049 GAGGGTGGTGCACCCAGGGAGGG + Intronic
1148549480 17:48542062-48542084 CAGGGTCCCGCACCCAGGGATGG - Intronic
1148798834 17:50210624-50210646 GAGGGTGCCCCTCCCAGGCAGGG + Intergenic
1149426593 17:56560577-56560599 GAGGGTGGCATGCCCAGGGAGGG + Intergenic
1150666839 17:67147890-67147912 GATGGTGGCGCACCCAGGGAGGG + Intronic
1152338176 17:79709718-79709740 CAGGGTGCCAGCATCAGGGAGGG - Intergenic
1152338203 17:79709805-79709827 CAGGGTGCCAGCATCAGGGAGGG - Intergenic
1152338244 17:79709936-79709958 CAGGGTGCCAGCATCAGGGAGGG - Intergenic
1152338259 17:79709980-79710002 CAGGGTGCCAGCATCAGGGAGGG - Intergenic
1152338288 17:79710068-79710090 CAGGGTGCCAGCATCAGGGAGGG - Intergenic
1152338331 17:79710199-79710221 CAGGGTGCCAGCATCAGGGAGGG - Intergenic
1152456002 17:80416534-80416556 GATGGTGGCACAGCCAGGGAAGG - Intronic
1152797807 17:82316581-82316603 GAGGGTCCCACGACAAGGGCTGG + Intronic
1152934173 17:83126345-83126367 TAGGGTGCCGTGACCAGGGAGGG + Intergenic
1154147018 18:11874870-11874892 GAGGGTGCAGCACCCAGTGATGG - Intronic
1154365848 18:13708305-13708327 AAGGGTGGCACACCCAGAGAGGG - Intronic
1156333463 18:36147942-36147964 GAGGGCGGCACAGCCAGGGAGGG - Intronic
1156485409 18:37462465-37462487 CAGGGTGCATCCACCAGGGAAGG - Intronic
1157959033 18:52131933-52131955 GAGGGTGATGCACCCAGGGAGGG - Intergenic
1158900100 18:61954484-61954506 GAGGGTGGCAAAAGCAGAGAGGG + Intergenic
1159307224 18:66659542-66659564 GAGGGTGCCACTTCCATGTATGG - Intergenic
1160366913 18:78334224-78334246 CCTGCTGCCACAACCAGGGATGG - Intergenic
1160430141 18:78805335-78805357 GAGGTGGCCACAGCCAGGGATGG + Intergenic
1160557150 18:79733404-79733426 GAAGGTGCCGGAACCAGGGCTGG + Intronic
1160807415 19:998588-998610 GAGGGAGCCGAACCCAGGGAGGG + Intergenic
1160810026 19:1009288-1009310 TCGGGTGCCACAACCACGGCGGG - Exonic
1161056227 19:2191776-2191798 GTGGGAGCCCCAACCTGGGAGGG - Intronic
1161083851 19:2324856-2324878 GTGGGTGCCAGGGCCAGGGATGG + Intronic
1161919489 19:7255398-7255420 GAGGGTGCCTCATGCCGGGAAGG - Intronic
1162046342 19:8002782-8002804 GAGGCTGCAACAGGCAGGGAGGG + Intronic
1163364883 19:16870284-16870306 GAGGGTGCTACACCCAGGACAGG - Intronic
1163664213 19:18595402-18595424 GAGGGTCCCAGAGCTAGGGAGGG - Intronic
1164883061 19:31752188-31752210 GAAGGTGGCATGACCAGGGAAGG + Intergenic
1165396531 19:35567263-35567285 GACAGTGCCACAGCCAGGGCTGG + Intergenic
1165786258 19:38463644-38463666 GAGGGTGGCAGAACTAGGGTTGG + Intronic
1165811906 19:38616955-38616977 GAGGGTGCCAAGACCAGGCGCGG + Intronic
1167850632 19:52198596-52198618 GAGGGTGGCATCCCCAGGGATGG - Intronic
1167861230 19:52285596-52285618 GAGAGTGGCACGCCCAGGGAGGG - Intronic
