ID: 928436716

View in Genome Browser
Species Human (GRCh38)
Location 2:31259194-31259216
Sequence TGCCACGGGGGAGTGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928436703_928436716 12 Left 928436703 2:31259159-31259181 CCCAAGAAAGGGCTCCTACCTTG 0: 1
1: 0
2: 1
3: 10
4: 122
Right 928436716 2:31259194-31259216 TGCCACGGGGGAGTGGCAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 308
928436707_928436716 -2 Left 928436707 2:31259173-31259195 CCTACCTTGGTGCCAGAGGTATG 0: 1
1: 0
2: 0
3: 7
4: 139
Right 928436716 2:31259194-31259216 TGCCACGGGGGAGTGGCAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 308
928436704_928436716 11 Left 928436704 2:31259160-31259182 CCAAGAAAGGGCTCCTACCTTGG 0: 1
1: 0
2: 2
3: 15
4: 159
Right 928436716 2:31259194-31259216 TGCCACGGGGGAGTGGCAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 308
928436708_928436716 -6 Left 928436708 2:31259177-31259199 CCTTGGTGCCAGAGGTATGCCAC 0: 1
1: 0
2: 2
3: 7
4: 94
Right 928436716 2:31259194-31259216 TGCCACGGGGGAGTGGCAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928436716 Original CRISPR TGCCACGGGGGAGTGGCAGG AGG Intronic
900555836 1:3279866-3279888 TGCCCGGGGGGGGTGGGAGGAGG - Intronic
900949336 1:5849177-5849199 TGCCACGGGGGTTTGGAAAGGGG - Intergenic
901453995 1:9352940-9352962 TGCCACAGTTGAGCGGCAGGGGG + Intronic
901534489 1:9873397-9873419 TGGCCCTGGGGAGTGGCTGGGGG - Intronic
901853870 1:12031844-12031866 TGCCAGAGGGGAGAGGCTGGAGG - Exonic
902565167 1:17306599-17306621 TTCTACTGGGAAGTGGCAGGAGG - Intergenic
902927111 1:19703385-19703407 TGCCACAAGGGGGAGGCAGGGGG - Intronic
903036237 1:20494426-20494448 TGCCACTGGTGTGGGGCAGGGGG - Intergenic
904344939 1:29861598-29861620 TGCAATGGGGCAGTGGCAGAGGG + Intergenic
904395796 1:30221006-30221028 TGACACAGGGGTGTGGCCGGGGG + Intergenic
905179400 1:36156831-36156853 TGCCACGGGGGATGGGGAAGGGG - Intronic
906155789 1:43613222-43613244 TGCCACCGGTGAGGGGCAGGAGG + Intronic
906665069 1:47615681-47615703 TGCAACGGGGGTTTTGCAGGAGG + Intergenic
911176998 1:94826974-94826996 TGCCCCTGGGGAGCTGCAGGAGG + Intronic
912495556 1:110089175-110089197 TGCCCCGGGGGATGGGCTGGTGG + Intergenic
912638396 1:111320336-111320358 TGCCACGGGGTAGAGGCCGTTGG - Exonic
915604952 1:156944660-156944682 TGGCACGTGGTAGGGGCAGGTGG - Intronic
915931246 1:160062188-160062210 GGCCAGGGGGGATGGGCAGGAGG - Intronic
917958671 1:180125622-180125644 TGCCTCGGGGGATAGGCAAGGGG - Intergenic
918398965 1:184144664-184144686 TGCCACCAGGGACTGGCATGGGG + Intergenic
919656832 1:200205187-200205209 AGCCACAAGGGAGTGGCTGGAGG + Intergenic
919770573 1:201155603-201155625 TGGCAGGGGGCAGGGGCAGGAGG + Intronic
920204312 1:204280700-204280722 TGCCACAGAGGAGGGGAAGGTGG + Intronic
920443184 1:205995104-205995126 TGTCACGGGGTGGGGGCAGGGGG + Intronic
922605646 1:226888324-226888346 TGACACAGGGGAGTGGAAGTGGG + Intronic
1065252885 10:23834836-23834858 TGCCATGGAGGGGTGGCAGGTGG + Intronic
1065996323 10:31062640-31062662 TGCCACGGGAGAGTGTAAAGAGG + Intergenic
1066004409 10:31133816-31133838 TGGCGCGGGGGAGGGGCGGGAGG - Intergenic
