ID: 928435781

View in Genome Browser
Species Human (GRCh38)
Location 2:31253691-31253713
Sequence GAGGGTCCACACCCTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 161}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928435781_928435800 30 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435800 2:31253744-31253766 GGAAGAAGGCTGGGGTGCCCGGG 0: 1
1: 0
2: 4
3: 55
4: 433
928435781_928435795 16 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435795 2:31253730-31253752 GGGTGTGTCTTGTGGGAAGAAGG 0: 1
1: 1
2: 2
3: 34
4: 377
928435781_928435799 29 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435799 2:31253743-31253765 GGGAAGAAGGCTGGGGTGCCCGG 0: 1
1: 0
2: 8
3: 64
4: 655
928435781_928435796 20 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435796 2:31253734-31253756 GTGTCTTGTGGGAAGAAGGCTGG 0: 1
1: 0
2: 3
3: 23
4: 315
928435781_928435798 22 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435798 2:31253736-31253758 GTCTTGTGGGAAGAAGGCTGGGG 0: 1
1: 0
2: 4
3: 36
4: 398
928435781_928435785 -10 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435785 2:31253704-31253726 GTGGACCCTCTACTGGGCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 130
928435781_928435794 9 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435794 2:31253723-31253745 TGGGGCGGGGTGTGTCTTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 220
928435781_928435793 8 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435793 2:31253722-31253744 CTGGGGCGGGGTGTGTCTTGTGG 0: 1
1: 0
2: 5
3: 39
4: 269
928435781_928435786 -9 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435786 2:31253705-31253727 TGGACCCTCTACTGGGCCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 187
928435781_928435789 -5 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435789 2:31253709-31253731 CCCTCTACTGGGCCTGGGGCGGG 0: 1
1: 0
2: 5
3: 48
4: 388
928435781_928435787 -6 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435787 2:31253708-31253730 ACCCTCTACTGGGCCTGGGGCGG 0: 1
1: 0
2: 2
3: 25
4: 221
928435781_928435791 -4 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435791 2:31253710-31253732 CCTCTACTGGGCCTGGGGCGGGG 0: 1
1: 0
2: 0
3: 22
4: 265
928435781_928435797 21 Left 928435781 2:31253691-31253713 CCTTGCTCAGGGTGTGGACCCTC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 928435797 2:31253735-31253757 TGTCTTGTGGGAAGAAGGCTGGG 0: 1
1: 0
2: 2
3: 25
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928435781 Original CRISPR GAGGGTCCACACCCTGAGCA AGG (reversed) Intronic
902442519 1:16440458-16440480 GATGATCCACACCCAGACCACGG + Intergenic
902767773 1:18628663-18628685 GAGGGACCACACTGTGGGCAAGG + Intergenic
902844073 1:19095734-19095756 CAGGGTCTACACCATCAGCAGGG + Intronic
903193190 1:21668154-21668176 GAGGGACCACTACCTGTGCAGGG + Intronic
903704389 1:25274511-25274533 GAGGGTCCACAACCCAGGCAGGG + Intronic