1167957960 19:53083075-53083097 GAGGGTGGCATACTCAGGGAGGG - Intronic
1168024965 19:53637347-53637369 GAGGGTGGCATATCCGGGGAGGG + Intergenic
925293664 2:2764212-2764234 GAGGGATCCAGAACCAGGGCAGG + Intergenic
926139579 2:10360177-10360199 GAGGGGTGCACCACCAGGGAAGG + Intronic
927164009 2:20298944-20298966 AAGGGTGGCACACCCAGGGAGGG + Intronic
928086023 2:28346929-28346951 GAGTGTCCCACACCCAGGGTGGG + Intergenic
928087873 2:28356917-28356939 GAGGGTGGCACCACCCTGGATGG + Intergenic
928429293 2:31204661-31204683 GAGGGTGCCACAACCAGGGAGGG + Intronic
929153433 2:38768844-38768866 GAGGGTGGTGCACCCAGGGAAGG + Intronic
929877364 2:45807961-45807983 GGGGGTGGCACAGCAAGGGAGGG - Intronic
932132081 2:69196997-69197019 GTGGGTGCCAATCCCAGGGAAGG - Intronic
933553835 2:83807875-83807897 GAGAGTGGCACACCCAGGGAGGG - Intergenic
935141762 2:100359443-100359465 GAGAGTGGCACATCCAGAGAGGG - Intergenic
936767629 2:115872713-115872735 GAGGATGCCACACCCATGAAAGG - Intergenic
937427366 2:121811572-121811594 GAGGATGCCAAAAACAGGAAAGG + Intergenic
938382462 2:130844285-130844307 GAGGGTCCCGGAGCCAGGGATGG - Intronic
938601801 2:132850025-132850047 GAGTGTCCAATAACCAGGGAGGG + Intronic
940463028 2:153991751-153991773 GATGGTGACACAACCAGTAATGG - Intronic
940472476 2:154116157-154116179 GATGTTGCCACTACTAGGGATGG + Intronic
941616279 2:167724134-167724156 GAGTGTTGCACAACCAGGCATGG - Intergenic
941881001 2:170480386-170480408 GAGGGTGGCACACCCAAGCAAGG + Intronic
942330019 2:174813354-174813376 GAGGGTGATACACCCAGGGAGGG - Intronic
942445920 2:176079247-176079269 GAGGTTGCCACGGCCAGGGAAGG - Exonic
942636411 2:178011529-178011551 GAGGGTGGCACACCCAGAGAAGG - Intronic
943471939 2:188305251-188305273 GAGGGTGGCCCACCCAGGGAAGG - Intronic
943573746 2:189606268-189606290 GAGGGAGACACAACCAAGGAAGG - Intergenic
946173324 2:217908205-217908227 GAGGGTGCCAGAGTGAGGGATGG - Intronic
948928681 2:241116405-241116427 GAGGGAGCCATAACCTGGGCTGG + Intronic
1169441152 20:5634971-5634993 GAGGGTGGTGCACCCAGGGAGGG - Intergenic
1169614494 20:7424822-7424844 GAGGTTTCCACAAGCAGGCAGGG - Intergenic
1170294949 20:14813679-14813701 GAGAGTGGCACACTCAGGGAGGG - Intronic
1172475538 20:35234749-35234771 GAGGCTGGCAGAACCAGGCATGG + Intronic
1173437811 20:43048415-43048437 CAGGGTGGCACAACCAGTCATGG + Intronic
1175615507 20:60394715-60394737 GAGAGTGGCAGGACCAGGGAGGG + Intergenic
1175787605 20:61721883-61721905 GAGCCTCCCACAGCCAGGGAAGG - Intronic
1175833183 20:61978253-61978275 GAGGGCGCGACACCAAGGGAGGG + Intronic
1176119207 20:63446462-63446484 GAGGGTGGCCCACCCAGGGTGGG + Intronic
