ID: 928438362

View in Genome Browser
Species Human (GRCh38)
Location 2:31270864-31270886
Sequence CTGCCTGTCTTCCTTAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928438362 Original CRISPR CTGCCTGTCTTCCTTAGATC AGG (reversed) Intergenic
900890069 1:5443255-5443277 CCGCCTGTCTGCCTTTGAACTGG + Intergenic
905512914 1:38536989-38537011 CTGCCTCTGTTTCTTAGCTCTGG - Intergenic
906688005 1:47775047-47775069 CTGCCACACTTCCTTAGAGCAGG + Intronic
907110455 1:51922024-51922046 CTGCTTGTCTTTCTCAGGTCAGG - Intronic
911642827 1:100306997-100307019 CTGCCTTTCTACGTTAGACCTGG - Intergenic
912679380 1:111719487-111719509 CTGCCTGTCTTCCTTGGAGAGGG + Intronic
915222354 1:154385103-154385125 CTCCCTGTCTTCATTGGAGCAGG - Intergenic
916016011 1:160750580-160750602 CAGCCTGTGCTCCTTAGTTCTGG + Intronic
916743013 1:167662679-167662701 CTCCCTGCCTTTCTTAAATCAGG - Intronic
918396138 1:184114999-184115021 CTGCCTGACTGCCTTTGAACTGG - Intergenic
919862576 1:201750738-201750760 CTGCCTGCCTTTCTGAGATTGGG - Intronic
920081768 1:203379971-203379993 CTGCCTGGCTTCCTTTGAACAGG - Intergenic
920100196 1:203512540-203512562 CTGCCTGTCTCCCTGAGGCCAGG - Intergenic
920807384 1:209247877-209247899 CTGCCTGACTGCCTTTGAGCTGG - Intergenic
920875940 1:209835858-209835880 CTACCAGTCTTACTCAGATCTGG + Intronic
921174772 1:212584499-212584521 CTGCCTGACTGCCTTTGAGCTGG - Intronic
1064262844 10:13799676-13799698 CTGCCTCTCCTCCTTGGAACTGG + Intronic
1065444799 10:25787248-25787270 CTGCCTGGCTTCTTCAGAGCAGG + Intergenic
1067657636 10:48208807-48208829 AGGCCTGTCTTCCTTACAACAGG + Intronic
1069464797 10:68628780-68628802 CTGCATGATTTCCTTAGGTCTGG - Intronic
1071094433 10:81956975-81956997 ATGCCTGTCTTCCATAGCTGTGG + Intronic
1071096723 10:81984062-81984084 CTGCCTATATTCCTTAGCTTGGG - Intronic
1071438508 10:85668923-85668945 CTCTCTGTCTTCCTGTGATCTGG - Intronic
1071967404 10:90866307-90866329 TTGCCTGACTGCCTTTGATCTGG + Intergenic
1073072693 10:100804907-100804929 CTGTCTGTCTTCTTCAGATGTGG + Intronic
1073853129 10:107644333-107644355 CTGACTGTCATCTTTAGGTCAGG - Intergenic
1074029099 10:109666220-109666242 CTGCTTGTCTTCCTGATATTAGG - Intergenic
1075945453 10:126429164-126429186 CTGCCATTCTTTCTGAGATCTGG - Intronic
1077761861 11:5109853-5109875 CTGCCTAACTTCCTCAGCTCTGG - Intergenic
1078801651 11:14650790-14650812 CTGCCTGCTTTCCTTGGCTCAGG - Intronic
1079334454 11:19559045-19559067 GTGTCTCTCTTCCTTAAATCTGG - Intronic
1081808540 11:45902778-45902800 CTGCCTGTCGTCCCCAGAGCGGG + Exonic
1083159277 11:60844708-60844730 CTGCCTGTTTTCCTTTAAACCGG + Intronic
1087411926 11:97802060-97802082 GTGACAGACTTCCTTAGATCGGG + Intergenic
1089121112 11:116136016-116136038 CTGCCTTTCTTCCTTGAAGCAGG + Intergenic
1089175121 11:116543020-116543042 CTGCTTGACTTCTCTAGATCTGG - Intergenic
1089246366 11:117123486-117123508 CTGTCTGTCTTCCTAAGTTTTGG - Intergenic