1066745706 10:38603230-38603252 TGGCACGGGGCAGTGACAGGAGG + Intergenic
1067064781 10:43097524-43097546 TGCCACATGGGATTGGGAGGGGG + Intronic
1067436456 10:46282614-46282636 TGCCCCTGGAGGGTGGCAGGGGG - Intergenic
1067533485 10:47091597-47091619 AGCCAAGGGTAAGTGGCAGGAGG - Intergenic
1067772639 10:49138432-49138454 ACCCACTGGAGAGTGGCAGGGGG - Intergenic
1069111814 10:64456758-64456780 TGGCAGGGGGGAGGGGGAGGGGG - Intergenic
1069253697 10:66305004-66305026 TGCCACCAGGGAGAGGCAGAAGG - Intronic
1069320481 10:67165344-67165366 AGGCACGGGGCAGGGGCAGGTGG + Intronic
1069630191 10:69892938-69892960 TGTGATGGGGGAGGGGCAGGCGG - Intronic
1070610155 10:77927063-77927085 GGCCACGGGGGAGCGGGTGGCGG - Intergenic
1071250888 10:83818407-83818429 TACAAAGGGGTAGTGGCAGGAGG - Intergenic
1071732294 10:88260242-88260264 TGCCACAGGGAAGTGGCTGCAGG - Intergenic
1072053598 10:91730788-91730810 AGCCAAGGGGGAGTGGGTGGTGG + Intergenic
1072631340 10:97149035-97149057 GGCCACGGGGGGGTGGCGAGCGG - Intronic
1073179203 10:101573900-101573922 GGCCAGGTGGGAGGGGCAGGAGG - Intronic
1076259596 10:129054993-129055015 TGGCACAGGGGAGGGGCATGGGG - Intergenic
1076873488 10:133204903-133204925 TGCCACGGGGCAGGGGCACCTGG - Intronic
1077158165 11:1100672-1100694 TGCAGCTGGGGAGTGGCAGTTGG + Intergenic
1077284867 11:1761118-1761140 TGACAGGGGCCAGTGGCAGGAGG + Intronic
1077635996 11:3841367-3841389 AGCCCCGGGGGAGTGCGAGGTGG + Intergenic
1077689456 11:4328002-4328024 TTCCACTTTGGAGTGGCAGGTGG + Intergenic
1078398038 11:10999389-10999411 TGGCAGGGTGGAGTGGCAGCTGG + Intergenic
1078527573 11:12111841-12111863 TGCCACTGGGGAGGGGGAGCAGG - Intronic
1081755617 11:45542256-45542278 TGCCACGGAGGAGGAGAAGGTGG - Intergenic
1084129083 11:67119480-67119502 TGCGACTGGGGAGTAGCCGGGGG + Intronic
1084419577 11:69053577-69053599 TGCCTGGGGAGCGTGGCAGGGGG + Intronic
1084422457 11:69067140-69067162 GGCTACGGGGCAGAGGCAGGAGG - Intronic
1085202645 11:74710993-74711015 TGCAGTGGGGGAGGGGCAGGAGG + Intronic
1086121027 11:83304463-83304485 TGTCCCTGGGGAGAGGCAGGAGG + Intergenic
1087528810 11:99353039-99353061 TGGCAGGGGCAAGTGGCAGGTGG - Intronic
1088715049 11:112541804-112541826 TGCCAAGAGGCAGTGGCTGGAGG - Intergenic
1089323197 11:117640198-117640220 TGCCAGGTGGGAGTGGCAAGTGG - Intronic
1089738168 11:120564077-120564099 TGTCCCGGAGGAGTGGCTGGTGG + Intronic
1089895700 11:121928151-121928173 GGCCACGGGGGTGGGGTAGGGGG + Intergenic
1091004253 11:131938295-131938317 AGCCCCGGGGGATGGGCAGGAGG + Intronic
1091496432 12:977227-977249 TGCCAAGGGGGAGGGACAAGAGG - Intronic
1091562452 12:1625491-1625513 TGGGACAGGGGAGGGGCAGGTGG - Intronic
1091887920 12:4030419-4030441 TGTCACGTGGGAGTAGCAGTGGG + Intergenic
1091994051 12:4978919-4978941 TGCCCGAGGGGAGGGGCAGGAGG + Intergenic
1096498923 12:52053974-52053996 CCCCATGGGGGAGGGGCAGGGGG + Intronic
1097616113 12:61886378-61886400 TTCCATGGGGCAGTGGCAGTGGG - Intronic
1102416368 12:112766478-112766500 TCCCATGGGAGACTGGCAGGGGG + Intronic
1102466878 12:113135301-113135323 TGCCAGGGCGGGTTGGCAGGAGG - Intronic