903722851 1:25418804-25418826 GAGGGTCCACAACCCAGGCAGGG - Intronic
904160357 1:28518359-28518381 GAGCGGCCACAGCCGGAGCACGG + Intronic
905089796 1:35420476-35420498 AAGGGCCCACACCCAGAGAAGGG - Exonic
905418175 1:37819088-37819110 GAGGGTCCACACCAGGAGGGCGG + Intronic
907158703 1:52356226-52356248 GAGGGTCGAGGCCCTGAGCCTGG + Exonic
910080341 1:83334288-83334310 TAGGGTCCACCACCTGAGCTGGG - Intergenic
910110770 1:83680663-83680685 AAGGGATCACAGCCTGAGCAAGG + Intergenic
915508073 1:156369837-156369859 TAGGGGCTCCACCCTGAGCATGG + Intronic
917919972 1:179743267-179743289 GAGGCTCCACGCCCGGAGCAGGG + Exonic
919814340 1:201428258-201428280 GAGCCTCCACACCCTGAGCCCGG + Intronic
922349291 1:224722565-224722587 CAGGGACCACACTTTGAGCAGGG + Intronic
923049588 1:230381501-230381523 GAGGGTCCAGCCTCTGATCAGGG - Intronic
1062972883 10:1662043-1662065 GGAGGTCCACACCCTAAGCCCGG + Intronic
1064769604 10:18710511-18710533 GGGGGTCCCCTCCCTGAGGAGGG - Intergenic
1069776354 10:70929400-70929422 GAGTGTCCACCCCCAGATCATGG - Intergenic
1069987640 10:72295418-72295440 GAGGGACCACACACAGAGGAAGG + Intergenic
1072584693 10:96771036-96771058 GAGGTTTCAATCCCTGAGCAAGG + Intergenic
1074568202 10:114600686-114600708 GAGGGTCCTTACCCCGTGCAGGG + Intronic
1075785692 10:125048613-125048635 GGGACTCCACACCCTGGGCAGGG - Intronic
1076451798 10:130561429-130561451 GAAGATGCACACCCTGAGAATGG - Intergenic
1076491998 10:130868005-130868027 GGGGGACAATACCCTGAGCAAGG + Intergenic
1076638157 10:131896421-131896443 GAGGGTGCACAGGGTGAGCAGGG + Intergenic
1076837143 10:133026883-133026905 GTGGGACCACAGCCAGAGCAGGG + Intergenic
1076888139 10:133271885-133271907 GATGGGCCACAACCTGGGCATGG - Exonic
1076888829 10:133274368-133274390 GAGGGTCCACAGCCTCAGGCAGG + Intronic
1078009977 11:7565498-7565520 AAGGGTGGACACCCTGAGCAAGG - Intronic
1081131306 11:39383501-39383523 GAGGGTCCATTTCCTGAGAAAGG + Intergenic
1081528221 11:43941632-43941654 CAGGGTACTCACCCTCAGCAGGG + Intronic
1082795450 11:57375728-57375750 GAGGGGCCACATCCTTAGGAGGG - Intergenic
1083647085 11:64178271-64178293 GAGGGTTCAAACCCTGGGGAGGG - Intergenic
1083682576 11:64358263-64358285 GAGGCCCCACACCCTGAGGCCGG - Intergenic
1083903391 11:65654764-65654786 GTGGGGCCACAGCCTGAGGAGGG + Exonic
1084266588 11:68008329-68008351 GAGGGTCCCCTCCCTGGCCAGGG - Intergenic
1084934743 11:72580852-72580874 GAGGGTCCCCACTGTGAGCAGGG + Intronic
1085439877 11:76550239-76550261 TAGGGTCCACAGCCTAAGTACGG - Exonic
1093757166 12:22865722-22865744 CAGGGGCCACAGCGTGAGCAGGG - Intergenic
1097171869 12:57119416-57119438 GAGGCTCCACAGCCTGGGCAAGG + Intronic
1099577034 12:84394353-84394375 GAGGTGCCATACCCTGAGGAAGG + Intergenic
1099588030 12:84546293-84546315 GAGGGGCCAAACCATTAGCAAGG - Intergenic
1103686810 12:122738643-122738665 GAGGATTCACATCCCGAGCAGGG + Intergenic
1104759652 12:131289307-131289329 CAGGGTCCCCACGCTGACCACGG + Intergenic
1106354911 13:28972207-28972229 CAGGGTCCACACCCTGGGTGGGG + Intronic
1107043864 13:35975441-35975463 GAGGGTCCACTCCCTGTTCCTGG + Intronic