1176184924 20:63773147-63773169 GACGGAGCCACACCCAGGGAGGG + Intronic
1177322790 21:19544267-19544289 GAGGGTGGCACATCCAGAGAGGG + Intergenic
1178000643 21:28158726-28158748 GAGGGTGGCAAGCCCAGGGAGGG - Intergenic
1178973040 21:37197957-37197979 GATGGTGCAACAACCACCGAGGG - Exonic
1179552159 21:42150429-42150451 GAGGGTCCCAGAGCCAGGGCAGG - Intergenic
1179609083 21:42537540-42537562 GTGGGTGTCACAGCCAGGGAAGG + Intronic
1179934049 21:44591295-44591317 GAGGGTGTCAAAGCCAGAGAGGG + Exonic
1179940836 21:44638243-44638265 GAGGGTGTCAAAGCCAGAGAGGG - Exonic
1180009756 21:45041521-45041543 GAGGGTTACACAACCCAGGACGG + Intergenic
1180785820 22:18547155-18547177 GAGGGTGCCAGAGGTAGGGACGG - Intergenic
1181131102 22:20732880-20732902 GAGGGTGCCAGAGGTAGGGACGG - Intronic
1181242745 22:21486709-21486731 GAGGGTGCCAGAGGTAGGGACGG - Intergenic
1181333120 22:22109940-22109962 GAGGGTCCCACAGCCTGGGCTGG - Intergenic
1181404587 22:22673677-22673699 GAGGGTGACACAGACAGTGAAGG - Intergenic
1182105665 22:27687304-27687326 GAGGGTCCCACATGCAGGGACGG - Intergenic
1182443226 22:30376173-30376195 GAGGGTGTCGTAGCCAGGGATGG - Intronic
1182852738 22:33489935-33489957 GAGGGTGCCTGTCCCAGGGAAGG + Intronic
1183092157 22:35529891-35529913 GAGTGTGCCAGTCCCAGGGAGGG + Intergenic
1184526281 22:45025328-45025350 GAGGGACCCAGAACCAGAGATGG + Intergenic
1185011459 22:48316872-48316894 GAGGGTGGCACAACCCGGGCAGG + Intergenic
1185164784 22:49254894-49254916 GAGGTGGCCACAACCTGGGGAGG + Intergenic
949091947 3:39165-39187 GAGGATGCTGCAGCCAGGGAAGG - Intergenic
949883803 3:8679494-8679516 GAGGGTCCCAAAGCCAGGGGGGG - Intronic
950168462 3:10819088-10819110 AAGGGTGCAACATTCAGGGAGGG + Intronic
950930582 3:16785039-16785061 GAGGGTGGCACACCCTGGGAGGG - Intergenic
951723311 3:25725302-25725324 GAGGGTGGCACACCCGGGGAGGG + Intronic
952939246 3:38429232-38429254 GAAGGTGACACAAGCAGGGGTGG - Intergenic
953859104 3:46527077-46527099 AAGGGTGAAGCAACCAGGGAGGG + Intronic
953878610 3:46680287-46680309 GAGGGAGCCAGAACCTGGGCAGG - Intronic
953901350 3:46845822-46845844 GAGGCTGCGCCGACCAGGGAGGG + Intergenic
954565796 3:51598826-51598848 GAGGGTGTCACACAAAGGGAGGG + Intronic
955293600 3:57715248-57715270 GAGGGTGGCACTCCCAGGGAAGG + Intergenic
957026991 3:75193310-75193332 GAGGGTGGCATACCCAGAGAGGG - Intergenic
958264926 3:91426903-91426925 GAGGGTGGAACACCCAGAGAGGG + Intergenic
959001076 3:100964859-100964881 GAGGCTGGTACAACCAGTGAGGG - Intronic
959021117 3:101188168-101188190 GAGGGTGCCATGCCCAGGGAAGG + Intergenic
959377378 3:105603059-105603081 GTGGGTTCCAGAACCAGAGAAGG - Intergenic
961369601 3:126421496-126421518 AAGGGTGGCAGAAGCAGGGATGG + Intronic
