ID: 928439821

View in Genome Browser
Species Human (GRCh38)
Location 2:31283140-31283162
Sequence GTAAAGCCAAGGCCACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928439817_928439821 -7 Left 928439817 2:31283124-31283146 CCCTGACAAATACTTTGTAAAGC No data
Right 928439821 2:31283140-31283162 GTAAAGCCAAGGCCACAGGCTGG No data
928439814_928439821 30 Left 928439814 2:31283087-31283109 CCAGCTTAGGTCAGGCCATCACT No data
Right 928439821 2:31283140-31283162 GTAAAGCCAAGGCCACAGGCTGG No data
928439818_928439821 -8 Left 928439818 2:31283125-31283147 CCTGACAAATACTTTGTAAAGCC No data
Right 928439821 2:31283140-31283162 GTAAAGCCAAGGCCACAGGCTGG No data
928439816_928439821 -1 Left 928439816 2:31283118-31283140 CCTCAGCCCTGACAAATACTTTG No data
Right 928439821 2:31283140-31283162 GTAAAGCCAAGGCCACAGGCTGG No data
928439815_928439821 15 Left 928439815 2:31283102-31283124 CCATCACTCTGTTAGACCTCAGC No data
Right 928439821 2:31283140-31283162 GTAAAGCCAAGGCCACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928439821 Original CRISPR GTAAAGCCAAGGCCACAGGC TGG Intergenic
No off target data available for this crispr