1109516139 13:63444291-63444313 AATGGTCCACACCCTCAGGAAGG + Intergenic
1111033104 13:82633032-82633054 GAGAGTCTACATCCTGGGCAAGG + Intergenic
1113587926 13:111478266-111478288 GAGTGTCCGCCCCCTGAGGATGG + Intergenic
1116835700 14:49767773-49767795 GAGGGTTCACAGCCCGGGCAGGG - Exonic
1121814917 14:96921789-96921811 AATGGTCCAGACCCTGAGTAGGG - Intronic
1125919275 15:43515944-43515966 CAAGGGCCACACCCTGGGCATGG - Intronic
1128760029 15:70210284-70210306 GAGGCACCACCCCCAGAGCATGG - Intergenic
1129028882 15:72604593-72604615 GAGGGTCCCTACCCTGATCCTGG - Intergenic
1131371266 15:91883823-91883845 GTGGGTCCACACCCCGTGCCAGG + Intronic
1132557953 16:580718-580740 CAGGGACCCCACCCTGAGCAGGG - Intronic
1132695503 16:1200058-1200080 GAGGGTCAAGACCCGGATCAGGG - Intronic
1134089438 16:11383805-11383827 CACTGTCCACACCCTGAGGAGGG + Intronic
1135661181 16:24297932-24297954 GAGGGTCCTCAGCCTGGGCCTGG + Intronic
1136995400 16:35185550-35185572 GAGGTCCCAGAGCCTGAGCAGGG + Intergenic
1139920218 16:70454919-70454941 GAGGATCCTCACCCTGAGGCAGG + Intronic
1140981492 16:80113764-80113786 AAGTGTCAACACTCTGAGCAAGG + Intergenic
1142116401 16:88358287-88358309 GAAGGTCCACACCCGGGGGAGGG + Intergenic
1142127367 16:88416871-88416893 GGGGGACCAGAGCCTGAGCAGGG + Intergenic
1142367188 16:89656908-89656930 GGGGGTCCAGGCCCTGGGCAAGG + Intronic
1147137865 17:38444472-38444494 GAGGGCCCCCACACTGAGCCAGG + Intronic
1147177703 17:38666667-38666689 GAGAGTCCACACCCTAAGGAGGG + Intergenic
1147259274 17:39198982-39199004 GAGAGTTCCAACCCTGAGCAGGG + Intergenic
1148238417 17:45984100-45984122 GTGCGGCCACAGCCTGAGCACGG - Intronic
1149849669 17:60027139-60027161 CAAGGTCCACATCCTGGGCAGGG - Intergenic
1149860499 17:60119385-60119407 CAAGGTCCACATCCTGGGCAGGG + Intergenic
1151144668 17:72029980-72030002 GAGTTTCCACTCCCTGAACAAGG - Intergenic
1151345976 17:73501418-73501440 CAGTGTCCACACCTTGAGGAGGG + Intronic
1151360366 17:73585005-73585027 TAGGGTCCACACACTGCTCAGGG + Intronic
1152500558 17:80705865-80705887 GAGAGGACACACCCTGAGGAGGG - Intronic
1152717744 17:81907980-81908002 GAGGGTCCCCTTCCTGTGCAAGG + Intronic
1161030434 19:2055670-2055692 TGAAGTCCACACCCTGAGCAGGG + Intergenic
1163471584 19:17500421-17500443 CATGGTCCCCACCCGGAGCAGGG + Intronic
1163492498 19:17625051-17625073 GAGGGCCCACAGCCTGTACAGGG + Intronic
1164399446 19:27892647-27892669 GAGGGGGAATACCCTGAGCAGGG - Intergenic
1167710414 19:51107092-51107114 GGGGGTCCACGTCCTGAGGAAGG + Intronic
1168560411 19:57377292-57377314 GACGGAACACACCCCGAGCAGGG + Exonic
1168568422 19:57443455-57443477 GATGGAACACACCCTGAGCAAGG + Exonic
928435781 2:31253691-31253713 GAGGGTCCACACCCTGAGCAAGG - Intronic
932310778 2:70738507-70738529 GAGGGTACAGACCCTGAGCTAGG - Intronic
932760609 2:74436810-74436832 AAGGGTCCAGATCCTGAGCCAGG - Intronic
937688418 2:124724352-124724374 GAGGTTCCACACCCTCGCCAGGG + Intronic
942194230 2:173501572-173501594 GAGGGTACAAACCCATAGCAGGG + Intergenic