1103075699 12:117980763-117980785 TGCCAGGGGGCAGGGGAAGGAGG + Intergenic
1103321405 12:120094685-120094707 TGGCAGGGGGCAGTGCCAGGCGG - Intergenic
1103917236 12:124382161-124382183 AGGCACAGGGGAGGGGCAGGAGG + Intronic
1105983661 13:25544853-25544875 GGCTACGGGGGAGGGGCAGAAGG + Intronic
1107170846 13:37341076-37341098 TGCAATGGGGGAGTTGCAGCTGG + Intergenic
1107841285 13:44459875-44459897 TGCCAAGGGTCAGTGGCAAGGGG - Intronic
1109233047 13:59782444-59782466 TGCCTCTGGGAAGTGGGAGGAGG + Intronic
1109594338 13:64530351-64530373 TGTCACAGGGGAGAGGCAAGTGG - Intergenic
1112811763 13:103226321-103226343 TGGCACTGGGTGGTGGCAGGAGG - Intergenic
1113678293 13:112223239-112223261 TGGCACGGGGAAGTGGCATGGGG - Intergenic
1113810510 13:113139506-113139528 TGCCCCTGAAGAGTGGCAGGTGG + Intronic
1118573297 14:67216077-67216099 TACCATGGGGGATTGGTAGGAGG - Intronic
1119140707 14:72264975-72264997 TGCCAGGAGGGAGTTGGAGGAGG + Intronic
1120383554 14:83814204-83814226 TCCCACGGTAGAGTCGCAGGAGG + Intergenic
1122437823 14:101711599-101711621 TGCCACAGGGGAGCAGCAGCTGG + Intergenic
1122848159 14:104512102-104512124 TGGCTCGGGGCAGTCGCAGGAGG + Intronic
1124641432 15:31398778-31398800 TGCCCTGGGGGAGAGGGAGGAGG - Intronic
1124713005 15:32030667-32030689 TCCCACGGAGGAGTGGAGGGCGG - Exonic
1127792219 15:62408155-62408177 TACCACAGTGGAGTGGCGGGTGG + Intronic
1129331012 15:74827068-74827090 GGCCAAGGGGGAGTGGGGGGAGG + Intronic
1129691177 15:77714475-77714497 TGGCAAAGGGCAGTGGCAGGGGG - Intronic
1132578488 16:674707-674729 TGCCTTTAGGGAGTGGCAGGTGG + Intronic
1132854392 16:2038417-2038439 TCCCAAGGGGGAGGGGAAGGGGG - Exonic
1132983793 16:2753040-2753062 TGTCATGGGGGAGGGGCGGGGGG - Intronic
1133235346 16:4384960-4384982 TGGCAGGGGGCAGTGGCGGGGGG + Intronic
1133890131 16:9871138-9871160 TGCCAGGTGGGTGTGACAGGAGG - Intronic
1133998243 16:10763334-10763356 TGCCTCGAGGAAGTGGTAGGGGG + Intronic
1134817600 16:17218905-17218927 TACCCTGGGGCAGTGGCAGGGGG + Intronic
1135117401 16:19735308-19735330 GGCCACTGGGGATTTGCAGGGGG + Intronic
1135533975 16:23278549-23278571 TGCCAGGGGGTAGTGGGAGACGG + Intronic
1136737359 16:32476418-32476440 TGGCACGGGGCAGTGACAGGAGG - Intergenic
1137687060 16:50393557-50393579 CACCACTGGGGAGGGGCAGGAGG - Intergenic
1137688035 16:50400550-50400572 CACCACTGGGGAGTGGCGGGAGG + Intergenic
1139508405 16:67411348-67411370 TGCCAATGGGGAGACGCAGGTGG + Intronic
1140170478 16:72599007-72599029 TGACACTGGAGAGTGGGAGGAGG + Intergenic
1203015711 16_KI270728v1_random:353159-353181 TGGCACGGGGCAGTGACAGGAGG + Intergenic
1203034046 16_KI270728v1_random:626317-626339 TGGCACGGGGCAGTGACAGGAGG + Intergenic
1143023335 17:3927816-3927838 TGCCCCAGGGGAGTGGGTGGAGG - Intronic
1143622369 17:8087904-8087926 AGCCAATGGGGACTGGCAGGAGG - Intergenic
1143893545 17:10120098-10120120 TGTCACGGGGCGGGGGCAGGGGG - Intronic
1144705255 17:17363755-17363777 AGCCACAGGGGAGGGCCAGGCGG - Intergenic
1144960289 17:19040754-19040776 TGGCATGTGGGACTGGCAGGAGG - Intronic
1144974871 17:19133770-19133792 TGGCATGTGGGACTGGCAGGAGG + Intronic