1091524717 12:1287589-1287611 CTGCCTGACTGCCTTCGAACTGG + Intronic
1091777732 12:3195605-3195627 CTGCCTCAGTTCCTTAGATTGGG - Intronic
1092878604 12:12870200-12870222 CTGCCTGTCTCCCGTATAGCTGG - Intergenic
1092972731 12:13713395-13713417 CTGCCTGTCTTCGTAAGATGGGG - Intronic
1093153287 12:15649496-15649518 CTGCCTGTATTTCATAGTTCAGG - Intronic
1093936771 12:25009827-25009849 CTGCCTGCCTTCCTTCCAACTGG - Intergenic
1096501455 12:52066321-52066343 CTGCCTGACTGTCTTAGAACTGG - Intergenic
1097597707 12:61654470-61654492 CGGTTTTTCTTCCTTAGATCCGG + Intergenic
1098152487 12:67561437-67561459 CTGCCTGTCTTAGTCAGCTCAGG + Intergenic
1101018724 12:100529925-100529947 CTGCCTCTCCTCCTTAAATGTGG + Intronic
1101936027 12:109057992-109058014 CTGCCTGTCCTGCTTTCATCAGG + Exonic
1101997160 12:109533646-109533668 CTGCCTGCCTTGCTGAGATATGG - Intronic
1102091747 12:110196005-110196027 CTCCCTGTGTTCATCAGATCAGG + Intronic
1103852680 12:123943543-123943565 CTGCCTGCCCTCCTTGGCTCTGG + Intronic
1103891917 12:124245768-124245790 CTGCCTGTCTTGCTGTGTTCTGG + Intronic
1104576062 12:129966776-129966798 CTGCCTGACCTCCTGTGATCAGG - Intergenic
1105294129 13:19073399-19073421 CTGCCTGTCTGCCTCACCTCTGG - Intergenic
1105728778 13:23190721-23190743 CTGGCTGTCTTCCTCACAACAGG - Intronic
1108429521 13:50340125-50340147 CTGGCTGCCTGCCGTAGATCCGG + Intronic
1108543527 13:51467468-51467490 CTGCCTGACTGCCTTTGAGCTGG + Intergenic
1111625492 13:90779344-90779366 CTCTCTGTGTTCTTTAGATCTGG + Intergenic
1112167177 13:96931937-96931959 CTCTCTCTCTTCCTTACATCTGG + Intergenic
1112336772 13:98522935-98522957 CAGCCTGCCTTCCTGAGGTCAGG + Intronic
1112832177 13:103466707-103466729 CTTTATGTCTTCATTAGATCAGG + Intergenic
1114486941 14:23068464-23068486 CTCCCTGTCTTGCTTACATCAGG - Intronic
1115335553 14:32241441-32241463 CTGCCTGTATCCCTTAGACCTGG - Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1117278354 14:54212643-54212665 CTGCCTGACTGCCTTTGATCTGG - Intergenic
1118533947 14:66737463-66737485 ATGCCTGTCTACCTTGGATTGGG - Intronic
1119682753 14:76605078-76605100 CAGCCTGTCTTCCTTGAACCAGG - Intergenic
1120490672 14:85175011-85175033 CTGCCTGACTTCATTTGAACTGG - Intergenic
1121261944 14:92572782-92572804 CTGCCTATCTCCCTTGGACCTGG - Intronic
1121362321 14:93272964-93272986 CTGCATGTCAGCCTTTGATCTGG + Intronic
1121742124 14:96261481-96261503 CATCATGTCTTCCTTAGATGAGG + Intronic
1122605967 14:102947939-102947961 CTGCCCGTGTTTCTTACATCTGG - Intronic
1125351395 15:38771040-38771062 CTGCATGTATTCCTTGAATCTGG - Intergenic
1125463088 15:39924615-39924637 CTGCCTGACTACCTTCGAACTGG + Intergenic
1127042391 15:54991147-54991169 CTGCCTGGATTCCTCAGAGCTGG - Intergenic
1129348069 15:74937317-74937339 CTGGCTATCTTCCGGAGATCAGG + Intronic
1129718140 15:77863638-77863660 GAGGCAGTCTTCCTTAGATCAGG - Intergenic
1129980308 15:79863282-79863304 CAGCCTGTCCTCCTTATTTCTGG + Intronic