961992210 3:131204200-131204222 GAGGGTGGCACACCCAGGAAGGG + Intronic
962432574 3:135333563-135333585 GAGGGTGGCATTCCCAGGGAGGG - Intergenic
962600884 3:136990103-136990125 AAGGGTGCTACAGCCTGGGATGG + Intronic
963605838 3:147411026-147411048 GACCTTGCCACAGCCAGGGAAGG - Exonic
963674242 3:148288312-148288334 GAGTGTGGCACAGGCAGGGAGGG - Intergenic
963791448 3:149586903-149586925 GAGGGTGGCACATCCAGAGAGGG + Intronic
964704465 3:159603242-159603264 GAGGGTGGCATACCTAGGGAAGG - Intronic
967195457 3:187021890-187021912 TAGGGCGGCACAACCAGGGAGGG + Intronic
968612026 4:1561678-1561700 CAGGGTCCCAGAACCAGGGCGGG - Intergenic
969275159 4:6129785-6129807 GAGGCTGCCAGAAACAGGAAGGG - Intronic
970111121 4:12639244-12639266 GAGGGCACAACAACCAGGGGAGG - Intergenic
970234041 4:13940432-13940454 GAGGGTGGTGCACCCAGGGAGGG - Intergenic
970628873 4:17919967-17919989 GAGGGTGGCACACCCAGGGAGGG + Intronic
971514475 4:27469160-27469182 GAGGGTGGCACGCCCAGGGGAGG + Intergenic
971903957 4:32701176-32701198 GAGGGTGCAGCCACCATGGATGG - Intergenic
972048245 4:34695532-34695554 GAGGCTGCTACAACTAGTGATGG + Intergenic
972285358 4:37642887-37642909 GAGGGTGGCGCACCCAGAGAGGG + Intronic
974535870 4:63174375-63174397 GAGGGTGTTGCATCCAGGGAGGG + Intergenic
974934827 4:68399543-68399565 GAGGGTGGCGCACCCAGGGAGGG + Intergenic
975340256 4:73231929-73231951 GAGGGTGGCACGCCCAGAGAGGG + Intronic
975796325 4:78010496-78010518 GAGGGGTCCACAACCATGAATGG + Intergenic
977721572 4:100245137-100245159 GAGTGTGGCACACCCGGGGAAGG + Intergenic
978236103 4:106462855-106462877 GAGGGAGCCAGAAACAAGGAGGG + Intergenic
979766679 4:124472198-124472220 GATGTTGCCACTACCAGGGATGG - Intergenic
980765771 4:137301750-137301772 GAGGGTGGCACACCCAGGGAGGG - Intergenic
981020444 4:140022069-140022091 GACGGTGCCACAGCCCTGGAGGG + Intronic
981434084 4:144699388-144699410 GAGAGTGGCACACCCAGAGAGGG - Intronic
983079983 4:163372957-163372979 GAGGGTGGCGCACCCAGGGAGGG - Intergenic
983626112 4:169803553-169803575 GAGGGTGACACGCCCAGGAAGGG + Intergenic
983867834 4:172789609-172789631 GAGAGTGACACACCCCGGGAGGG - Intronic
984983015 4:185301288-185301310 GAGGGTGACACACCCAGGGAGGG + Intronic
985295068 4:188428225-188428247 GAGGATGACAGAAGCAGGGAAGG - Intergenic
985358744 4:189149016-189149038 GGGGGAGCCACACCCAGGCACGG + Intergenic
985932300 5:3068034-3068056 GAGGCAGCCACATCCAGGGTGGG - Intergenic
986686058 5:10276043-10276065 CAGGATCCCACAACCATGGAAGG - Intronic
988400295 5:30752985-30753007 GAGGGTGGTGCACCCAGGGAGGG - Intergenic
989181317 5:38580288-38580310 GAGTGTGCCACAAACAGAGGTGG + Intronic
990473688 5:56141619-56141641 GAGGGTGGCACACCCAGAGAGGG + Intronic