1145011778 17:19372406-19372428 GGCCAGAGGGAAGTGGCAGGAGG - Intronic
1145924937 17:28639784-28639806 TGTAACTGGGGAGTGGAAGGAGG - Intronic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1147015792 17:37490204-37490226 CGCGGCGGGGGAGCGGCAGGGGG - Intronic
1147324208 17:39662654-39662676 TGCCAGGGGTGAGTGGGAGAGGG + Intronic
1149223514 17:54441732-54441754 TGTCAGGGGGTAGGGGCAGGGGG + Intergenic
1149710968 17:58741859-58741881 TTCCACGGACGAGGGGCAGGGGG - Intergenic
1149891469 17:60393127-60393149 TGCCACGGACCAGTGGGAGGGGG - Intronic
1150283124 17:63940808-63940830 TGCCCTGGGGGAGGGGCGGGAGG + Exonic
1150466734 17:65399661-65399683 TGACAAAGGGGATTGGCAGGTGG - Intergenic
1150489040 17:65561771-65561793 GGCCGCGGGGGGCTGGCAGGGGG - Intronic
1150701790 17:67453504-67453526 GGGCAGAGGGGAGTGGCAGGCGG - Intronic
1150722514 17:67625643-67625665 TGCCACGGAGCAGTGGGAAGTGG - Intronic
1150887062 17:69099353-69099375 TGCCATGGGGAAGTGGGAGTGGG + Intronic
1151200776 17:72466325-72466347 TGACAGTGGGGAGTGGAAGGGGG - Intergenic
1151429630 17:74053576-74053598 TGCTACCTTGGAGTGGCAGGTGG - Intergenic
1151625082 17:75271279-75271301 TGCCCCGGGGGCCCGGCAGGTGG - Intergenic
1151829431 17:76540850-76540872 AGGCACAGGGGAGTGGAAGGAGG + Intronic
1152577832 17:81150662-81150684 TTCCACGTGGCAGTGCCAGGGGG - Intronic
1152733950 17:81987581-81987603 TGCCACTGGGGAGGGGCCGAGGG + Intronic
1152822018 17:82442246-82442268 TGCCGTGGAGGAGTGGCTGGAGG + Exonic
1153220116 18:2853816-2853838 TGTCAGGGTGGAATGGCAGGAGG + Intronic
1153404271 18:4718503-4718525 AGCCAAGGAGGAGTGTCAGGAGG + Intergenic
1155228836 18:23754334-23754356 TGCCAGGGGCCAGTGGTAGGAGG - Intronic
1155341629 18:24819414-24819436 TTCCAAGGGGCAGGGGCAGGTGG + Intergenic
1155914273 18:31540646-31540668 TGCCAAATGGGAGTGGCAGATGG + Intronic
1156465216 18:37344390-37344412 TGCCACGGGGCAGAGACAGGGGG + Intronic
1156474765 18:37398494-37398516 AGCCTCGGGGCAGTGGGAGGAGG + Intronic
1156545076 18:37956268-37956290 TGCCACAAAGGAGTGGCTGGAGG - Intergenic
1156733867 18:40229215-40229237 TGCCAGGGGGTAGTGGGAGACGG - Intergenic
1157329108 18:46690291-46690313 TGCCATGAGGGAGTGTCAGGTGG - Intronic
1157700887 18:49761119-49761141 TGCCTAGGGGCAGGGGCAGGTGG + Intergenic
1158444371 18:57506416-57506438 TGAGACGGGGCAGTGGCAGAGGG - Intergenic
1158787910 18:60739301-60739323 TGCAGCGGGGGAGAGGCAGCTGG + Intergenic
1160369195 18:78357182-78357204 TGCCACTGAGGAGCTGCAGGAGG + Intergenic
1160802307 19:976012-976034 AGCCAGGGGTGAGTGGAAGGGGG + Intergenic
1161195526 19:2984139-2984161 TCCCGGGGGAGAGTGGCAGGCGG - Intronic
1161470737 19:4455735-4455757 TTCTCCGGGGGAGTGGGAGGAGG + Intronic
1161936672 19:7376486-7376508 TGGCTGGGGGGAGTGGCTGGAGG + Intronic
1162021928 19:7872057-7872079 TGCGAGGGGGGCGTGGCTGGTGG + Exonic
1162193203 19:8963355-8963377 TGTAACGTGGAAGTGGCAGGAGG + Exonic
1162477288 19:10908190-10908212 TCCTGCGGGTGAGTGGCAGGGGG - Intronic
1162495189 19:11019497-11019519 TGTCACTGGGCAGTTGCAGGGGG + Intronic
1163466689 19:17471922-17471944 TGGATGGGGGGAGTGGCAGGTGG - Intronic