944379161 2:199087091-199087113 GAGAGTCCACTCGCTGAGCTTGG + Intergenic
945430205 2:209755098-209755120 GAGGGTGCAGACCCTGGGGAAGG + Intergenic
946371884 2:219286053-219286075 GAGGGTCCCCTCCCAGCGCATGG - Exonic
948606413 2:239138695-239138717 GAGAGGCCACCCCCAGAGCACGG - Intronic
949057391 2:241935953-241935975 GGTGGTCCACACAATGAGCATGG + Intergenic
1171389849 20:24794416-24794438 GAGAGGCCACAGCCTAAGCATGG - Intergenic
1171458267 20:25283890-25283912 GTGGGTCCACACCAAGAGTAGGG - Intronic
1171493408 20:25538007-25538029 GAGAGTCCCCAGCCTGGGCAGGG - Intronic
1172105988 20:32517604-32517626 CTGGGTCCACACCCTGGACAGGG - Intronic
1174171452 20:48620334-48620356 GTGGCTCCAGACCCTGAGCCCGG - Intergenic
1179537168 21:42060214-42060236 GAGGGGACACACCCTGTGCACGG + Intergenic
1179911216 21:44449924-44449946 GAGGGTCCCCACGCTGAGTGAGG + Intergenic
1183746622 22:39695440-39695462 GAGGGGTCATACCCAGAGCAGGG - Intergenic
1184608145 22:45586111-45586133 CAGGGGCCACCCACTGAGCAGGG - Intronic
950270470 3:11610592-11610614 CAGGGTCCACACCCTGGACTGGG + Intronic
953615110 3:44482915-44482937 GAGCCTCCACACCCTGTGCTGGG - Intergenic
953845379 3:46422399-46422421 GAGGGTCCACACCATAAAGAAGG - Intergenic
954302001 3:49705139-49705161 GAAGGTCCGCACGCTGAGCGTGG + Exonic
954671625 3:52294189-52294211 GAGGGTTCTGACACTGAGCAAGG - Intergenic
955299540 3:57764127-57764149 AAGGGTCCACATCCTAAGCTTGG - Intronic
955402077 3:58599455-58599477 GATTGTCCACACCTTCAGCAAGG + Intronic
960799413 3:121522851-121522873 GGTGGTACACACCTTGAGCAAGG - Intronic
962399980 3:135049973-135049995 GAGGAGCCCCACCCTGGGCATGG + Intronic
966936844 3:184716198-184716220 GAGGTTCAGCACCCTGTGCAAGG - Intergenic
967824744 3:193869359-193869381 GAGGAGCCCCACCCTGAGCCAGG + Intergenic
968509590 4:989559-989581 GAGGTCCCACACCTTGCGCAGGG + Exonic
968647221 4:1746923-1746945 GGGGGCCCACACCCTGTGCTTGG - Intergenic
968737092 4:2303302-2303324 GAGGGTCCTCACACTGGGGAAGG - Intronic
970711857 4:18873147-18873169 GAGGGTACAAACCCATAGCAAGG - Intergenic
971330193 4:25675727-25675749 GCTGGTCCACAGCCTGGGCATGG + Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
975172580 4:71249385-71249407 GAGGGTCCAGACTCAGAACAAGG - Intronic
976348178 4:84029420-84029442 GAGGGTCAACCCCCTGATCAAGG - Intergenic
978562843 4:110051833-110051855 GAGGGTAGACATCCTGAGCTAGG + Intronic
981034157 4:140152859-140152881 GAGGAACCACACGCTGATCATGG - Exonic
985781212 5:1872752-1872774 GCTGGTCCAGCCCCTGAGCAGGG - Intergenic
987114331 5:14714216-14714238 GAGGGCCCACACCATTAGGAGGG - Intronic
992087269 5:73289139-73289161 GTGGGTCCTCACCCTGAGTGAGG - Intergenic
995583625 5:113624619-113624641 TGAGGTCCACACCCTGAGGAAGG + Intergenic
996697662 5:126416713-126416735 GAAGGTACAGACCCTGAGCCAGG - Intronic
999229291 5:150052325-150052347 GAGCTTCCATTCCCTGAGCATGG + Exonic
999702306 5:154239298-154239320 CAGGGTCATCACCCTGGGCAGGG + Intronic
1001793687 5:174483606-174483628 GAGGGACCACACCTAGAGCCAGG - Intergenic