990775445 5:59301030-59301052 GAGGTTGGCACAGCCAGGTAAGG - Intronic
991482816 5:67101358-67101380 CAGGGTGCCACATCCAGTGAGGG - Intronic
991722447 5:69506378-69506400 GAGGGTGGCACAACCAGGGAGGG - Intronic
992129243 5:73674867-73674889 GAGGGTGGCACACCCAGGGGAGG + Intronic
992226183 5:74621430-74621452 GAGGGTGATGCATCCAGGGAGGG - Intergenic
993336827 5:86670262-86670284 GAGGGTGGCACACTCAGGGAAGG + Intergenic
993810550 5:92470764-92470786 GAGGGTGGCATGAGCAGGGAAGG - Intergenic
994017912 5:94989889-94989911 GAAGGTGTCACAGCCAGAGAGGG + Intronic
994187570 5:96832081-96832103 GAGTGTGCCAGAACCATGCAGGG + Intronic
995367176 5:111375765-111375787 GAGGATGGCAGAACCAAGGATGG - Intronic
995379613 5:111517643-111517665 GAGGGTGGTGCACCCAGGGATGG + Intergenic
995594548 5:113733976-113733998 AAGGGTGACACACCCAGAGAAGG - Intergenic
999278368 5:150347473-150347495 GAGGGTGCCACACCAAGAAATGG + Intergenic
999420803 5:151440723-151440745 GAGGGAGGCAGAACCAAGGAGGG + Intronic
1000131831 5:158307413-158307435 CAGGATGCCAAAACCAGGGGAGG + Intergenic
1002110365 5:176905473-176905495 TAGGGTGCCTTCACCAGGGATGG - Exonic
1003348620 6:5294766-5294788 GAGGGTGGAACACCCAGGGAGGG - Intronic
1004232629 6:13846927-13846949 GGGGGTGCGACACCCAAGGAGGG + Intergenic
1004620167 6:17324675-17324697 GGGGGTGGGACAACCAGGCATGG + Intergenic
1004931114 6:20464080-20464102 GAGGGTGGCACACCTGGGGAGGG - Intronic
1005152857 6:22772619-22772641 GAGGATGGCACGCCCAGGGAGGG + Intergenic
1005746864 6:28846414-28846436 GAGGGTGGCATGCCCAGGGAGGG + Intergenic
1006024664 6:31139279-31139301 GAGGGTGTGAAAACCAGGGTGGG - Exonic
1006091628 6:31632040-31632062 GAGGCTCCCACACCCAAGGAGGG + Exonic
1006246712 6:32743475-32743497 GAGGGTGCACAAACCAGTGATGG + Intronic
1006388387 6:33744970-33744992 CAGGGTGCCACAGCCTGGGCGGG - Intronic
1006691948 6:35895925-35895947 GAGGGTGGTACACCCAGAGAGGG + Intronic
1007674870 6:43585221-43585243 GAGGGTGGCTCACCCAGGGAGGG - Intronic
1008577677 6:52876842-52876864 GAGGGTGGCACGTCCAGGGAAGG - Intronic
1008656549 6:53619761-53619783 GAGGGTGGCACATGCAGAGAGGG - Intergenic
1008990457 6:57595757-57595779 GAGGGTGGAACACCCAGAGAGGG - Intronic
1009179033 6:60494303-60494325 GAGGGTGGAACACCCAGAGAGGG - Intergenic
1009374241 6:62947723-62947745 GAGGGTGGTGCACCCAGGGAGGG + Intergenic
1009927277 6:70135183-70135205 GAGGGTGGCATGACCAGGGAGGG - Intronic
1010238131 6:73591965-73591987 GAGGGTGGCACGCCCAGAGAGGG - Intergenic
1010970023 6:82253291-82253313 GAGGGTGGCACACACAGGGAGGG + Intergenic
1011391152 6:86854995-86855017 GAGGGTGATGCACCCAGGGAGGG - Intergenic
1011463829 6:87634490-87634512 GTGTGTGCCACAGCAAGGGAAGG - Intronic