1163775292 19:19213728-19213750 TGGCACGGGGGTGTGGGACGTGG + Intronic
1164502435 19:28831285-28831307 GGCCAGGGGGGAGCAGCAGGTGG + Intergenic
1164585940 19:29476143-29476165 TGCCCCAGGGGAGTCCCAGGAGG + Intergenic
1166100112 19:40566589-40566611 TGGGATGGGGGAGTGGGAGGGGG + Intronic
1167112825 19:47471958-47471980 GGACACGGGGGAGGGGGAGGCGG + Exonic
1168060395 19:53888922-53888944 TGTGCAGGGGGAGTGGCAGGGGG - Intronic
925306476 2:2850742-2850764 TGGCAGGTGGGGGTGGCAGGTGG - Intergenic
925464078 2:4090375-4090397 TTCCTCGGGGGAGGGGAAGGTGG + Intergenic
927521878 2:23703893-23703915 TGGGACGGAGGAGTGGGAGGAGG + Intronic
927662003 2:25001160-25001182 TGCCTAGAGGGAGTGGGAGGAGG - Intergenic
928436716 2:31259194-31259216 TGCCACGGGGGAGTGGCAGGAGG + Intronic
928723717 2:34148021-34148043 TGCCCCGGGGGAGTGGAGAGAGG + Intergenic
929576854 2:43057443-43057465 TGCCAGGGGCCAGTGGCAGCTGG + Intergenic
929651350 2:43682731-43682753 TGCCAGGGGCTAGTGGGAGGGGG - Intronic
930188245 2:48431513-48431535 TGCCAGGGGTGGGGGGCAGGAGG + Intergenic
932152629 2:69387095-69387117 GGCCAGGGGCGAGTGGCTGGCGG + Exonic
934308107 2:91842422-91842444 TGGCACGGGGCAGTGACAGGAGG + Intergenic
935131826 2:100266391-100266413 AGGCACATGGGAGTGGCAGGCGG - Intergenic
935463025 2:103361823-103361845 GGCGGCGGGGGAGGGGCAGGCGG - Intergenic
935584031 2:104784670-104784692 TGCTGCTGGGGAGTGGCTGGTGG - Intergenic
936278454 2:111119684-111119706 TGCAGCGGGGGTGTGGGAGGTGG - Intronic
936623044 2:114120004-114120026 TCCCAAGGAGGAGTGGCAGGGGG + Intergenic
937926868 2:127174452-127174474 TGCCAGGTGGGAATGGGAGGGGG - Intergenic
938778022 2:134559233-134559255 TGCCACAGGGGCCAGGCAGGTGG - Intronic
939799443 2:146690176-146690198 TCGCAGTGGGGAGTGGCAGGGGG - Intergenic
941754731 2:169173065-169173087 GGCCACAGGGGAGTGGAGGGAGG - Intronic
944667374 2:201968897-201968919 TGCCTCGGGGAAGGGGAAGGAGG - Intergenic
946054650 2:216890078-216890100 TAACATGGAGGAGTGGCAGGAGG - Intergenic
946956076 2:224931326-224931348 GGCCACTGGGGACTGGGAGGAGG - Intronic
947379222 2:229528904-229528926 TGTCCCGGGGCTGTGGCAGGTGG + Intronic
947535897 2:230940265-230940287 TGCCAAGGGTGGGTGCCAGGAGG - Intronic
1168837975 20:890415-890437 TGACACGTGGGAGGGACAGGGGG - Intronic
1169384382 20:5135843-5135865 TGTCCCTGGGGAGAGGCAGGCGG - Intronic
1170253902 20:14318316-14318338 AGCCACGGGGGTGTGGAAGTTGG - Intronic
1170255942 20:14343190-14343212 GGGCACTGGGGAGTGGCAAGGGG - Intronic
1172196916 20:33098139-33098161 TGCCACAGGGGGATGGCAGTAGG + Intronic
1172312654 20:33930295-33930317 AGCCACGGGGGAGAGGCACAGGG - Intergenic
1173738150 20:45376263-45376285 TGCCACTGGGGGTTTGCAGGGGG - Intronic
1175457449 20:59126217-59126239 TGACACGGGGGAGAGAGAGGGGG - Intergenic
1175899105 20:62353091-62353113 GGCCTGGGGGGAGAGGCAGGGGG - Intronic
1176520194 21:7818471-7818493 TGCAAGGGAGGAGTGGAAGGCGG + Exonic
1178567174 21:33698338-33698360 TGTTAGGGGGGAGTGGCAGCAGG - Intronic
1178654220 21:34448483-34448505 TGCAAGGGAGGAGTGGAAGGCGG + Intergenic
1179618129 21:42594896-42594918 TGCCACCGGGATGAGGCAGGAGG + Intergenic