1004251035 6:14023354-14023376 CTGGGGCCACACCCTGAGGACGG - Intergenic
1004867466 6:19868453-19868475 GAGTGTCCCCACCTTCAGCAAGG + Intergenic
1005816350 6:29555865-29555887 GAGGGTGACCACCCTGGGCATGG - Exonic
1007407881 6:41645218-41645240 GAGCGTCCACACACTCAGCCAGG - Intronic
1007416303 6:41693501-41693523 GAGGGTCTCCACACAGAGCAGGG + Intronic
1007744624 6:44035868-44035890 GAGGGTGCACGGCCTGAGGAAGG + Intergenic
1011109237 6:83818659-83818681 TAGGATCTACACCCTCAGCAAGG - Intergenic
1013231442 6:108165066-108165088 CCGGGTCCACGCCCTGAGGAGGG + Intronic
1013828907 6:114249600-114249622 GAGGGGTCGTACCCTGAGCAAGG - Intronic
1016151173 6:140744972-140744994 GATGGTGCCCACCCTGATCAAGG + Intergenic
1017770231 6:157638912-157638934 CAGCGCCCACAGCCTGAGCAAGG + Intronic
1017823398 6:158064690-158064712 GAATGGCCACAGCCTGAGCAAGG + Exonic
1019558978 7:1646593-1646615 GAGGGTCCATCCCCTGGGGAGGG - Intergenic
1020261024 7:6530937-6530959 GAGGGTGCCCACCCAGGGCAGGG + Intronic
1020879729 7:13744881-13744903 GAGGGTACACAGTCTAAGCAAGG - Intergenic
1023343224 7:39244708-39244730 GAAGGTCCACATTCTGAGCCAGG + Intronic
1025109233 7:56199086-56199108 GAAGGTCCACACCCTAAAGATGG + Intergenic
1027298114 7:76799554-76799576 TAGGGTCCACCACCTGAGCTGGG - Intergenic
1029170785 7:98627809-98627831 CAGGGTTAAGACCCTGAGCAGGG - Intronic
1031980984 7:128124132-128124154 GAGGCTCCACAGACTGGGCACGG - Intergenic
1035373219 7:158392187-158392209 CAGAGTCCTCACCCTGAGGATGG - Intronic
1037487647 8:19363739-19363761 GAGGATCCCCCGCCTGAGCATGG - Intronic
1037598202 8:20372312-20372334 GCAGTTCCACACTCTGAGCAGGG + Intergenic
1038898516 8:31814978-31815000 GAGGATCCACACCCTGTCCTAGG + Intronic
1040701145 8:50067694-50067716 GAGGATCCACACCCTGATTTTGG + Intronic
1041584487 8:59499897-59499919 GAGAGTGCACACCCTCAGCAGGG + Intergenic
1042207255 8:66341910-66341932 GAGGTTTCAGTCCCTGAGCAAGG - Intergenic
1042766907 8:72331901-72331923 GAGGCCCCATACCTTGAGCAAGG - Intergenic
1048962611 8:139593305-139593327 CAAGGGCCAGACCCTGAGCAAGG + Intergenic
1049207974 8:141372176-141372198 GAGGGTCCTCACAGAGAGCAAGG + Intergenic
1051145932 9:14027271-14027293 GAGGATGGACACTCTGAGCACGG - Intergenic
1056938869 9:90938045-90938067 GGGGCTCCACACCCTGAGAGTGG - Intergenic
1057590601 9:96370075-96370097 GCATGTCCACTCCCTGAGCATGG + Intronic
1057625536 9:96673204-96673226 GAAGGGCCAGACCCTAAGCATGG - Intergenic
1061185251 9:129049221-129049243 CAGCGTCCACACCCTCAGAATGG - Intronic
1061190841 9:129081692-129081714 GTGGTGCCACGCCCTGAGCAGGG + Intronic
1061400239 9:130364636-130364658 GAGGGGCCACACCCTGGGTCAGG - Intronic
1061861852 9:133472393-133472415 GAGGGCCCAGCCCCTGAGGAAGG - Intronic
1062003564 9:134228587-134228609 GCGGGTCCACCGCCTGAGCAAGG + Intergenic
1062732715 9:138118782-138118804 GAGGGTCCAGGCCCTGGGCTGGG + Intronic
1198701796 X:139405081-139405103 CATGGTCCACACCCTCAACATGG - Intergenic
1200966558 Y:9044497-9044519 GGGGGGCCATACCCTGAGTAAGG - Intergenic