1017446831 6:154514560-154514582 GAGGGTGCCACAGACAAAGAGGG + Intergenic
1017977460 6:159370646-159370668 GATGTTGCCACTACCGGGGATGG + Intergenic
1019001065 6:168752555-168752577 GAGGGTGGTGCACCCAGGGAAGG - Intergenic
1019006263 6:168799202-168799224 GAGAGAGCCACAGGCAGGGAGGG + Intergenic
1019093809 6:169562907-169562929 GAGGAGGCCACAGCCCGGGAAGG + Intronic
1019254564 7:41015-41037 GACTGTGCCACCCCCAGGGAGGG + Intergenic
1021292995 7:18868924-18868946 GAGGGTGGCATTCCCAGGGAGGG + Intronic
1024136188 7:46411732-46411754 GAGGGTGGCACACCCAAGGAGGG - Intergenic
1025023265 7:55496361-55496383 GAGGGGGCCAGTACCAGAGACGG - Intronic
1025289629 7:57704153-57704175 GAGGGTGGCCCACCCAGGGATGG - Intergenic
1025553579 7:62276469-62276491 GAGGGGGCAAAAAGCAGGGACGG + Intergenic
1026013797 7:66656476-66656498 GATGGTGACAGAACCAGGGAAGG + Intronic
1026017764 7:66684100-66684122 GATGGTGACAGAACCAGGGAAGG + Intronic
1026524014 7:71139155-71139177 CAGGGTGACACAGCTAGGGAAGG + Intronic
1027344383 7:77242207-77242229 GAGGGGGCCACTGCCAGGGCAGG - Intronic
1027564640 7:79776423-79776445 GAGGGTGGCACAGCCAGGGAGGG - Intergenic
1029490739 7:100868647-100868669 GAAGGTGGCACAGCCAGTGAGGG + Exonic
1029630566 7:101747788-101747810 GAGGGTCCCACAACCCGGTGGGG - Intergenic
1029927578 7:104333719-104333741 GAGGGTGCCACAAGATAGGATGG - Intronic
1031083489 7:117280170-117280192 GAGGGTGGGTCAGCCAGGGATGG + Intronic
1031779460 7:125942848-125942870 GATGTTGCCACTACCAGGGATGG + Intergenic
1034528970 7:151683734-151683756 GAAAGTGCCACAGCCAGAGAGGG + Intronic
1034626643 7:152498290-152498312 CAGGGTCCCTCACCCAGGGATGG + Intergenic
1035048916 7:155987130-155987152 GAGGCAGCAACAAACAGGGAGGG + Intergenic
1036757771 8:11482642-11482664 GAGGGTGCCAGCTCCTGGGATGG + Intergenic
1036767473 8:11557898-11557920 GAGGCTGGCACCACCAGGGGCGG + Intronic
1036791704 8:11725466-11725488 GTGGATGCCACTGCCAGGGAGGG + Intronic
1037720522 8:21439707-21439729 GAGGTGGCCACCACCAGGAAGGG + Intergenic
1037994950 8:23345313-23345335 GAGGGTGACTCACCCAGGGCAGG + Intronic
1038216320 8:25564809-25564831 CAGGGTGCCAAGACAAGGGATGG + Intergenic
1038493096 8:27983798-27983820 GCAGGTCCCACCACCAGGGAAGG + Intronic
1042705608 8:71663211-71663233 GAGTGGCCCACAACCAGTGACGG + Intergenic
1044150466 8:88770523-88770545 GATGTTGCCACTACTAGGGATGG - Intergenic
1044445012 8:92265414-92265436 GAGGGTGGCATGCCCAGGGAGGG - Intergenic
1044994587 8:97827395-97827417 GAGGGTGGTACACCCAGGAAGGG + Intronic
1045331898 8:101162365-101162387 GAGGGTGGTACACCCAGAGAGGG + Intergenic
1046198031 8:110888826-110888848 GAGGGTGGAACACCCAGGGTGGG + Intergenic