1180095426 21:45553918-45553940 GGGCACGGGGGACTGGGAGGGGG - Intergenic
1180151570 21:45950817-45950839 TGCCACGGGGCAGTGCCAACAGG - Intergenic
1180535189 22:16389505-16389527 TGGCACGGGGCAGTGACAGGAGG + Intergenic
1180833876 22:18920117-18920139 TGTCACATGGGAGTTGCAGGGGG - Intronic
1181488136 22:23244540-23244562 GGCCACGGGAGAGAGGCAGGTGG - Intronic
1181612963 22:24031264-24031286 TGCCTCTGTGGGGTGGCAGGGGG + Intronic
1181694557 22:24586410-24586432 GGCTATGGGAGAGTGGCAGGTGG + Exonic
1182296094 22:29311824-29311846 TGCCAAGGGGCAGGGGCAGTGGG + Intronic
1182360306 22:29742607-29742629 TTCCACGGAGGAGTGGAAGCAGG + Intronic
1183429411 22:37756687-37756709 TGCCGAGTGGGTGTGGCAGGTGG - Intronic
1183784387 22:40021200-40021222 GGCCACAGCGGAGGGGCAGGTGG + Intronic
1183898209 22:40985794-40985816 TGCCCAGGGTGGGTGGCAGGAGG + Intergenic
1184105971 22:42367836-42367858 TGCCACAGGGGAAGGGCAGAAGG - Intergenic
1184651563 22:45921593-45921615 TGCCGCGGGGGTCAGGCAGGTGG - Exonic
1184774899 22:46618268-46618290 TGCCCCGGGGGAGCACCAGGCGG + Intronic
1184902489 22:47456532-47456554 TGCCACAGGGGAGGGGCCAGAGG + Intergenic
1203283962 22_KI270734v1_random:145415-145437 TGTCACATGGGAGTTGCAGGGGG - Intergenic
950154693 3:10712746-10712768 AGGCACAGGGGAGAGGCAGGAGG + Intergenic
950636860 3:14321543-14321565 TGCCACAGGACAGAGGCAGGTGG + Intergenic
950662767 3:14476995-14477017 TGGCTCCGAGGAGTGGCAGGCGG + Intronic
950861941 3:16155827-16155849 TGCCAGGGGGCAGTGGGTGGGGG - Intergenic
952956744 3:38562373-38562395 TCCCACCAGGGAGTGGGAGGCGG - Intronic
953179428 3:40582372-40582394 TGCAAAGGGGGAGGGGCAGGAGG + Intergenic
953190738 3:40685095-40685117 TGCCCCTGGGGAGTGGAATGAGG - Intergenic
953768760 3:45763237-45763259 TGCCACGTGTGTGGGGCAGGGGG + Intronic
954151350 3:48658872-48658894 TGTCACAGGTGAGGGGCAGGGGG - Exonic
958110949 3:89144240-89144262 TGCCATGGATGAGTGGGAGGAGG - Intronic
961361237 3:126369017-126369039 TGCCAGGGGCTAGTGGGAGGGGG - Intergenic
961453061 3:127011215-127011237 GTCCACTGGGGAGAGGCAGGTGG - Intronic
961525237 3:127492622-127492644 TGCCACAGGGGAGTGGGCAGGGG + Intergenic
961677498 3:128576637-128576659 TACAAAGGGGGAGTGGCAGGAGG + Intergenic
961738098 3:129014943-129014965 TGCGACTGGAGAGTAGCAGGTGG - Intronic
961790325 3:129371277-129371299 AGCAAGTGGGGAGTGGCAGGCGG + Intergenic
962742465 3:138371891-138371913 TGACAAGGAGGAGAGGCAGGAGG - Intronic
962825287 3:139095469-139095491 TGCCAATGGGGAGGGGAAGGAGG - Intronic
963989733 3:151639346-151639368 TGCCACAGGAGAGTAGCAGCAGG + Intergenic
966623632 3:181993063-181993085 TGGCAAGGGGGAGGGGGAGGGGG + Intergenic
966872486 3:184299778-184299800 TGCCCCGGGTAAGTGGGAGGAGG + Intronic
967255855 3:187591227-187591249 GGCCCAGGGGGAGGGGCAGGGGG + Intergenic
967786541 3:193503021-193503043 TTCCACCGGGGCGGGGCAGGGGG + Intronic
968626560 4:1628716-1628738 TGGCATGGGGGAGTGGCATGGGG + Intronic
968626582 4:1628762-1628784 TGGCATGGGGGAGTGGCATGGGG + Intronic
968629014 4:1640811-1640833 TGCCCCGGGGCAGGTGCAGGCGG + Exonic
969529534 4:7723111-7723133 TGCCACGCGGGGATGGCAGTTGG + Intronic