1130156534 15:81355213-81355235 CTACCTGTCTTCATGAGGTCAGG + Intronic
1130392454 15:83470581-83470603 CTACCTGTCTTCCTTTTAACTGG + Intronic
1130440443 15:83947400-83947422 TTGCCTTGGTTCCTTAGATCTGG + Intronic
1133678131 16:8095196-8095218 CTGCCTGCCTGCCTTTGAACTGG - Intergenic
1138258359 16:55591619-55591641 TTGGCTGTCATCCTTAAATCGGG + Intergenic
1138538449 16:57673304-57673326 CTGCATTCCTTCCTTAGGTCAGG + Exonic
1139509673 16:67419985-67420007 CTGCCTGCATTCCTTGGCTCAGG - Intergenic
1140303798 16:73783448-73783470 CTGGGTGTCATCCTTAGATGGGG - Intergenic
1140706974 16:77639876-77639898 CTGCCTGCATTCCTTAGCTGTGG - Intergenic
1140709922 16:77667877-77667899 CTGCCTTTCTTCCTTCCTTCTGG - Intergenic
1141391580 16:83668972-83668994 CTGCCTGCCGTCCTTAGACTGGG + Intronic
1141838608 16:86559767-86559789 CTGCCTGTCTTCCCTGTATGGGG + Intergenic
1142757195 17:2023587-2023609 CTGCCTGACCTGCTTATATCTGG + Intronic
1146608666 17:34285603-34285625 CTGCTTGACTTCCTAGGATCTGG + Intergenic
1148806742 17:50267583-50267605 GTGCCTGGCTTCCTTATCTCCGG - Intergenic
1153425945 18:4963481-4963503 CTTCCTGTCTTCCTTAGTGAAGG - Intergenic
1160918684 19:1509785-1509807 CTGCCTGTCTCCCTGAAATCTGG + Intronic
1162228425 19:9244095-9244117 CTGTCTGTCTTTATTTGATCAGG + Intergenic
1163286215 19:16349785-16349807 ATGGCTGTCTTCCTTTGCTCTGG - Intergenic
1163290419 19:16376119-16376141 TTACCTGTCTTCCCTAGATAGGG - Intronic
1163382951 19:16980681-16980703 CTGCGTGTCTTCCATAGGTTGGG - Exonic
1165657623 19:37548423-37548445 CTGACTGCCTCCCTTTGATCTGG - Intronic
1167006421 19:46778991-46779013 CTTCCTGCCTTCCTGAGGTCAGG + Intronic
925073663 2:991758-991780 CTGCATGTCATCCTGAGACCAGG + Intronic
927530609 2:23795448-23795470 CTTCATTTCTTCCATAGATCTGG + Intronic
927870150 2:26618159-26618181 CTGCCTGTCCACCTGAGATGAGG - Intronic
928438362 2:31270864-31270886 CTGCCTGTCTTCCTTAGATCAGG - Intergenic
929113351 2:38423767-38423789 CTGCCTGACTGCCTTTGAACTGG + Intergenic
929688229 2:44053001-44053023 CTGGATATCTTCCTTAGCTCTGG - Intergenic
931375554 2:61704680-61704702 CTGCCTGCATTCCTTGGCTCAGG + Intergenic
934035363 2:88084566-88084588 CAGCTTGGCTTCCTTAGATCTGG - Intronic
934779656 2:96961587-96961609 CTGCCTCTCTTCCTCTAATCAGG + Intronic
937148740 2:119671148-119671170 CTGCCTGACTGTCTTAGAACTGG + Intergenic
938995249 2:136671668-136671690 CTGCCTCTCTTCCTAAGTTAAGG + Intergenic
940709838 2:157148664-157148686 CTGCCTGTCTCCTGTAGACCTGG + Intergenic
942472968 2:176281697-176281719 CTGCCTGTTTTTCTTAGATCTGG + Intronic
942567717 2:177283068-177283090 CTTCCTGTCTTCCTGAGACATGG + Intronic
942925253 2:181424921-181424943 CTGCCTTTCTTCCTTAGAGAAGG + Intergenic
943639637 2:190344010-190344032 CTGCCCCTCCTCCTTGGATCTGG + Intronic
945920015 2:215746384-215746406 CTGCCTGACTGCCTTTGAACTGG + Intergenic
