ID: 928441594

View in Genome Browser
Species Human (GRCh38)
Location 2:31296770-31296792
Sequence CCATCTGGGGCCAGTCTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928441588_928441594 12 Left 928441588 2:31296735-31296757 CCAAGTTGGCGTGTCAAAGATCT No data
Right 928441594 2:31296770-31296792 CCATCTGGGGCCAGTCTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928441594 Original CRISPR CCATCTGGGGCCAGTCTCGG AGG Intergenic
No off target data available for this crispr