969938663 4:10708099-10708121 TGACAGGAGGAAGTGGCAGGAGG + Intergenic
970424606 4:15934647-15934669 TGGCAGGGAGGAATGGCAGGTGG - Intergenic
971088522 4:23310552-23310574 TGCCATTGGGAAATGGCAGGAGG - Intergenic
971100223 4:23458353-23458375 TTCCACAGGGGAGTGTCATGAGG - Intergenic
975229215 4:71911024-71911046 TGCCACTGGGGACAGGCAGGAGG - Intergenic
975701903 4:77075375-77075397 TGCCACGGGGGCGGCGCGGGGGG + Intronic
975710884 4:77158339-77158361 GGCCAGGGAGGTGTGGCAGGGGG - Intronic
980615149 4:135210633-135210655 TGCCATGGTGGGGTGGAAGGAGG + Intergenic
982135457 4:152270619-152270641 TGGCACGGGGCAATGGCTGGCGG + Intergenic
983334994 4:166379534-166379556 TGACACTGGGGAGGGGCTGGAGG + Intergenic
985754893 5:1707708-1707730 TACCCCTGGGGAGTGGCAGCTGG - Intergenic
985789329 5:1916748-1916770 TGCCACCGGGCAATGCCAGGCGG + Intergenic
987078451 5:14405217-14405239 TGCCATCGGGGATTGGCAGTTGG + Intronic
992114977 5:73531251-73531273 TAGCACGGGGTAGTTGCAGGAGG + Intergenic
995077678 5:108005996-108006018 TGCCAGAGGGCAGTGTCAGGCGG - Intronic
997143149 5:131404787-131404809 TGCCAAGGGAGAGGGGCAGTGGG + Intergenic
998065011 5:139150955-139150977 TGCCAAGGGAGGGTGGCAGAGGG - Intronic
998882824 5:146661124-146661146 TGCCACTGGGCAGTGTCTGGAGG + Intronic
999044552 5:148453028-148453050 TGTCACAGGGGAGTGGAAGCTGG + Intronic
1002306493 5:178286772-178286794 TGCCCCGGGGGAGGGGCAGGGGG - Intronic
1002425086 5:179170260-179170282 GGCAATGGGGGAGCGGCAGGTGG + Intronic
1002579498 5:180199080-180199102 TGCCAGCAGGGGGTGGCAGGTGG - Intronic
1002723890 5:181282285-181282307 TGCCAGTGGCGGGTGGCAGGGGG + Intergenic
1002761966 6:209364-209386 TGCCAAGGACGAGGGGCAGGAGG - Intergenic
1005650166 6:27878715-27878737 TGCTGTGGGGGAGTTGCAGGTGG + Intergenic
1005764042 6:28993179-28993201 AGCTACTGGGGAGTGGGAGGCGG - Intergenic
1007563563 6:42830620-42830642 TGCCAGGGGGCAGGGGTAGGGGG + Intronic
1009389429 6:63127757-63127779 TTCCACGGGAGAGTGAAAGGAGG - Intergenic
1010571094 6:77475250-77475272 CTCCACGGGTGCGTGGCAGGAGG - Intergenic
1010949089 6:82013756-82013778 TCCCACAGGGGTGTGGTAGGGGG + Intergenic
1015639118 6:135311836-135311858 TACCACAGGGGAGTGGGAGCAGG - Intronic
1015947852 6:138521485-138521507 TTCCAGGGGGGTGAGGCAGGGGG - Intronic
1018455334 6:163946686-163946708 TGCCATGGTGGAGCGGCAGTTGG - Intergenic
1018865784 6:167746168-167746190 TGCCCAGAGGGAGAGGCAGGAGG - Intergenic
1018889535 6:167973569-167973591 TACCACCGGGTAGTGCCAGGTGG - Intergenic
1020070425 7:5223614-5223636 GGCCACGGGGGTGAGGAAGGGGG - Intronic
1021217877 7:17940038-17940060 TGCCAGGGGCGAGTGGCAAGTGG + Intronic
1021920187 7:25476758-25476780 TGACAAGGGGGGGTGGGAGGAGG + Intergenic
1022603037 7:31779690-31779712 TGCCACGGGCCATTGGCGGGGGG + Intronic
1023374530 7:39542812-39542834 TGTCATGGGTGAGTTGCAGGAGG + Intergenic
1024962990 7:54996972-54996994 TGAGACTGGGGAGTGACAGGTGG + Intergenic
1025152751 7:56573088-56573110 TGCCATGCTGGAGTGTCAGGCGG + Intergenic
1028109972 7:86928489-86928511 TCCCAGGTGGGAGTGGCGGGCGG + Intronic
1029710743 7:102298089-102298111 AGCCAGGGAAGAGTGGCAGGAGG + Intronic