946603838 2:221380121-221380143 CTTCCTATGGTCCTTAGATCTGG - Intergenic
947025032 2:225727893-225727915 CTGCCTGACTGCCTTAGAGCTGG + Intergenic
947890080 2:233609834-233609856 TTGCCTCTCTTCCTTAGATTAGG + Intergenic
948101975 2:235382382-235382404 CTGCCTGACTGCCTTTGAGCTGG + Intergenic
948169461 2:235889389-235889411 CTGCGTGTCTCCCTCAGAACTGG + Intronic
1169268012 20:4179047-4179069 GTGCCTGTCCTCCATAGAGCAGG - Intronic
1169347012 20:4836607-4836629 CTGTCTGTCTTTCATACATCTGG + Intergenic
1172698355 20:36837288-36837310 CTGCCTGTCTTCGGAAGCTCTGG - Intronic
1174182310 20:48682632-48682654 CTGCCTGTCTTCCTCTGGCCTGG - Intronic
1176205084 20:63883846-63883868 CTGCCTGCCTGCCTTAGGTTAGG + Intronic
1177734273 21:25069694-25069716 CTGACTGTTGTCCTTATATCAGG + Intergenic
1181614865 22:24046916-24046938 CTGCCTGACTACCTTTGAACTGG - Intronic
1182297551 22:29318619-29318641 CTGCCTGTCTGCCTGGGATGTGG + Intronic
1183050120 22:35254159-35254181 CAGGCAGTTTTCCTTAGATCAGG + Intergenic
950495021 3:13328560-13328582 CTGTCTGTCTTCCTCTGAGCTGG + Intronic
952464495 3:33567293-33567315 CTGCCTGCAGTCTTTAGATCAGG - Intronic
955376099 3:58398474-58398496 CTGCCTGCCTGCCCTAGGTCTGG - Intronic
956389776 3:68759130-68759152 CTGCCTGACTGCCTTTGAGCTGG - Intronic
958522195 3:95204394-95204416 CTGCCTGGATTCCTCAGAACAGG + Intergenic
959136368 3:102426969-102426991 CTGCCTTTGCTCTTTAGATCTGG - Intronic
959615897 3:108346988-108347010 CTGCCTTTCTCCCTCACATCTGG + Intronic
960375093 3:116890866-116890888 CTTCCTGTCTCCCTTACCTCTGG - Intronic
961797472 3:129419892-129419914 CTGCCTGTCTTCCTACGGCCTGG - Intronic
964052649 3:152415189-152415211 TTGCCTGTGTTCATTTGATCCGG - Intronic
965185742 3:165460401-165460423 CTGCCTGACTACCTTTGAACTGG + Intergenic
965625400 3:170679329-170679351 CTGCCTGTCTTGCTTATAGTTGG + Intronic
968273626 3:197423590-197423612 CTGCCTCTCTTTCCTAGTTCTGG - Intergenic
968915353 4:3494842-3494864 CTGCCTGTCTCCCCTACATGGGG + Intronic
970580045 4:17466752-17466774 CTGCCTGCCTTCCTTAGCTTAGG - Intronic
970591743 4:17565887-17565909 GTGCCTGTCCTCCTTAGATGGGG + Intergenic
971394064 4:26212602-26212624 CTGCCTTTCTGCCTTGGAGCTGG + Intronic
972319970 4:37964547-37964569 GTGCCTGCCTTCCCGAGATCCGG + Intronic
972465041 4:39347347-39347369 CTGCCCGACTGCCTTAGAGCTGG + Intronic
978485487 4:109248914-109248936 CTGACTGTCTCCCTTATATGAGG - Intronic
980255297 4:130372256-130372278 TTGCCGGGCTTCTTTAGATCCGG + Intergenic
981123761 4:141082506-141082528 CTGCCTTTCTACCTCAGAGCAGG + Intronic
981746983 4:148061788-148061810 CTGCCTGGCTTCGTGAGATCTGG + Intronic
982980150 4:162123141-162123163 CAGCCTGTGTTCTTTAAATCTGG + Intronic
983932886 4:173472645-173472667 CTGCCTGTCTGCCTTTGAGCTGG - Intergenic
985225882 4:187761527-187761549 CTGCCTGACTGCCTTTGAACGGG - Intergenic
985505571 5:278345-278367 CTTTCTGTCTTCCCTAGAACAGG - Intronic
985541241 5:488679-488701 CTGTCTGTCTTGCTCAGATGGGG - Intronic
