ID: 928440700

View in Genome Browser
Species Human (GRCh38)
Location 2:31289602-31289624
Sequence AAATTCAGGCCACATGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928440692_928440700 12 Left 928440692 2:31289567-31289589 CCCTCCTCCTCTTTAGATACCAT No data
Right 928440700 2:31289602-31289624 AAATTCAGGCCACATGTCAAAGG No data
928440697_928440700 -7 Left 928440697 2:31289586-31289608 CCATCAACTGGTCACCAAATTCA No data
Right 928440700 2:31289602-31289624 AAATTCAGGCCACATGTCAAAGG No data
928440694_928440700 8 Left 928440694 2:31289571-31289593 CCTCCTCTTTAGATACCATCAAC No data
Right 928440700 2:31289602-31289624 AAATTCAGGCCACATGTCAAAGG No data
928440693_928440700 11 Left 928440693 2:31289568-31289590 CCTCCTCCTCTTTAGATACCATC No data
Right 928440700 2:31289602-31289624 AAATTCAGGCCACATGTCAAAGG No data
928440695_928440700 5 Left 928440695 2:31289574-31289596 CCTCTTTAGATACCATCAACTGG No data
Right 928440700 2:31289602-31289624 AAATTCAGGCCACATGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928440700 Original CRISPR AAATTCAGGCCACATGTCAA AGG Intergenic