1030319056 7:108145458-108145480 TGCAACGGGGGAGGGGGAGGTGG + Intergenic
1030766097 7:113411572-113411594 TGCCACGGGGGTGGGGGTGGGGG + Intergenic
1031296506 7:120010445-120010467 TGGGACTGGGGAGAGGCAGGAGG - Intergenic
1032474257 7:132201674-132201696 TGCCATGGGGGAGGAGCATGTGG + Intronic
1034422131 7:150995802-150995824 TGGGACGGGGGAGAGGGAGGAGG - Intronic
1034669709 7:152848822-152848844 AGCTACGGGGGGGTGGCAGCTGG - Intronic
1035125911 7:156607662-156607684 TGCCACGGAGGAGAAGCTGGGGG + Intergenic
1035299551 7:157887967-157887989 TGCCAAGGGTGGGAGGCAGGGGG - Intronic
1036638003 8:10564699-10564721 TGGCACACGGGAGAGGCAGGAGG + Intergenic
1036835263 8:12058865-12058887 TGTCATGGGGTAGTGGGAGGGGG + Intergenic
1036857105 8:12305429-12305451 TGTCATGGGGTAGTGGGAGGGGG + Intergenic
1038306920 8:26413338-26413360 TGCCTCCAGGTAGTGGCAGGAGG + Intronic
1043273477 8:78363226-78363248 TGCTACAGGAGAGTGGCAAGTGG + Intergenic
1043781009 8:84335062-84335084 TGGCAGAGGGGAGAGGCAGGAGG + Intronic
1044748476 8:95394167-95394189 TGACTCGGGTGAGTGGGAGGTGG + Intergenic
1048268499 8:133009011-133009033 GGCCAGGGGACAGTGGCAGGTGG + Intronic
1048943697 8:139425409-139425431 TGCCAGGGGTTAGAGGCAGGGGG + Intergenic
1049675395 8:143886778-143886800 TGCCGCGCAGGAGTGGCTGGAGG - Intergenic
1049749908 8:144278166-144278188 CGCCACTGGGCAGAGGCAGGCGG + Intronic
1049782639 8:144435876-144435898 TGCCCCGGGGGCGGGGCCGGCGG + Exonic
1049844782 8:144794717-144794739 TGCTACGGGGGCGCGGTAGGGGG - Intergenic
1052317358 9:27129468-27129490 TGCAAGGGGGAAGTGGCATGGGG - Intronic
1052330880 9:27266652-27266674 AGAAACGGGGGAGTGGGAGGAGG + Intergenic
1053314282 9:37038084-37038106 TGCGCTGGGGGAGTTGCAGGTGG - Intergenic
1056539668 9:87560491-87560513 TGCCAAGGGGTAGGGGAAGGGGG - Intronic
1060200645 9:121650277-121650299 GACCAGGGGGGAGGGGCAGGAGG - Intronic
1060934799 9:127508644-127508666 TGCCAGGGAGGAATGGCAAGCGG + Intronic
1060942508 9:127550983-127551005 TGCCCCAGGGAAGTGGCTGGCGG - Intronic
1061847704 9:133397102-133397124 CCCCACGGGGAGGTGGCAGGGGG + Intronic
1061908649 9:133711548-133711570 TGCCATGGAGGGGTGGCAGCTGG + Intronic
1061912912 9:133734309-133734331 TGCCATGGGGAAGTGGCAAGAGG - Intronic
1185740403 X:2527302-2527324 ACCCAGGGGAGAGTGGCAGGGGG - Intergenic
1186705327 X:12134649-12134671 TGCCCCGGGGGATTCTCAGGGGG - Intergenic
1187294567 X:17986218-17986240 ATCCAAGGGGGGGTGGCAGGTGG + Intergenic
1188006663 X:25020610-25020632 TCCCACGGGCGAGAAGCAGGTGG + Intergenic
1188904723 X:35778581-35778603 GGCCACGTGGGAGTGTCTGGGGG - Intergenic
1189346413 X:40245062-40245084 TGCCACGGGGGAGTGTGGAGTGG - Intergenic
1192845912 X:74907051-74907073 TGCCTCCTGGGTGTGGCAGGGGG - Intronic
1194995652 X:100588978-100589000 TGCAACTGAGGTGTGGCAGGAGG - Intronic
1196457279 X:115899400-115899422 TGCTATGGGGGAGTGGTAGATGG + Intergenic
1196457690 X:115901637-115901659 TGCTATGGGGGAGTGGTAGATGG + Intergenic
1197871944 X:131069299-131069321 CGCCACGGGGTAGTCGGAGGGGG - Intronic
1200111312 X:153742352-153742374 TGACACGGGGCAGTGACAGGAGG + Intronic