985577495 5:680290-680312 GTGTCTGTCTTCAGTAGATCCGG - Intronic
985592426 5:772386-772408 GTGTCTGTCTTCAGTAGATCCGG - Intergenic
987142373 5:14959468-14959490 CTTCCTGGCTTCCCTAGCTCAGG + Intergenic
987207419 5:15641745-15641767 CTGCCTGACTGTCTTTGATCTGG + Intronic
987640504 5:20605913-20605935 CTGTCTGTCTCCCACAGATCAGG - Intergenic
988055553 5:26090068-26090090 CTGTCTGTCTGTCTTAGAGCTGG - Intergenic
992064428 5:73092630-73092652 CTGCCTGTCTTACATAATTCAGG - Intergenic
992443738 5:76816530-76816552 CTGCCTGGCTTCCAGAGATTAGG - Intergenic
992832513 5:80608123-80608145 CTGCCTGACTGCCTTTGACCTGG - Intergenic
993491922 5:88562046-88562068 CTGCTTGTCTTAGTTAGTTCAGG - Intergenic
993599854 5:89908381-89908403 CTGCCTGGCTACTTTAGATTTGG - Intergenic
994898415 5:105737002-105737024 CAGCCTGTCCTCATTAGATAGGG - Intergenic
995280946 5:110335074-110335096 ATGCCTTTCTTCTTTAGGTCAGG - Intronic
995305586 5:110643988-110644010 CTGACTGTCTTCTATATATCAGG + Intronic
995797956 5:115961880-115961902 CAGCCTGGCTTCCTGAGCTCTGG + Intergenic
996418271 5:123233507-123233529 CTTCCTGTATTCCTTGGCTCAGG - Intergenic
997360736 5:133293133-133293155 CTGCCTCTCCTTCTTAGCTCTGG - Intronic
997654823 5:135546948-135546970 CTGCCTCTCTTCCTTATATAAGG - Intergenic
998180066 5:139930789-139930811 CTGCCTGTCTGCTTTAGCCCTGG - Intronic
998201996 5:140132335-140132357 CACCCTTTCTTCCTTAGAGCAGG + Intergenic
998503704 5:142654995-142655017 CTGACTGTTTTCCTTGGAGCTGG - Intronic
1000619205 5:163463635-163463657 TTGCCTGTGTTCCTTTGACCCGG + Intronic
1001452356 5:171836454-171836476 CCGCCTGTATTCCTGAGAACTGG - Intergenic
1003237087 6:4304506-4304528 CTGCCTGTCTGCCTCACATGAGG + Intergenic
1004548670 6:16625373-16625395 TGGCCTGTCTTCCTTGCATCTGG - Intronic
1007514292 6:42399061-42399083 CTGCCTGACTTCCTTCCATCTGG - Intronic
1009907086 6:69883395-69883417 CTGCCTGTCCACCTGATATCCGG - Intronic
1010388993 6:75314950-75314972 CTGTCTGTCTTCTTTGGATTTGG + Exonic
1011403386 6:86989249-86989271 TTGCCTGTCTTCCTGAGTACCGG + Intronic
1013237091 6:108206793-108206815 CTTCCTGTCTTACTTACATGGGG - Intergenic
1013967095 6:115967914-115967936 GTGCCTGACTTCCCAAGATCTGG - Intronic
1017191885 6:151662693-151662715 CTGCCCGTCTTTCTGAGAACAGG + Intronic
1018497241 6:164361221-164361243 CTGCCAGTGTTCCTTGGATTAGG - Intergenic
1019972669 7:4554063-4554085 CTGCCTGACTGCCTTTGAGCTGG - Intergenic
1020798202 7:12701300-12701322 CTGCCTTTCTGTCTTAGAGCTGG - Intergenic
1022316827 7:29253242-29253264 CGGCCTGTCATCCTTATATGTGG + Intronic
1025936240 7:66039930-66039952 CTGCCTTTCTGTCTTAGAGCTGG - Intergenic
1025947928 7:66118979-66119001 CTGCCTTTCTGTCTTAGAGCTGG + Intronic
1026768330 7:73174541-73174563 CTGCCTGCCTGCCTTAGCTAAGG - Intergenic
1027044793 7:74984246-74984268 CTGCCTGCCTGCCTTAGCTAAGG - Intronic
1027078843 7:75218110-75218132 CTGCCTGCCTGCCTTAGCTAAGG + Intergenic
