ID: 928442639

View in Genome Browser
Species Human (GRCh38)
Location 2:31304847-31304869
Sequence GACCCACGTATTCTACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928442639_928442642 16 Left 928442639 2:31304847-31304869 CCTGTGGGTAGAATACGTGGGTC No data
Right 928442642 2:31304886-31304908 CCATCACTCTGTGACCTTCTTGG No data
928442639_928442643 17 Left 928442639 2:31304847-31304869 CCTGTGGGTAGAATACGTGGGTC No data
Right 928442643 2:31304887-31304909 CATCACTCTGTGACCTTCTTGGG No data
928442639_928442644 18 Left 928442639 2:31304847-31304869 CCTGTGGGTAGAATACGTGGGTC No data
Right 928442644 2:31304888-31304910 ATCACTCTGTGACCTTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928442639 Original CRISPR GACCCACGTATTCTACCCAC AGG (reversed) Intergenic
No off target data available for this crispr