ID: 928438827

View in Genome Browser
Species Human (GRCh38)
Location 2:31274380-31274402
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928438827_928438832 -4 Left 928438827 2:31274380-31274402 CCCTCATTCCAGAAAAGCCTAGT No data
Right 928438832 2:31274399-31274421 TAGTCTTCAGGAATATGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928438827 Original CRISPR ACTAGGCTTTTCTGGAATGA GGG (reversed) Intergenic
No off target data available for this crispr