1027661309 7:80991160-80991182 CTGCTTGTCTGCCTTAAATTGGG - Intergenic
1028779480 7:94719663-94719685 CTGCCTGGATTCCTCAGAGCTGG + Intergenic
1029118115 7:98248372-98248394 CTGCCTGTCTCCTTTTGCTCCGG - Intronic
1029421256 7:100472850-100472872 CTTCCTGTCCTCCCCAGATCAGG - Intronic
1030247891 7:107405527-107405549 GTGTCTGTCTTCCTCAGACCTGG - Intronic
1030724359 7:112908315-112908337 CTGCCTGACTGCCTTTGAACTGG + Intronic
1030783498 7:113630865-113630887 CTGCCTTTCTTCCTTAGTTGTGG - Intergenic
1031038334 7:116812654-116812676 CTGACTGTCTCCTTTAGATGGGG - Intronic
1035112115 7:156491995-156492017 CTGCCTCTGTCCCTTGGATCTGG - Intergenic
1040391464 8:46954339-46954361 CTGCCTGACTGCCTTTGAGCTGG - Intergenic
1040617973 8:49059029-49059051 CTGGCTGGCTTTCTTAGATATGG + Intronic
1043369671 8:79575966-79575988 CTGCCTTTTTTCCTGAAATCTGG + Intergenic
1047388950 8:124434359-124434381 CTGCCTTTCTGCTTTAGGTCAGG + Intergenic
1047607959 8:126493372-126493394 CTGCCTGTCTTCATTTCTTCAGG - Intergenic
1048437153 8:134429089-134429111 CTGCCTGTCTTCATTAACACTGG + Intergenic
1049718508 8:144104836-144104858 CTGCCTGGCTGGGTTAGATCAGG - Exonic
1051271652 9:15361101-15361123 CTGCCTTTCTTTCTAAAATCTGG + Intergenic
1051459066 9:17293342-17293364 CTGCCTGGATTCCTCAGAGCTGG + Intronic
1053422571 9:37988851-37988873 CTGCCTGACTGCCTTTGAGCTGG + Intronic
1055383174 9:75731439-75731461 CTGCCTGACTGCCTTTGAGCTGG + Intergenic
1056602240 9:88055223-88055245 CTGCCTGGCTTGCTGAGATCTGG + Intergenic
1057265744 9:93616582-93616604 CTGCCTGTCTGCCTCACCTCTGG + Intronic
1059368569 9:113806686-113806708 CAAACTGTCTTGCTTAGATCTGG - Intergenic
1059377783 9:113899341-113899363 CTGTCTGTGTGACTTAGATCAGG + Intronic
1059381764 9:113932632-113932654 CTTCCTGGCTTCCTTGGATGTGG + Intronic
1062602643 9:137325224-137325246 CTGCATTTCTACCTTAGATCTGG - Intronic
1062702105 9:137912678-137912700 TTCCCTGTCTTCCTGAGATAAGG + Intronic
1186068507 X:5792109-5792131 CTGCCTGTCTTACTTGGCTTGGG - Intergenic
1186167659 X:6844061-6844083 CTGCCTGCTTTCCTTGGCTCAGG + Intergenic
1189338033 X:40182543-40182565 CTGCCTGACTGCCATAGATTGGG + Intergenic
1195069536 X:101266031-101266053 CTGCCTGTCTTCCTGTGTTCCGG + Intergenic
1197261849 X:124328238-124328260 GGGCCTGTCCTCCTTAGATTAGG + Intronic
1198257688 X:134938994-134939016 CTGCCTGTCTTCCAAAGCTGTGG - Intergenic
1198549040 X:137725346-137725368 CTGCCTGACTTCCTTCCAGCTGG - Intergenic
1199792989 X:151172283-151172305 CTGCCTGTCTAACTTGGACCAGG + Intergenic
1200006174 X:153085905-153085927 CTGCCTGTTTTCCTGATATTTGG - Intergenic
1200211473 X:154348615-154348637 CTGCTTGTCTTCTTTGGTTCTGG - Intronic
1200228619 X:154432914-154432936 CTGTTTGTCTTCCATAGCTCTGG + Exonic
1200289599 X:154859086-154859108 CTGCCTGTCTGCCTTTGGACTGG + Intronic
1201634604 Y:16108533-16108555 TTGCCTTTCTTCCTTACCTCTGG - Intergenic