1046362769 8:113184208-113184230 AAGGGTGGCACTTCCAGGGAGGG - Intronic
1046839116 8:118837976-118837998 GAGGGTGGCACACCCAGAAAAGG - Intergenic
1048484640 8:134835342-134835364 GAGGGTGCTTCTATCAGGGAAGG + Intergenic
1048879857 8:138863370-138863392 GCGGAGCCCACAACCAGGGAGGG - Intronic
1049020918 8:139957230-139957252 GAGGGTGCCATGAGCAGGGAGGG + Intronic
1049299830 8:141863609-141863631 GATGGTGCCACATCCTGAGAGGG + Intergenic
1052851279 9:33380049-33380071 GAGGGTGCCAGCACCAGGCCAGG + Intergenic
1053020161 9:34689067-34689089 GAGTGTGCCAGACCAAGGGAAGG + Intergenic
1054835538 9:69672134-69672156 CAAGGTACCACAGCCAGGGAGGG - Exonic
1055508182 9:76969422-76969444 GAGGCTTCCACAGCCTGGGATGG + Intergenic
1056771764 9:89482581-89482603 GAGGGTGACACCAGCAGGAACGG + Intronic
1056947653 9:91013514-91013536 GAGGGTGGCACAGCCTGGCAGGG + Intergenic
1057016917 9:91659929-91659951 GAGGGAGACAGAACAAGGGAGGG + Intronic
1057021248 9:91699214-91699236 GAGGGTGGCACACCCGGGGAGGG + Intronic
1057404659 9:94758089-94758111 GAGGGAGCAAGGACCAGGGAAGG + Intronic
1057526850 9:95810597-95810619 GAGGGTGGCACACCCGGAGAGGG - Intergenic
1059244056 9:112834525-112834547 AAGGGTGCTACACCCAGGGAGGG - Intronic
1059288013 9:113194077-113194099 GAGGTTGTCAGCACCAGGGATGG + Exonic
1059409699 9:114124287-114124309 GAGAGTGACACAAGCAGGGCTGG - Intergenic
1059425639 9:114219365-114219387 GAACGTGCCACAATCAGAGAAGG + Intronic
1061917019 9:133760607-133760629 GAGGCAGCCACAAGGAGGGAAGG + Intergenic
1185465616 X:352758-352780 GAGGACGCCACAACCACGGCCGG + Intronic
1186487208 X:9942663-9942685 GAGGGTGGAGCACCCAGGGAGGG - Intronic
1188800604 X:34525038-34525060 GAGGGTGGTGTAACCAGGGAGGG + Intergenic
1189091155 X:38084236-38084258 GAGGGTGGTACACACAGGGAGGG + Intronic
1190156059 X:47993232-47993254 GAGGGCGGCACACCCAGAGAGGG + Intronic
1192053711 X:67750653-67750675 AAGGGTGACGCACCCAGGGAGGG + Intergenic
1192298063 X:69870593-69870615 GACGTTGCCACTACTAGGGATGG + Intronic
1192729177 X:73785479-73785501 GAGAGTGGCACACCCAGGGAGGG - Intergenic
1193490949 X:82146547-82146569 GAGAGTCACACAGCCAGGGAGGG + Intergenic
1197190923 X:123647408-123647430 GAGGGAGACAGAAACAGGGAGGG + Intronic
1197337929 X:125231100-125231122 AAAGGTGGCACACCCAGGGAGGG + Intergenic
1197372363 X:125640457-125640479 GAGGTTGCCACCACTAGGGGAGG + Intergenic
1197557860 X:127978320-127978342 GAGGGTGGCATACCCAAGGAGGG - Intergenic
1199298532 X:146186423-146186445 GGGGCTGCCACAACCTGGGCTGG + Intergenic
1199868494 X:151875542-151875564 CAGGGTGCCACAGCAAGAGATGG + Intergenic
1200085569 X:153602856-153602878 GTGGGTGCCAGGGCCAGGGAGGG + Intergenic